ID: 1090982147

View in Genome Browser
Species Human (GRCh38)
Location 11:131732520-131732542
Sequence TTTCAGAAGGGGAAATTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 355}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090982142_1090982147 10 Left 1090982142 11:131732487-131732509 CCGAATTGGACAACAAACTTTCT 0: 1
1: 0
2: 0
3: 17
4: 218
Right 1090982147 11:131732520-131732542 TTTCAGAAGGGGAAATTGGAAGG 0: 1
1: 0
2: 1
3: 49
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090982147 Original CRISPR TTTCAGAAGGGGAAATTGGA AGG Intronic
902340742 1:15782113-15782135 TTTCACATGGGGAAACTGGTGGG + Intronic
903613411 1:24633717-24633739 TATAAGAAGGGGAAATTGGCTGG - Intronic
904935187 1:34125204-34125226 TTTCACAAGTGGAAAAGGGAGGG + Intronic
905466659 1:38159431-38159453 TTTCACTAGGGGAAATAGTAAGG + Intergenic
906474320 1:46157830-46157852 TTTCAGAAGGGAAGATAGAAGGG - Intronic
907262708 1:53233132-53233154 TTTCAGGATGGAAAAATGGATGG + Intronic
908108194 1:60867795-60867817 TTTCAGCTGGGGAAATTGTTTGG - Intronic
908142003 1:61194964-61194986 TTTCAAAAGGGGAAATTGATAGG - Intronic
909041076 1:70652715-70652737 TCTCAGGAGGTGAGATTGGAAGG + Intergenic
910179230 1:84463227-84463249 TTTCTGAACGAGAAAATGGAAGG - Intergenic
910287421 1:85571170-85571192 TTTCAGAAGGGGAAAGAGAAGGG - Intronic
910781227 1:90936348-90936370 TTTCAGAAGGGTAAAACGCAGGG - Intronic
910923472 1:92374300-92374322 TTTCAGAAGTGGAAGTTAGGAGG + Intronic
915130216 1:153690491-153690513 TATGAGAAGGGGAACTTGGGAGG - Intronic
915297481 1:154931368-154931390 CTTCAGAAAGGGAACTTGGAAGG - Intronic
915374779 1:155383986-155384008 TTTTAAAAGAGTAAATTGGATGG + Intronic
916523389 1:165586346-165586368 TTCCAGAAAGGGAAACAGGAAGG - Intergenic
916740899 1:167646225-167646247 ATTCAGAAGTGGAGTTTGGAGGG + Intronic
917322629 1:173799487-173799509 TCTCAGTAGTGGAAATTGGTAGG - Intergenic
918135485 1:181670248-181670270 TATCAGCCGGGGAAATTGGGAGG - Intronic
918779327 1:188676474-188676496 TTTCAGAAGGAGAAAATGCCAGG + Intergenic
920188135 1:204175005-204175027 TTTCAGAAGGGGAAGAGGGTTGG + Intergenic
920905268 1:210158134-210158156 TTTCAGAAGGAGAAATTGAGTGG + Intronic
921241599 1:213189774-213189796 GTTCGGAAGGGGAAGTGGGAAGG - Intronic
921948939 1:220908958-220908980 TTGCAGAGGAGGAAAATGGAAGG + Intergenic
922414268 1:225406130-225406152 TTTTAGAGGGGAAAATGGGATGG - Intronic
922600013 1:226843752-226843774 TTTCAGAAAGTGAAACAGGAAGG - Intergenic
923259088 1:232249656-232249678 TTTCAGCAGAGGAAAGTGAAAGG - Intergenic
923320018 1:232822651-232822673 TTCCAGGAAGGGTAATTGGATGG + Intergenic
923349692 1:233091984-233092006 TTTCAGAAGAGGAAACTGATGGG - Intronic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
924202845 1:241678037-241678059 TTTCAGAAGGAGAAACAGGGAGG + Intronic
1062893810 10:1087392-1087414 TTTCTGAAGAGGAAATTTGAAGG - Intronic
1063195416 10:3736769-3736791 TTTCAGCATGTGAATTTGGAGGG + Intergenic
1065703052 10:28444201-28444223 TTTCAGAAGAGGAAATGGATTGG + Intergenic
1065971765 10:30811276-30811298 TTACAGAAGAGGAAATAGAATGG + Intergenic
1065990828 10:31008307-31008329 TTTCAAAAGGGTAAATTGCATGG - Intronic
1066413102 10:35192761-35192783 TTTCAACAGAGGAAATTGGGTGG + Intronic
1066492827 10:35910509-35910531 TTTCTGAAGTAGAAATTGGGTGG - Intergenic
1067841910 10:49687909-49687931 TTTAAGAAGGAGAAATGGCAGGG + Intronic
1069875519 10:71560601-71560623 TCCCAGATGGGGAAAATGGAAGG - Intronic
1073243891 10:102075866-102075888 ATTCAGAAGAGAAAAATGGATGG - Intergenic
1073507673 10:104014471-104014493 TTTCAGGAGAGGAAAAAGGAGGG - Intronic
1074089457 10:110235050-110235072 TCTAAGAAGCAGAAATTGGATGG - Intronic
