ID: 1090984645

View in Genome Browser
Species Human (GRCh38)
Location 11:131755336-131755358
Sequence AAGACTGGCAAGGGAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 412}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090984638_1090984645 -5 Left 1090984638 11:131755318-131755340 CCAATGACCCTGGGGGTGAAGAC 0: 1
1: 0
2: 2
3: 25
4: 244
Right 1090984645 11:131755336-131755358 AAGACTGGCAAGGGAGTGGAAGG 0: 1
1: 1
2: 3
3: 32
4: 412
1090984637_1090984645 -4 Left 1090984637 11:131755317-131755339 CCCAATGACCCTGGGGGTGAAGA 0: 1
1: 0
2: 1
3: 20
4: 159
Right 1090984645 11:131755336-131755358 AAGACTGGCAAGGGAGTGGAAGG 0: 1
1: 1
2: 3
3: 32
4: 412
1090984632_1090984645 8 Left 1090984632 11:131755305-131755327 CCTAGCAGGAATCCCAATGACCC 0: 1
1: 0
2: 1
3: 12
4: 194
Right 1090984645 11:131755336-131755358 AAGACTGGCAAGGGAGTGGAAGG 0: 1
1: 1
2: 3
3: 32
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090984645 Original CRISPR AAGACTGGCAAGGGAGTGGA AGG Intronic
900718424 1:4159783-4159805 AGGAATGGGAAGAGAGTGGAGGG + Intergenic
900767111 1:4513080-4513102 AGGACAGGGCAGGGAGTGGAGGG - Intergenic
900831518 1:4969148-4969170 GGGAATGGAAAGGGAGTGGAGGG + Intergenic
901488348 1:9581249-9581271 AAGGCTGGCAAAGGAGAGGGTGG + Intronic
902527399 1:17068180-17068202 AAGAAAGTCAAGGCAGTGGAAGG + Exonic
902791942 1:18775370-18775392 AAGCCTGGCAAGGGAGCAGAGGG + Intergenic
902983055 1:20139309-20139331 CACACTGGCAGGGGAGTGGCAGG - Exonic
903476667 1:23624110-23624132 AACACTGGAGAGGGAGTAGATGG + Intronic
903828058 1:26159280-26159302 AAGGCAGGCAAAGGAATGGAGGG + Intronic
903878537 1:26492805-26492827 GAGACAGGCCAGGAAGTGGAGGG + Intergenic
904469526 1:30727860-30727882 AAGACTGACAATGGCCTGGAAGG - Intergenic
904563575 1:31414005-31414027 GAGACTGGGATGGGAGCGGAGGG + Intronic
905160256 1:36027024-36027046 AAGTTTGGGAAGGGAATGGAAGG - Intronic
905875502 1:41429513-41429535 AAGACTGAGAAGTCAGTGGAAGG + Intergenic
905908724 1:41639254-41639276 GATACTGGCAAAGGGGTGGATGG + Intronic
905993451 1:42360072-42360094 AGTACAGGCAAGGGAGTGGCAGG + Intergenic
906383718 1:45349126-45349148 AAGGCTGGCAAGGAAGAGGGAGG - Intronic
906552663 1:46678594-46678616 AAGACTGGCCAGGACGTGGATGG - Exonic
906678983 1:47712194-47712216 CAGCCTGGCCAGGGAGTGAAAGG + Intergenic
907185175 1:52603443-52603465 ACGACTGGCAAGGGAGCAGGCGG + Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907925190 1:58949408-58949430 AAGACTGGTGAGTGAGTGGGTGG + Intergenic
908292506 1:62682507-62682529 AAAACAGGGAAGGGGGTGGAGGG + Intronic
910648684 1:89540728-89540750 AACACTGGCAACTGTGTGGAGGG + Intronic
910802761 1:91162217-91162239 TAGCCTGGGAAGGGAATGGAAGG + Intergenic
911165912 1:94724138-94724160 AAGCCTGGTTAGGGAGTGGAAGG - Intergenic