1074108355 10:110405090-110405112 TACCAGATGGGGAAGTTGGATGG - Intergenic
1075597769 10:123744528-123744550 GTTCAGAAGGGGGAGTTGCAGGG - Intronic
1076069411 10:127474841-127474863 GCTCAAAAAGGGAAATTGGAAGG - Intergenic
1076469281 10:130707457-130707479 TCTGAAAAGGGGAAATTGCATGG + Intergenic
1079650326 11:22920348-22920370 TATCAGAAGTTAAAATTGGAAGG - Intergenic
1079706133 11:23621460-23621482 TTTGAGAAGGGAATAATGGAAGG - Intergenic
1080038143 11:27730586-27730608 TCTCAGCAGGGCAAAGTGGAAGG - Intergenic
1081384390 11:42454200-42454222 TTTCAGAACGTGAATTTGGGGGG - Intergenic
1081554611 11:44146814-44146836 TTCCAGAAGGGGAAGGTTGAAGG + Intronic
1084429276 11:69102268-69102290 TCCCAGAAGGGGAAATAGGTTGG + Intergenic
1084875077 11:72125092-72125114 CTTCAGAGGGGGAAATGAGAGGG - Intronic
1086127073 11:83360010-83360032 TTCAAGATGAGGAAATTGGAGGG - Intergenic
1086153194 11:83636134-83636156 TTTAAGAAGGGGCAGCTGGAAGG - Intronic
1087681984 11:101228551-101228573 TGGCAGAAGGGGAAAAGGGAGGG + Intergenic
1088474203 11:110218497-110218519 TTTCCCAAGGGGAAAGTGTAAGG - Intronic
1089044920 11:115492276-115492298 TTTCAAAAGGAAAAATTGAAAGG + Intronic
1090064259 11:123489625-123489647 TTTCAGAAGAGTATATTTGAGGG + Intergenic
1090982147 11:131732520-131732542 TTTCAGAAGGGGAAATTGGAAGG + Intronic
1092034005 12:5315006-5315028 TTTAAAAAGGGGAAAGAGGAAGG - Intergenic
1093624852 12:21332844-21332866 TTTCAACATGGGAATTTGGATGG + Intronic
1094421718 12:30278289-30278311 ATTTAGAAGGGGAAATTATAAGG - Intergenic
1094478000 12:30856524-30856546 TTTCACAAGGTGTAATAGGACGG + Intergenic
1094804826 12:34079428-34079450 TTTCAGAAAATGAAATTGCAGGG + Intergenic
1095085721 12:38056012-38056034 TTTCTGAAGGGGAAAAGGGAAGG - Intergenic
1095592238 12:43916144-43916166 TGTTAGAAGGGGAAATGGAATGG + Intronic
1096084762 12:48857980-48858002 TATGTGAAGTGGAAATTGGAGGG - Exonic
1096403075 12:51323633-51323655 TTACAGATGATGAAATTGGAGGG - Intronic
1096421095 12:51458503-51458525 TGTCAGAAGGGGAAAAGGGCAGG + Intronic
1098807569 12:75038762-75038784 TTTTGGCAGTGGAAATTGGATGG + Intergenic
1100122050 12:91380197-91380219 TTTCAGAAGGTGAATTTGAAAGG - Intergenic
1101478573 12:105074998-105075020 TTTGAGAAGAGGAAATTAAATGG - Intronic
1101593930 12:106147059-106147081 TTCCAGAATAGGAAATTGAATGG - Intergenic
1101829522 12:108246510-108246532 GTGCAGAAGGGGAACCTGGATGG - Intronic
1102014867 12:109641424-109641446 ATTCAGAAGGGGAGGTTAGAAGG - Intergenic
1102986046 12:117279553-117279575 TTTCAAAAGGTAAAATTGCATGG + Intronic
1103027953 12:117589118-117589140 TCTCAGAAGGGGACATGGTATGG - Intronic
1103126076 12:118423624-118423646 TTCCAGAAGCGAAAAATGGAAGG - Intergenic
1103679253 12:122680329-122680351 ATACAGAAGGGGAATTTAGAGGG - Intergenic
1104141698 12:125993435-125993457 TTTCAGGAGGGGTTATTAGAAGG + Intergenic
1104590250 12:130078958-130078980 TTTCAGAAGGTGAAAGTCCAAGG + Intergenic
1104785978 12:131448243-131448265 TTTTAAAAGGAGAAATTGTAGGG + Intergenic
1106484971 13:30163936-30163958 TTCCAGAAGGGCAACTAGGAAGG + Intergenic
1110559550 13:76896155-76896177 TTTCAGCATGGGAATTTGAAGGG + Intergenic
1110676707 13:78256318-78256340 TTTCAGAAAGGATAATTGGAAGG + Intergenic
1110911213 13:80966412-80966434 TTTCAGGAGCAGAAGTTGGATGG + Intergenic
1111056930 13:82962735-82962757 TTTCAAAACAGGAAATAGGAGGG - Intergenic
1112597362 13:100820194-100820216 TTTAAGAAGGGGAAATAAAAGGG + Intergenic
1113163051 13:107405150-107405172 TTTGGGGAGGGGAAATTGAATGG - Intronic
1114420097 14:22574999-22575021 TTTTAGGAAGAGAAATTGGATGG - Intronic
1114722414 14:24896718-24896740 TCTCAGACTGGGAACTTGGAAGG + Intronic
1114759046 14:25290785-25290807 TTTCAGCAGGTAAAATTGCAAGG + Intergenic
1114931873 14:27481068-27481090 TTTCAGGAGAGGAAATAGCATGG - Intergenic
1115488150 14:33932735-33932757 TTTCAGAAGGTGAAACTGTGAGG + Intronic
1116132594 14:40876076-40876098 ATTCAGAAGAGCAAATAGGAGGG + Intergenic
1117411037 14:55451356-55451378 TTACAGATGAGGAAATTGAAGGG + Intronic
1117681803 14:58210995-58211017 TTTTGGAAGGGAAAATTGAAAGG - Intronic
1118043048 14:61938065-61938087 TTTCAGACAGGAAACTTGGAGGG + Intergenic
1118305101 14:64649110-64649132 TCTAAGAAGGGGAAATTGGCCGG + Intergenic
1118517263 14:66544241-66544263 TTTGAGAAGGTGACATTTGAGGG - Intronic
1118687591 14:68306733-68306755 TTTCAGAAGATGAACTTGCATGG + Intronic
1118951179 14:70437960-70437982 TTTAAGGAAGGGAAACTGGATGG + Intergenic
1119102115 14:71889474-71889496 TCACAGAATGGGAAACTGGAGGG + Intergenic
1120586854 14:86322370-86322392 TCTCAGAATGTGAAATTGCAGGG - Intergenic
1121371827 14:93365801-93365823 TTTCAGATAGAGAAAATGGAAGG + Intronic
1121592879 14:95132469-95132491 GTTGTGCAGGGGAAATTGGATGG - Intronic
1122081223 14:99269158-99269180 TTTGAGGAGGGGGAATTGGGGGG - Intronic
1122147844 14:99703874-99703896 TGTCAGAAGTGAAAATGGGAAGG + Intronic
1122150121 14:99721155-99721177 TTTAAGAAGGGGGCACTGGAAGG - Intronic
1122598230 14:102908033-102908055 TTTGTGAAGGGGAAGTTGCAGGG - Exonic
1123775397 15:23574526-23574548 TTTCAGGAGAGGAAATCTGAGGG + Intronic
1124422326 15:29533702-29533724 TCTAAGAAGGGGAAATTCCAAGG - Intronic
1124781687 15:32642159-32642181 TTGCAGAAAAAGAAATTGGAGGG + Intronic
1125785893 15:42317625-42317647 TTTTAGATGGGTAAATTGCATGG + Intronic
1125888781 15:43250166-43250188 TTTCAGAAGAGGAAATTGAGTGG - Intronic
1126765401 15:52006412-52006434 TTAAATAAGGGGAAATTTGAAGG + Intronic
1127111747 15:55680761-55680783 CTTCAGATGGGTGAATTGGATGG - Intronic
1127478031 15:59353087-59353109 TTTGAGAAAGGGAAATGTGAAGG - Intronic
1127703588 15:61525779-61525801 TTTCAGAAGTAGAAATTCAAAGG - Intergenic
1129027466 15:72590896-72590918 TTTCAGAATGAGAATTTGGAGGG + Exonic
1129069582 15:72939575-72939597 TTGCAGAGGGGAAAGTTGGAGGG - Intergenic
1130031489 15:80318329-80318351 TTAAAGGAGGGGACATTGGAAGG - Intergenic
1130333196 15:82937270-82937292 TTTGAGAAGGGGAAAGCTGAAGG - Intronic
1130568816 15:85022497-85022519 TTTCAGAAGGGGCTATGGCATGG + Intronic
1130806097 15:87324802-87324824 TTTCAGGAGAGGAAAATGCATGG - Intergenic
1130873483 15:87991601-87991623 TGTCAGAAAGGGAAATTGTTTGG - Intronic
1131523303 15:93133127-93133149 ATGCGGAAAGGGAAATTGGAGGG - Intergenic
1131841693 15:96444079-96444101 TGACAGAAGGGGAAAAGGGATGG + Intergenic
1132112693 15:99114067-99114089 TTACAGAACTGGAAAGTGGAGGG + Intronic
1133273688 16:4624464-4624486 TTTCAGAGGGGGCAAGTGGAAGG + Intronic
1133605575 16:7384574-7384596 TTTCCCATGGGGAAATAGGAGGG + Intronic
1133708231 16:8376027-8376049 TTTAAAAAGGGGAAATGGGAGGG - Intergenic
1134612953 16:15624929-15624951 TAACAGAAGGGGAAAATTGAAGG + Intronic
1135761771 16:25143681-25143703 GTCAAGAAGGGGGAATTGGATGG + Intronic
1136598422 16:31267397-31267419 TAAGAGAAGGGGAAAGTGGAGGG - Intronic
1137947110 16:52744209-52744231 TTTCAGAACAGGAAACTGAAAGG - Intergenic
1138761063 16:59544925-59544947 TTGGAGAAGGTGAAATTAGAAGG + Intergenic
1138816265 16:60206357-60206379 TTACAGAGGGGGAAACTTGAAGG + Intergenic
1138880221 16:61004488-61004510 TTTCACAAAGAGAAAATGGAGGG + Intergenic
1138897033 16:61219046-61219068 TTTCAGAGGGAAAATTTGGATGG + Intergenic
1144247972 17:13386556-13386578 TTTAGGAAGGGGAAAGAGGAGGG - Intergenic
1144334572 17:14257236-14257258 ATGCTGAAGGGGCAATTGGATGG - Intergenic
1144954433 17:19011907-19011929 TATCAGAAGGGGGCTTTGGAGGG + Intronic