912535454 1:110365692-110365714 AAGAATGACAAGGGATGGGAGGG - Intronic
912631003 1:111246777-111246799 AAGACTGGGGAAGGAGTGGAAGG + Intergenic
912878892 1:113390177-113390199 AGGAGGGGCAGGGGAGTGGAAGG - Intergenic
913232138 1:116748842-116748864 AAGAGTGGCAAGGGAGGAGCTGG + Intergenic
916142693 1:161713009-161713031 AAGATTGGCCAGGGATGGGAGGG + Intronic
916310088 1:163388557-163388579 CAGCCTGGCATGGAAGTGGAAGG + Intergenic
917125339 1:171682570-171682592 AAGAAAGGAAAGGGAGGGGAGGG - Intergenic
918300024 1:183195093-183195115 CTGACTAGCAAAGGAGTGGAGGG - Intronic
919458296 1:197846187-197846209 AAGGAAGGCAAGGGAGGGGAAGG - Intergenic
920346623 1:205309946-205309968 AAGACTAGGTAGGGAGTGGCTGG + Intronic
920877964 1:209854902-209854924 AAGATGGGAAAGGGACTGGAAGG - Exonic
922196567 1:223364452-223364474 GAGACTGGCGAGGGCGGGGACGG + Intergenic
922932128 1:229398086-229398108 AGGACTGGCAAGGGAGCTGGGGG + Intergenic
922971265 1:229741877-229741899 AAGAGTGGCAAAGGATGGGATGG + Intergenic
923865609 1:237935963-237935985 AAGAATGACAGGGGAGGGGACGG + Intergenic
924597998 1:245464051-245464073 AAGACTAGAAAGGGTGGGGATGG - Intronic
924633835 1:245766422-245766444 AAGGCTGAAAAGGGAGCGGAAGG + Intronic
1063114310 10:3063460-3063482 AAGAGTGGGTAGGGAGAGGAGGG + Intergenic
1063179896 10:3588679-3588701 CAAACTGACAATGGAGTGGAGGG - Intergenic
1064306372 10:14170785-14170807 AAGAGAGGTAGGGGAGTGGAAGG - Intronic
1064713628 10:18152457-18152479 AAGGCTGTCAGAGGAGTGGAAGG + Intronic
1064890322 10:20164337-20164359 AAGACTAGAAAGGGAGTCAAAGG - Intronic
1064951311 10:20854218-20854240 AAAAATGGCAATAGAGTGGAGGG + Intronic
1065245374 10:23750957-23750979 AAGAAAGGGAAGGGAGGGGAGGG - Intronic
1066329708 10:34407194-34407216 ATGCCTGCCAAGGGGGTGGAGGG + Intronic
1066475106 10:35739123-35739145 AGGCCTGGCAAGGAAGTGGGAGG - Intergenic
1066765434 10:38798324-38798346 TAGAATGGAAAGGGATTGGATGG - Intergenic
1066773985 10:38870027-38870049 TAGAATGGAAAGGGATTGGATGG + Intergenic
1068064012 10:52105959-52105981 AAGAGTGGGAGGGGAGTGGGGGG - Intronic
1068798349 10:61109850-61109872 AAGAATGGCAAGGCTGTGGCTGG + Intergenic
1069899741 10:71700659-71700681 GAGGCTGGGAAGGGAGAGGAGGG + Intronic
1071502623 10:86214406-86214428 AAGACTGGGGACGGTGTGGAAGG - Intronic
1071875139 10:89836937-89836959 CAGGCCGGCATGGGAGTGGATGG - Intergenic
1072424841 10:95321197-95321219 AACTCTGGCAACAGAGTGGAGGG - Intronic
1072786624 10:98287552-98287574 GAGACTGGCATGGGAGTGGGTGG - Intergenic
1073113701 10:101078834-101078856 CAGACTGGGAGTGGAGTGGAAGG - Intergenic
1073615321 10:104989437-104989459 ATGGCTGGAAATGGAGTGGAAGG + Intronic
1074434053 10:113418660-113418682 AAGACTGGGAAGGGTGCTGATGG + Intergenic
1074820486 10:117174691-117174713 AAGCCTGGCAGAGGAGGGGAGGG + Intergenic
1074935469 10:118175130-118175152 AACACTGGAAAGGGGGTTGAAGG - Intergenic
1075239484 10:120765017-120765039 AAGACAGGCCAGGGGGAGGAGGG - Intergenic
1076913039 10:133401886-133401908 AACACAAGGAAGGGAGTGGAGGG - Intronic
1077161775 11:1116755-1116777 AATACAAGCCAGGGAGTGGAAGG + Intergenic
1077318460 11:1929496-1929518 AAGGCTGGGAAGGGAGGAGACGG - Intronic
1077462057 11:2715607-2715629 AAGGCTGGCAGGGGCTTGGAAGG - Intronic
1078824200 11:14912073-14912095 AAAATTTGCAAGGGAGTGCAAGG - Intronic
1079274977 11:19027003-19027025 AAGTGTGGCAAGGAGGTGGAGGG + Intergenic
1080257324 11:30305593-30305615 ATGACTGGAAATGAAGTGGAAGG + Intergenic
1081273426 11:41116616-41116638 TAAAATGGGAAGGGAGTGGAAGG + Intronic
1082989780 11:59197404-59197426 AAGACTCGCAAGGAAGTAGAGGG + Intronic
1083756941 11:64796909-64796931 GAGGCTGGCGAGGGAGTGCAGGG + Intronic
1083958710 11:66002181-66002203 AAGACGGACAAGGGAGGGGACGG - Exonic
1084425480 11:69081718-69081740 AAGGCGGGCAAGGGTGTGGCGGG + Intronic
1087509462 11:99072153-99072175 ATGAATGGGAAGGGAGTTGAGGG + Intronic
1087619763 11:100528256-100528278 AAGAGTGACATCGGAGTGGAGGG + Intergenic
1089255211 11:117190452-117190474 CAGGCTGGCAAGGGAGGGCAGGG - Intronic
1089571814 11:119416257-119416279 AGGACTGGCGAGGGAGTGGATGG + Intergenic
1089631563 11:119787563-119787585 GGGACTGGCAGGGGAGTGGTGGG - Intergenic
1090435331 11:126682461-126682483 AAGCCTGGTAAAGGAGTGGCAGG - Intronic
1090984645 11:131755336-131755358 AAGACTGGCAAGGGAGTGGAAGG + Intronic
1091092420 11:132784446-132784468 AAGGCAGGCAGAGGAGTGGAAGG - Intronic
1091110006 11:132957215-132957237 AAGACTGGGAAGGAAGGAGACGG + Intronic
1093656386 12:21699336-21699358 AAGAAAGGCATGGAAGTGGATGG - Intronic
1094832676 12:34307623-34307645 AATATTGGCACGGCAGTGGAGGG + Intergenic
1094842337 12:34347351-34347373 AAAACTGGCAAGGCAGAGGAGGG - Intergenic
1094843535 12:34351747-34351769 AAAACTGGCAAGGCAGAGCAGGG - Intergenic
1095223056 12:39641502-39641524 AAGACAGGCAAGGGGAAGGAAGG + Intronic
1096611077 12:52802137-52802159 AAGACAGGGCAGGGAGTGGTGGG - Intergenic
1096755252 12:53794058-53794080 AGGACTGGCCAGGTGGTGGATGG - Intergenic
1097152400 12:56988529-56988551 AAGACTGATAAGAGACTGGAAGG - Intergenic
1097501733 12:60411580-60411602 AAGTCAGGCAAGAGAGGGGAGGG - Intergenic
1097989120 12:65816258-65816280 AAAGCTGGCAAGGATGTGGATGG + Intergenic
1098175257 12:67783637-67783659 AAGCCAGGGAAGGGAGAGGAAGG - Intergenic
1099138395 12:78938169-78938191 AAGGGTGGAAAGGGAGAGGAGGG - Intronic
1099481579 12:83173438-83173460 AAGTCTGTCAAGTGACTGGAGGG + Intergenic
1101500444 12:105299181-105299203 TAGACTGGGGAGGGTGTGGAAGG + Intronic
1102112810 12:110377754-110377776 TAGACTGGCAAGAGTGTTGATGG + Intronic
1102417360 12:112775631-112775653 AAGACAGGAAAGGCAGGGGAGGG + Intronic