1146032372 17:29377205-29377227 TTGGAGAATGGGAGATTGGAAGG - Intergenic
1146402200 17:32508702-32508724 TTTCAGAAGAGGAAATGAGAAGG + Intronic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148533297 17:48415938-48415960 TTTCAGAAGCCCAAGTTGGAAGG + Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1150981081 17:70142453-70142475 TTTCAACATGGGAATTTGGAGGG - Intergenic
1151375793 17:73687970-73687992 TTTCAGAAGGAGAACTGGGCAGG + Intergenic
1153269323 18:3304054-3304076 ACTCAGAAGGGGAAGTAGGAGGG + Intergenic
1153378952 18:4413476-4413498 TGTCAGAAGGAGGAATTGAATGG - Intronic
1153667276 18:7377308-7377330 TTTCAGGAGAGGATGTTGGAGGG - Intergenic
1153797671 18:8639949-8639971 TTTCAGCTGGGGAAGATGGACGG + Intergenic
1155152043 18:23130866-23130888 TTTCAGAATGGGCACTTGAAAGG + Intergenic
1155343421 18:24835799-24835821 TTTCAGAAGGAGTCCTTGGAGGG + Intergenic
1155486519 18:26349258-26349280 TTTCGGAAGGGGAAAGAAGAAGG - Intronic
1156582880 18:38397967-38397989 ATTCAGTAGGGGAAATTGTTAGG - Intergenic
1157082101 18:44536384-44536406 TTTCAGCTGGGGAATTTGGGGGG + Intergenic
1157190584 18:45578093-45578115 TTTCAGACAGGGAAATGGTAGGG - Intronic
1157989122 18:52473917-52473939 TGTCAGAAGAGGAAGGTGGAAGG - Intronic
1158330414 18:56356389-56356411 TTTCAGAAGGTGAAAGACGATGG - Intergenic
1159020722 18:63141116-63141138 TTTCAGATGAGGAAAATTGAAGG - Intronic
1159141595 18:64402205-64402227 TTTCAGAGGGGGAAACAGCATGG - Intergenic
1159851437 18:73530928-73530950 TTTCAGTAGATGAAAATGGAAGG + Intergenic
1165367898 19:35380772-35380794 TTTCAGCTTGGAAAATTGGAAGG - Intergenic
1165641100 19:37387622-37387644 TTTCAGGAGAGGATATTGGTTGG - Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1166535871 19:43574525-43574547 TTAAAGAAGGGGAAACTGGCCGG - Intronic
1166577722 19:43858511-43858533 TTCCAGAAGGAGAAAGTTGAGGG + Intergenic
1166617436 19:44262879-44262901 TCAGAGAAGGGGAAGTTGGAGGG - Intronic
926039434 2:9660945-9660967 TCTCAGATGGAGAAATTAGAAGG - Intergenic
926162086 2:10496178-10496200 ATTCAGAAAGTGAAATTGGCAGG - Intergenic
926228146 2:10983034-10983056 TTTCAGAAAGGGCCACTGGAAGG + Intergenic
929192443 2:39151924-39151946 TTTCAGGAGGAGAACATGGATGG - Intergenic
929354142 2:40999070-40999092 GTTCCGAAGGGGAAATTGAGCGG + Intergenic
929379464 2:41333393-41333415 TTTCAGAGCTGGAAAATGGATGG - Intergenic
931236002 2:60413118-60413140 TCTCAGAAGGGGAATTTGGGAGG - Intergenic
931384751 2:61787939-61787961 TTTCAGATTGGAAAAATGGAAGG + Intergenic
931667151 2:64617699-64617721 TTTTGGAAGGGGAGATTGGAGGG - Intergenic
932092728 2:68820773-68820795 TTTCATAAAGGAACATTGGAAGG - Intronic
933197860 2:79412780-79412802 ATTGAGAAGGAGAAACTGGATGG + Intronic
933591406 2:84237096-84237118 TTTCAAAAGGTGAAATTCCATGG + Intergenic
935681759 2:105644396-105644418 TTACAGCATGAGAAATTGGAGGG + Intergenic
936239917 2:110778452-110778474 TTTGAAAAGGGGATATGGGATGG + Intronic
937042413 2:118832905-118832927 TTTCACAAGGGGCAGTTGGAAGG - Intergenic
937067792 2:119031371-119031393 TTTCAGCAGGGGCAGTGGGAGGG + Intergenic
938128888 2:128693977-128693999 TTTCAGAAGGGGACACTGGCAGG - Intergenic
938726320 2:134111668-134111690 TTCAAGAAGGCGAAAATGGAAGG - Intergenic
938930635 2:136083692-136083714 TTACAGAAGGTGCTATTGGATGG + Intergenic
939616310 2:144365248-144365270 TTCCAGCAGGGGAAATTTTAGGG - Intergenic
939897109 2:147805540-147805562 GTTCAGTGGGGGAAATTGCAGGG + Intergenic
940068140 2:149652929-149652951 GTTCAGAAGGGGAAACAGGGAGG + Intergenic
940380223 2:153007525-153007547 TTTTTGAAAGTGAAATTGGATGG - Intergenic
941147562 2:161870665-161870687 TTTGAGAATGGTAAATTGAATGG + Intronic
941463684 2:165800439-165800461 TGTTAGAAGGGGAATTTTGAAGG + Intergenic