1102745248 12:115244001-115244023 AAGACGGGGAGGGGAGGGGAGGG + Intergenic
1102986959 12:117286037-117286059 AAGAGGGGAAGGGGAGTGGATGG - Intronic
1103091744 12:118103113-118103135 AAGACTTGCAAAGGTGTGTAGGG + Intronic
1103274653 12:119701302-119701324 AAGGATGGAAAGGGAGGGGAAGG + Intronic
1103726337 12:122999138-122999160 AGGAAGGGCAAGGGAATGGATGG + Intronic
1104074733 12:125379003-125379025 AAGACAGGCAAGGCAGTGATAGG - Intronic
1104368890 12:128204546-128204568 GAGACTGCCAAGTCAGTGGAGGG - Intergenic
1105373038 13:19817989-19818011 AAGACTTGAAGGGGAGCGGAGGG - Intergenic
1105913740 13:24894128-24894150 AGGACTGGCCAGGGACAGGAAGG + Intronic
1106224344 13:27773845-27773867 AAAACTGGGAAGGGAAAGGAAGG + Intergenic
1106811168 13:33359699-33359721 AAGAATGGCAAGGGAGCTGTGGG - Intergenic
1107182485 13:37477581-37477603 AGGACTGACAAGGAAATGGAAGG - Intergenic
1107685644 13:42895540-42895562 AAGACTGGCAGTGGAGTGCAGGG - Intronic
1108088032 13:46816585-46816607 AAGAGTGGCATGGGTGAGGAGGG - Intergenic
1109248881 13:59993803-59993825 ATGACTGGCAAGGGGGTGGAAGG - Intronic
1109454295 13:62564188-62564210 AAGACTGGCATGGGATGGAAGGG - Intergenic
1110620251 13:77586539-77586561 AATGATGGCAAGGGAGTGGAAGG - Intronic
1111916132 13:94362533-94362555 AAGACTGGTAAGGGGGTGAAAGG + Intronic
1112089809 13:96070769-96070791 AGGACTGGCAGGAGAGGGGAAGG + Intergenic
1112595284 13:100802256-100802278 ACCAGTGGTAAGGGAGTGGAGGG + Intergenic
1114458734 14:22873491-22873513 AAGACTTCCAATGGAGGGGAAGG - Intronic
1114556107 14:23563324-23563346 AGGATGGGCAAGGGAGTGGTTGG + Intronic
1116605569 14:46989253-46989275 AATACTTGCAAGATAGTGGAAGG + Intronic
1117340742 14:54789205-54789227 GAGACTGGGAGGGGGGTGGAGGG + Exonic
1118338511 14:64875782-64875804 AGGACTGGCAAGGAAGTTCATGG - Intronic
1118356148 14:65015516-65015538 CAGCCTGGCAAGGGGGAGGAGGG - Intronic
1118466277 14:66034108-66034130 AGGACTAGGAATGGAGTGGAGGG + Intergenic
1118722118 14:68601831-68601853 AAGACTTTCAAGGGTGAGGAGGG - Intronic
1120378122 14:83735272-83735294 GAGACTGGGAAGTGAGTGGAAGG - Intergenic
1121242717 14:92441560-92441582 AAAACCGGCATGGGAGGGGATGG + Intronic
1121464874 14:94109310-94109332 AAGAAAGGAAAGGGAGGGGAGGG + Intronic
1121935748 14:98017042-98017064 AAGGCGGGGAAGGGAGGGGAGGG + Intergenic
1123431830 15:20224410-20224432 AAGACTGAAAAGTGAGTGAAGGG - Intergenic
1123434907 15:20247808-20247830 AAGGATGGGAAGGGAGGGGAGGG + Intergenic
1123799597 15:23806199-23806221 AACACTGGGAAGGGAGGTGAGGG - Intergenic
1124401134 15:29348496-29348518 AAGACCGGCTCGGGAGTGGGAGG + Intronic
1124492075 15:30164241-30164263 AAAAATGCCAAGGGAGTGCAGGG - Intergenic
1124718112 15:32085897-32085919 ACGACTGGCCAGGGAGCAGATGG - Intronic
1124751462 15:32374076-32374098 AAAAATGCCAAGGGAGTGCAGGG + Intergenic
1125267006 15:37893503-37893525 AAGGCTAGAAAGGCAGTGGATGG + Intergenic
1126427773 15:48547970-48547992 AAGACAGGCATGGGAGCTGAGGG + Intronic
1127251221 15:57240465-57240487 AATATTGGCAAGGGAGGGAAAGG - Intronic
1127806886 15:62529504-62529526 AAGAGAGGCAAGGGAGGGGCAGG - Intronic
1128722348 15:69959555-69959577 AACACTGACTAGGGAGAGGAAGG - Intergenic
1128892086 15:71340541-71340563 AAGACAGCCTAGGAAGTGGAAGG - Intronic
1128980424 15:72181353-72181375 AAGTGGGGCAGGGGAGTGGAGGG + Intronic
1129074165 15:72977244-72977266 AAGCCAGGCCAGGGAGTCGATGG - Intergenic
1129090593 15:73146028-73146050 AAGCCAGGCAAGGGAGTGGAAGG - Intronic
1129440500 15:75578353-75578375 AACATTTACAAGGGAGTGGAAGG + Intronic
1129892562 15:79081288-79081310 ACGGCTGGGATGGGAGTGGAGGG + Intronic
1130029269 15:80296766-80296788 GAGACTGGCAAGTGAGTTGGCGG - Intergenic
1130644625 15:85713407-85713429 AAGAATTGCAAGGATGTGGATGG - Intronic
1131515977 15:93077032-93077054 TTGACGGGCAAGGGAGGGGATGG + Intronic
1132396415 15:101478293-101478315 AAGACTGACATAGGAGTGGCTGG + Intronic
1132733672 16:1375318-1375340 AAGCCTGGCTCGGGAGTGGACGG + Intronic
1133810635 16:9158464-9158486 AAGAAAGGGAAGGGAGGGGAGGG - Intergenic
1134332701 16:13265228-13265250 AAGAAAGGGAAGGGAGGGGAGGG - Intergenic
1134862598 16:17574039-17574061 CATCCTGGCAAGGGAGAGGATGG + Intergenic
1135078430 16:19413584-19413606 AAGGCTGGCATGGGATGGGAAGG + Intronic
1135637431 16:24090519-24090541 AAGAGGGGCAAGGGAGTTGAGGG + Intronic
1136061591 16:27730404-27730426 GAGACAGGCAATGGAGTGAAAGG - Intronic
1136849713 16:33603180-33603202 AAGGATGGGAAGGGAGGGGAGGG - Intergenic
1136852814 16:33626830-33626852 AAGACTGAAAAGTGAGTGAAGGG + Intergenic
1138238384 16:55405436-55405458 AAAAGTGGAAAGGGATTGGAAGG + Intronic
1138301095 16:55930392-55930414 ATAACTGGGCAGGGAGTGGAAGG - Intronic
1138605335 16:58085003-58085025 AAGGCAGGGAGGGGAGTGGAAGG - Intergenic
1138617868 16:58185715-58185737 AAGACTGAGAAGGGAAGGGATGG - Intronic
1138651987 16:58465878-58465900 AAAGTTGGCAAGGGATTGGAGGG - Intronic
1138760349 16:59535652-59535674 AAAACTGGCAAGATAGTGGGAGG - Intergenic
1138763403 16:59570820-59570842 AAGATTGTCACTGGAGTGGAAGG + Intergenic
1139384282 16:66554642-66554664 AAGCCAGGTAAGGGAGTGTAAGG + Intronic
1139588583 16:67920114-67920136 AAGACAGGAGAGGGAGGGGATGG - Intronic
1139645621 16:68327552-68327574 AAGACTGGGAAGGTAAGGGAGGG + Intronic
1140376175 16:74447010-74447032 AAGACTGACAAGGGGGTGATGGG + Intergenic
1203114415 16_KI270728v1_random:1475249-1475271 AAGACTGAAAAGTGAGTGAAGGG + Intergenic
1143674468 17:8421843-8421865 CAGACTGGCCAAGGAGAGGAAGG + Intronic
1143755480 17:9064233-9064255 AAGGCTGGCCAGGAAGTGGGTGG - Intronic
1143984026 17:10895706-10895728 AAGAAAGGGATGGGAGTGGATGG - Intergenic