943696531 2:190941717-190941739 TTTGAGAAGGGGAAAGAAGAAGG + Intronic
943742953 2:191430909-191430931 TTTCAGTAGGTGAATTTAGACGG - Intergenic
944104510 2:196065100-196065122 TTTAAGAAAGGTAAAGTGGAGGG - Intronic
944943929 2:204661193-204661215 TTTGAGATGGGGAAAGAGGAAGG - Intronic
944950525 2:204743839-204743861 TTTCAGAAGGGAAGTGTGGATGG + Intronic
945321833 2:208433056-208433078 TTTCAAAAGAGGAAATAGGATGG + Intronic
945435344 2:209811020-209811042 TTTAAGAAGGAGAAATGGGATGG + Intronic
948502001 2:238402207-238402229 TTTCATAAAGGGATATTGGGAGG + Intergenic
1168971281 20:1932637-1932659 TTTCAGATAGGGAGAATGGAGGG + Intronic
1169806747 20:9567553-9567575 TTGCAGAAAGGGCTATTGGATGG + Intronic
1169875629 20:10294172-10294194 TTTTAGAAGGGGGAAGTGGGAGG - Intronic
1170094788 20:12633948-12633970 TTTTAAAAAAGGAAATTGGAGGG - Intergenic
1171482590 20:25465344-25465366 TTTCAGAAGAGGATGTGGGATGG - Intronic
1172856582 20:38008932-38008954 TTGCAGAAAGGAAAATTGAATGG - Intronic
1173364937 20:42376584-42376606 TTTCAGAAGGGGCCATGGAAAGG - Intronic
1173608695 20:44350920-44350942 TTTAAGAAGGGGATCTAGGAGGG - Exonic
1173692879 20:44978668-44978690 TTGCAGAAGGGAGAATTCGATGG + Intronic
1174017920 20:47503453-47503475 TCTGAGAAGGGGAAACTGTAGGG - Intronic
1174148671 20:48470272-48470294 TCACAGAAGGGGAAATGTGAAGG + Intergenic
1174224510 20:48986105-48986127 TGTAAGAAGTGGAAATAGGAAGG + Intronic
1175791011 20:61739706-61739728 GTTCAGAAGGTAAAACTGGAAGG + Intronic
1176897761 21:14402814-14402836 TTTCAAAATATGAAATTGGAGGG + Intergenic
1176902181 21:14455556-14455578 TTTCAGGAGGGAAAACTGAATGG + Intergenic
1177363755 21:20106081-20106103 TTTCAAAAGGAGAAATTTCATGG + Intergenic
1177370208 21:20193122-20193144 TTTCAAATGGGGAAACTGAATGG + Intergenic
1178864835 21:36319099-36319121 TTTTAGAAAGAGAAATTGGCTGG - Intergenic
1179312025 21:40205016-40205038 TTTAAGAAGGGGGAAATGGAAGG + Intronic
1179542514 21:42092865-42092887 TTTCAGAAGAGGAAATTGAGGGG + Intronic
1182051993 22:27320002-27320024 TTCCAGAAGAAGAAATTGGTTGG + Intergenic
1182260474 22:29070489-29070511 TTTCAGAGGAGAAAATAGGAAGG - Intergenic
1182794605 22:32981936-32981958 TTTCTGAAGACTAAATTGGAGGG - Intronic
1185271169 22:49929807-49929829 TTCTAAAAGGGGAACTTGGAAGG + Intergenic
949483116 3:4512491-4512513 TTTCATCAGGGGAATTAGGAAGG + Intronic
950584367 3:13881806-13881828 GTTCAGCTGGGGACATTGGAGGG + Intergenic
950971851 3:17197162-17197184 TTGCGGAAGTGGACATTGGAAGG - Intronic
951147898 3:19251388-19251410 TTTCAGAGGGGGAGAGTGGCTGG + Intronic
951280271 3:20739814-20739836 TTTCAGATATGGAAAATGGATGG - Intergenic
952183625 3:30945072-30945094 TTTCAGTAGAGGACACTGGAGGG + Intergenic
953119576 3:40026809-40026831 TTCAAGAAGGGGAGAGTGGATGG - Intronic
955191463 3:56765617-56765639 CTTCAGAAGGGAATATGGGATGG - Intronic
955887194 3:63613092-63613114 ACTCAGAAGGGGTACTTGGAAGG - Intronic
956074451 3:65489996-65490018 TTTCAGGAGGGGAAAAAAGATGG + Intronic
956199609 3:66692656-66692678 GTTCAGAAGGGCAATTTGGAAGG + Intergenic
956340848 3:68222314-68222336 TATCAGAGGAGGAAATAGGAAGG - Intronic
956601022 3:71022726-71022748 TTTCAAATGAGGGAATTGGAGGG - Intronic
956788408 3:72661528-72661550 TTACAGATGGGGAAATTGAGAGG - Intergenic
956918356 3:73898839-73898861 GGTCAAAAAGGGAAATTGGAAGG + Intergenic
957567981 3:81908911-81908933 TTTCAGACAGGGAAACTTGAAGG - Intergenic
958255563 3:91320880-91320902 TGTCAGTAGGTGAAATTGTAAGG - Intergenic
958530333 3:95321599-95321621 TTTCAGAAGAAGAAATTGAAGGG - Intergenic
959602617 3:108205154-108205176 TTTCAGACGGGGAAATATGGAGG + Intronic
959640402 3:108626517-108626539 TTTAAGAAAGTGAAATTGTATGG + Intronic