1144585054 17:16482715-16482737 AGGACTGGCAAGTGACTGCAGGG - Intronic
1144877709 17:18411080-18411102 AAGACTGGAAAAGGGGTGAAGGG - Intergenic
1144911494 17:18686003-18686025 GAGGCTGGGAAGGGTGTGGAGGG - Intergenic
1145016569 17:19402661-19402683 GAGACTGGCAAGGGTGTTCAAGG + Intergenic
1145154520 17:20533323-20533345 AAGACTGGAAAAGGGGTGAAGGG + Intergenic
1146658548 17:34649489-34649511 AACACTGGGAAGGGAGGGCATGG + Intergenic
1148070948 17:44908198-44908220 AAGCCGGGCATGGGAGAGGATGG - Intronic
1148790085 17:50168042-50168064 AAGACTGGCATTGGTGGGGAAGG - Intronic
1149599213 17:57882314-57882336 GAGACTGCCAAGGGAGGGGAGGG + Intronic
1150603766 17:66674222-66674244 TAGGCTGGCAGGAGAGTGGAAGG + Intronic
1151345132 17:73496777-73496799 AAGTCGGGGCAGGGAGTGGAGGG - Intronic
1151404369 17:73877202-73877224 AAGAGCTGCAAGGGAGAGGAAGG - Intergenic
1151857252 17:76730549-76730571 AAGACTGCCACGGCCGTGGAAGG - Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1153922570 18:9804542-9804564 CAGAAGGGAAAGGGAGTGGAAGG - Intronic
1155089112 18:22488977-22488999 AAGACTGGGAAGTGGGAGGAGGG + Intergenic
1155420000 18:25645545-25645567 ATGATAGTCAAGGGAGTGGAGGG + Intergenic
1155920859 18:31601499-31601521 AAGGCTGTCAAGTGATTGGAAGG + Intergenic
1156388590 18:36629114-36629136 ACAACTGGTTAGGGAGTGGAGGG + Intronic
1157187666 18:45554275-45554297 AAAACTGGAAAGGGAGTTGGGGG + Intronic
1157217985 18:45801651-45801673 AAGACTGGGAAAGGAATGGAAGG - Intergenic
1158308973 18:56138752-56138774 ATGAGTGGGAAGGGAGTGGGAGG + Intergenic
1158343593 18:56491910-56491932 AATACATGTAAGGGAGTGGAGGG - Intergenic
1158743987 18:60176468-60176490 AAAACTGTCAGGGGATTGGATGG + Intergenic
1159700757 18:71623822-71623844 AACACTTCCAAGGGGGTGGAGGG - Intergenic
1159724036 18:71931115-71931137 AAGACTGGAAAGTGAAGGGAAGG - Intergenic
1160181284 18:76638715-76638737 GAGACTGGAAAGGGTGTGGAAGG + Intergenic
1160439013 18:78874999-78875021 AAGGCTGGCAAGGGACTACAGGG + Intergenic
1161605238 19:5211167-5211189 AATCCTGGCAAAGGAGGGGAGGG - Intronic
1162876803 19:13626640-13626662 AAGAATGGGAAGGGAAGGGAGGG + Intergenic
1164558897 19:29274932-29274954 GAAACTGGAAAGGGAGTGGTTGG + Intergenic
1164678808 19:30120642-30120664 AAGACAGGCAAGGGAGACCAAGG - Intergenic
1164901580 19:31930595-31930617 GAGATTGGCAAGGAGGTGGAAGG - Intergenic
1165984423 19:39755475-39755497 AAGATTGGCAAAGCTGTGGATGG - Intergenic
1166462100 19:42996613-42996635 AAGACTGACCAGGGAGTGTTGGG - Intronic
1166501887 19:43347740-43347762 AAGACTGACCAGGGAGTGTTGGG - Intergenic
1166508229 19:43385711-43385733 AAGACTGACCAGGGAGTGTTGGG + Intergenic
1166834882 19:45661279-45661301 AAGAAGGGCAGGGGAGGGGAGGG - Intergenic
1166980669 19:46630257-46630279 GAGACTGGAATGGGAGTGGGAGG - Intergenic
1167279795 19:48560213-48560235 AATGCTAGCAAGGGAGGGGATGG + Intronic