962086631 3:132198351-132198373 CTTCAGTAGGGGAAGTGGGAAGG - Intronic
962875323 3:139531659-139531681 TTTCAGAATGAGAAATTCTAGGG + Intronic
963197868 3:142553639-142553661 TTACAACAGGGGATATTGGAAGG - Exonic
963405307 3:144855751-144855773 TTTCACAATCAGAAATTGGAGGG - Intergenic
963806210 3:149725665-149725687 TTTCAGAAGGAAAATTTTGAAGG + Intronic
964141018 3:153399367-153399389 TTTCAGAAGAGGAAAAGGCATGG + Intergenic
965302874 3:167024865-167024887 TTTCAGAGAGGGAAATATGAAGG + Intergenic
966104377 3:176318559-176318581 TATGAGAAGGGGAAATTAGAAGG - Intergenic
966306844 3:178545789-178545811 TTTCAAATGAGGAAATTAGAAGG + Intronic
969212495 4:5698530-5698552 ATTCATAAAGGTAAATTGGAAGG - Intronic
970178332 4:13361962-13361984 CCTCAGAAGGGGCAATTGAAGGG + Intronic
970567413 4:17346175-17346197 TTTCAGGAAGGGAAACTGGGTGG - Intergenic
971040805 4:22749957-22749979 TTTAAGAAGGAGAAATTGGCCGG - Intergenic
971935867 4:33146185-33146207 TTTCTGAAGAAGAAATTGAATGG + Intergenic
973139594 4:46750115-46750137 TTTCAGAAGGCCAAAGTGGAAGG + Intronic
974451914 4:62074486-62074508 TTTGTGAAGGAGAAATTGGTTGG + Intronic
974799193 4:66793684-66793706 TCTCAGAAGAGGATATTAGAAGG - Intergenic
976128413 4:81857825-81857847 TTTCTGGAGGAGAAATGGGAAGG - Intronic
977334288 4:95676588-95676610 ATTAAGAAAGGGCAATTGGAAGG - Intergenic
977518443 4:98051360-98051382 TTTCAGCAGAAAAAATTGGAAGG - Intronic
977578623 4:98700946-98700968 TTTTAGAAGAGTAAATTGGCAGG - Intergenic
978239707 4:106500868-106500890 TTTCAGAAGAGCTAATGGGATGG - Intergenic
979307008 4:119158034-119158056 ATGCAGAATGGGAAAGTGGATGG + Exonic
980097127 4:128502726-128502748 TGACAGAAGTGGAAACTGGAGGG - Intergenic
980699951 4:136412524-136412546 TTTAAGAAGCTGAAAGTGGAAGG + Intergenic
981355990 4:143789632-143789654 TTTAAGAAGGGCAATTTGAAGGG + Intergenic
981397221 4:144266666-144266688 TTTCCTTAGGGGAAATTAGAGGG + Intergenic
981996648 4:150982666-150982688 TTCCAGAAGGGGAAATGTGGTGG - Intronic
985116427 4:186596582-186596604 TGTCAGAAGGGGAGTTTGAAGGG + Exonic
985343574 4:188976970-188976992 TTGCAGAAGGAGGAATTTGAAGG + Intergenic
986000724 5:3628768-3628790 TTTCAGCAGAGGAATTTGGGGGG - Intergenic
986098618 5:4584796-4584818 TGTCAGGAGGGGGACTTGGAGGG + Intergenic
986491297 5:8293711-8293733 TTGCAAAAGGGGAGAATGGAAGG + Intergenic
986703786 5:10438462-10438484 TTTCAGCAAAGGAAATTGCATGG + Exonic
987110392 5:14680660-14680682 TTTCAGAATGGTCCATTGGATGG + Intronic
988513794 5:31888058-31888080 TTACAGCAGTGGAATTTGGATGG + Intronic
988994988 5:36706239-36706261 AATCAGAAGAGGCAATTGGAAGG - Intergenic
991595609 5:68302314-68302336 TTTAAGATGGTGAAATTGGCCGG - Intergenic
992313346 5:75526337-75526359 TTTCAGAAAAGGAAATGAGAGGG + Intronic
993069190 5:83137328-83137350 TTTCAGTAGGTGAGTTTGGAGGG + Intronic
995731871 5:115253451-115253473 TTTCAAAAGGGGACATTTGGGGG + Intronic
996005821 5:118419836-118419858 TATCAGCAGGGGAAAATGGCAGG - Intergenic
996359276 5:122627697-122627719 TGTCAGAAGTGGAACTTGCACGG + Intergenic
996624102 5:125549063-125549085 TTTCAAAAGGGGAAAATAGATGG - Intergenic
996879284 5:128276566-128276588 AATCTGAAGGGGAAAGTGGAAGG - Intronic
997626389 5:135334010-135334032 TGTCAGAAGGGGACAATGGTAGG + Exonic
997994193 5:138572661-138572683 TTTCAGAAGAGGAGATTGGGGGG - Intronic
998335753 5:141370935-141370957 ATTCAGAAGGAGAACCTGGATGG + Exonic
998861407 5:146447542-146447564 TTTAAGAAGGGGGAAGGGGAAGG + Intronic
999265623 5:150265064-150265086 TTTGAGAAGGGGGAGATGGAGGG - Intronic
999278098 5:150345800-150345822 TCTCAGAATGGGAAAGGGGACGG - Intergenic
999770761 5:154773880-154773902 TTGCAGAAGGGGACATGGGTTGG + Intronic
999859267 5:155627956-155627978 ATTTTTAAGGGGAAATTGGAGGG + Intergenic
1000135512 5:158345922-158345944 TTTCAGCATTGGATATTGGAAGG - Intergenic
1000187074 5:158869491-158869513 TTGGAGAAGAGGAAATAGGAGGG - Intronic
1000599720 5:163257753-163257775 TGTGTGAAGGCGAAATTGGATGG + Intergenic
1000689014 5:164291391-164291413 TTCCAGAAGAGGAAATTTGATGG - Intergenic
1001079235 5:168654755-168654777 TGTAAGTAGGGGAAATTGTAGGG + Intergenic
1002881329 6:1255037-1255059 TTTCAGAAGGTGAAGTTGAGGGG - Intergenic
1003338403 6:5196506-5196528 TTTCAGAAGAGGAAACTGTGAGG - Intronic
1003760159 6:9170947-9170969 TTTCAGAATGGGAAATTCGTTGG - Intergenic
1003884255 6:10506669-10506691 TTTCAAAAGGGAGAATTGTATGG + Intronic
1004750253 6:18555102-18555124 TTTAGGATGGGGAAAGTGGAAGG + Intergenic
1004927554 6:20430601-20430623 TTCCAGAGGGGAAACTTGGATGG + Intronic
1005216891 6:23539965-23539987 TTTCAGAAGACGAAATTGGAAGG - Intergenic
1007415117 6:41687184-41687206 TTCCAGAAGGAGCAATTAGAGGG + Intronic
1008326296 6:50185943-50185965 TCTAAGAAGGAGAAATGGGATGG - Intergenic
1010508841 6:76692243-76692265 TTTCTGAAGGGGAATTTGGGTGG + Intergenic
1011066391 6:83331291-83331313 TTTAAGAAGAGGAAATTGGCCGG + Intronic
1011555997 6:88572154-88572176 TTTAACAAGGGGAAAATGCAAGG + Intergenic
1012412039 6:98969621-98969643 TTTCAAAAGGGTAATTTGGGAGG + Intergenic
1013223827 6:108104817-108104839 TTGCAGATTGGGAAATTGGATGG - Intronic
1013592448 6:111630880-111630902 TATCTGAAGGGGAAAATGGAGGG - Intergenic
1014534102 6:122595974-122595996 TTGCAGAAGAGGTAAGTGGATGG - Intronic
1014598775 6:123381486-123381508 TTTAAGGAGAGAAAATTGGAAGG - Intronic
1015037652 6:128676694-128676716 TTTCATGAGGGAAAATTGCATGG + Intergenic
1015041175 6:128721209-128721231 TTTCAGATGAGGAAATTGAGTGG - Intergenic
1015634978 6:135266098-135266120 TTTAAGAAGAGGAAATTTTACGG - Intergenic
1017551535 6:155514575-155514597 TTTCTGAAAAGGAATTTGGAAGG + Intergenic
1018697648 6:166402903-166402925 TTTCAAATGGGTAAATTGTATGG - Intergenic
1020225828 7:6279228-6279250 TTCCAGAAGGCAAACTTGGAGGG - Intergenic
1021715459 7:23458033-23458055 ATTCAGATGGGGAAGCTGGATGG - Intronic
1021767644 7:23965711-23965733 TTTGAGAAGGTGATTTTGGAAGG + Intergenic
1022460606 7:30602056-30602078 TTTCAGAATGTGAAACTGAAAGG + Intronic
1022465789 7:30652621-30652643 TTTCTGAAGGGGAGACTGGAGGG + Intronic
1022832475 7:34082058-34082080 AGTAAGAAGGGAAAATTGGAAGG + Intronic
1022948486 7:35313020-35313042 TTTAAGAATGGGAAATGGGAAGG + Intergenic
1024588632 7:50862108-50862130 TTACAGATGAGGAAATTGAAGGG - Intergenic
1026292949 7:69025212-69025234 TTTCAGAAAGAGATATTGGAGGG - Intergenic
1026685145 7:72503529-72503551 TTGCAGAAGGGAAAAGTGAAAGG - Intergenic
1027186196 7:75972174-75972196 TTACTGTAGGGGAAATGGGAAGG + Intronic
1027513674 7:79114450-79114472 TTTCAGAGGCTGAAATTGGAAGG + Intronic
1028203189 7:87986487-87986509 TTTCTGAAGGGGTATTTGGAAGG + Intronic
1029475598 7:100782014-100782036 TTACAGAAAGGGAAATTCAAAGG - Intronic
1031811241 7:126371929-126371951 TTTCAGAAGCTGAAATTTCAGGG - Intergenic
1031847005 7:126817696-126817718 TTTCAGAAGCAGACATTTGAGGG + Intronic
1031943972 7:127819134-127819156 TTTGAGCAGGGCAAAATGGAAGG + Intronic
1032249001 7:130236901-130236923 TTTGATGAGGGGAGATTGGAAGG + Intergenic
1033999607 7:147396382-147396404 TTTCAGAAGCGGGTTTTGGAAGG - Intronic
1034074641 7:148220022-148220044 TTTCAGAAGGGGAAAATACTAGG - Intronic
1035940003 8:3888783-3888805 TTTTAGAAGGGCTATTTGGAAGG - Intronic
1038649329 8:29388223-29388245 TTTCAGAAGGGGAAAATTGCTGG + Intergenic
1038738704 8:30197457-30197479 GAACAGAAGAGGAAATTGGAAGG + Intergenic
1038761610 8:30389356-30389378 TTTCAGATGGGTAGTTTGGAAGG + Intronic
1039552856 8:38455754-38455776 GTTCAGAAGGGGAAAAATGAAGG - Intronic
1039928508 8:41961066-41961088 TTTCAGAACGGGAGAGTGAATGG - Intronic
1040439870 8:47429962-47429984 TTTAAAAAGTGGAAATAGGAGGG - Intronic
1042784060 8:72527032-72527054 TTTTGGAAGGGGAGATGGGAAGG + Intergenic
1042793851 8:72638604-72638626 TTTCAGAGGCAGAAATTAGATGG - Intronic
1044878997 8:96702766-96702788 TTACAGAAGGAGAAAGGGGAGGG - Intronic
1045333045 8:101172981-101173003 TTTCAGAAGGGGCTATAGGTGGG - Intergenic
1045651879 8:104348956-104348978 TTTCAAAAGTGGAAAATGTATGG - Exonic
1045980968 8:108187030-108187052 ATTCTGAAGGGGGATTTGGAGGG + Intergenic
1047551370 8:125876092-125876114 TTTAAGAAGGAGAAATTGCAAGG - Intergenic
1047840096 8:128742269-128742291 TTTTAGAAGGTAAAATTGGCAGG + Intergenic
1048207981 8:132430972-132430994 TGGGAGAAGGGAAAATTGGAAGG - Intronic
1048299883 8:133243826-133243848 TTATAGGAGGGGAAATTGAAGGG + Intronic
1048302374 8:133260947-133260969 TTGCACAAGGGGAAATTGAAAGG + Intronic
1048397264 8:134025697-134025719 TTTTAGAAGGGGAAAATAGTTGG + Intergenic
1049133319 8:140869372-140869394 TTTCAGAGGTGGAAATGGGTTGG - Intronic
1050205436 9:3191522-3191544 TTTCAGAAGGGGACACTTGAGGG - Intergenic
1050897831 9:10906327-10906349 TTGCAGTATGGGAAATTGGTAGG - Intergenic
1051212545 9:14759795-14759817 TATCAGAAGGGGATATTCCATGG - Exonic
1052231536 9:26160317-26160339 TTTCATCAGGGGAAGATGGATGG + Intergenic
1052311181 9:27071112-27071134 TTACAGAAGGGCAAGTTGGTTGG - Intergenic
1054925330 9:70583170-70583192 TTTCAGAAGGGGCAACAGAAGGG + Intronic
1056687214 9:88776541-88776563 TTCCAAAAGGGGAAAATGGGGGG - Intergenic
1056832354 9:89927510-89927532 TTTGGGAAGGGGAAGTTGGCAGG - Intergenic
1057133859 9:92672885-92672907 GTTCAGGAGGGGAAATGGCATGG - Intergenic
1058302480 9:103393349-103393371 TTCCTGAAAGGTAAATTGGATGG + Intergenic
1058752154 9:108050226-108050248 TTACTGAAGGGGAAAGAGGAAGG + Intergenic
1058931686 9:109726324-109726346 TTTCAGAAGCAGCAATTGCAGGG + Intronic
1059131422 9:111754919-111754941 TTTGAGCATGGGAAATAGGAAGG + Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1060146906 9:121260866-121260888 TGTAAGAAGGAGAAAGTGGAAGG + Intronic
1060441423 9:123643354-123643376 TTTCAGAAGGAAATATTGTATGG - Intronic
1060553818 9:124498369-124498391 TTTGAGAAGGGGAAGCAGGAAGG + Intronic
1062182268 9:135196783-135196805 TATGGGAAGGGGAAATGGGAGGG - Intergenic
1203743473 Un_GL000218v1:22608-22630 GTTCAGAATTTGAAATTGGAAGG + Intergenic
1186152116 X:6686498-6686520 TTACAGAAGGGGAATCTGAATGG + Intergenic
1186588091 X:10898119-10898141 TTTCAAAAAGGGAAAAGGGAAGG + Intergenic
1186663318 X:11691919-11691941 TTCCAGAAGGAAAAACTGGAAGG - Intergenic
1188254089 X:27938269-27938291 TATCAGATGGGAAAATTTGAAGG + Intergenic
1191677855 X:63810539-63810561 TTCCAGGTGAGGAAATTGGAGGG - Intergenic
1192052775 X:67742312-67742334 TTTATGAAGAAGAAATTGGAGGG + Intergenic
1193162899 X:78247727-78247749 TTCCAGAAGGGGAAAATGGGTGG + Intergenic
1193198606 X:78662200-78662222 TTTCAGAGTGGGAAAAGGGAGGG - Intergenic
1193663673 X:84288692-84288714 TTTCAGAAAAGGAAATTATAAGG - Intergenic
1195942115 X:110175303-110175325 TTACAAAAGGAGAAGTTGGAAGG + Exonic
1196309127 X:114140957-114140979 TTTAAGAAGGGGAAATTGATGGG - Intergenic
1197032875 X:121839340-121839362 TGTCAGAATGGGAAATTCCAAGG - Intergenic
1197396379 X:125932480-125932502 CTTCATAAGGGAAAATTGGTAGG - Intergenic
1198001051 X:132436350-132436372 AATAAGAAGGGCAAATTGGATGG - Intronic
1198881873 X:141290732-141290754 TTTCAGAGGAGAAAATTGTATGG + Intergenic
1200127551 X:153823646-153823668 ATTAAGAAGTGGAAATTGGCTGG - Intronic