1167461264 19:49625789-49625811 AGGAATGGGGAGGGAGTGGAGGG - Exonic
1167772873 19:51531654-51531676 GAGAAGGGGAAGGGAGTGGAGGG + Exonic
1168565050 19:57415645-57415667 AAGACAGATGAGGGAGTGGATGG + Intronic
925978512 2:9157534-9157556 TAGACTGGCATGGGAGGGGAGGG + Intergenic
926209248 2:10856993-10857015 AAGACTTACAAGGGAGTGAGAGG - Intergenic
928368773 2:30723524-30723546 AGGGCTGGCACTGGAGTGGAGGG + Intronic
928589729 2:32801851-32801873 GAGACTAGGAAGGGAGTTGATGG + Intronic
929787769 2:45004494-45004516 AAGACTGGCAGGTGAGAAGAAGG + Intergenic
930088294 2:47513976-47513998 GACACTGGCAAGCCAGTGGAGGG - Intronic
932344552 2:70987053-70987075 AACACTGGCAGTAGAGTGGAGGG + Exonic
934850129 2:97693733-97693755 CAGAGTGGCAGGGGATTGGAAGG + Intergenic
935122366 2:100194030-100194052 GAGGCTGGCAAGAGATTGGAAGG - Intergenic
935285457 2:101560366-101560388 AACACTGGGAATGGAGGGGAAGG - Intergenic
936656826 2:114498321-114498343 AAGCCTGGCAGGGGAGGGGGAGG - Intronic
938892321 2:135718188-135718210 CTGACTGGGAAGGGACTGGAGGG + Intronic
938977304 2:136492183-136492205 ATGACTTGCAAGGGAAGGGATGG + Intergenic
939593048 2:144089757-144089779 AAGACTGGGAAGGGAGAGTGGGG + Intronic
941017099 2:160369808-160369830 AGGAGTGGAAAGGGAGTGGCGGG + Intronic
941413101 2:165185348-165185370 AAGATGGGCAAGGGACTTGAAGG - Intronic
941810565 2:169752092-169752114 TAAACTGGCAAAGGAGGGGAAGG - Intronic
943344983 2:186727672-186727694 ACGACTGGAAAGGGAGGTGACGG + Intronic
944748256 2:202680265-202680287 AAGTCTGACAAGGGAGAGGGGGG + Intronic
945601778 2:211876357-211876379 AAGAATGGCAAGACAGAGGAAGG + Intronic
946047914 2:216836655-216836677 AGGCCAGGCAAGGGAGTGAAGGG - Intergenic
947131579 2:226932608-226932630 GAGAGGGACAAGGGAGTGGAAGG - Intronic
947265007 2:228268851-228268873 AAGAATGGAAGGGGAGAGGATGG - Intergenic
948721887 2:239905824-239905846 CAGACTGGGAGGGGAGGGGAGGG + Intronic
948790935 2:240376497-240376519 CAGCCTGGGAAGGGAGGGGAAGG + Intergenic
1168837169 20:885023-885045 AAGACGGGCAGGAGAGGGGAGGG - Intronic
1168903941 20:1389422-1389444 ATACCTAGCAAGGGAGTGGATGG + Intronic
1169469467 20:5871709-5871731 AAGAGAGGGAAGGGAGGGGAGGG + Intergenic
1170444823 20:16415655-16415677 AAGACTGGAAAGGGGATGGAGGG - Intronic
1172357103 20:34287889-34287911 AAGACTGTCAAGGATGTTGAGGG + Intronic
1172499053 20:35412039-35412061 AAGACTGGCAAGGGGGGCGCAGG + Exonic
1174195314 20:48768813-48768835 AAGACTGGCAAGGGGCTCAAGGG + Intronic
1175814199 20:61875066-61875088 GGGACTGGCAAGGAAGTGGCAGG + Intronic
1175823582 20:61924679-61924701 ATGACTGACATGGGAGTGGGTGG - Intronic
1177012465 21:15745040-15745062 AGGAGTGGGAAGGGAGGGGAAGG - Intronic
1178289754 21:31357033-31357055 AAGATGGGCCAGGGAGTTGAGGG - Intronic
1178314132 21:31554994-31555016 GAGGCTGGGAAGGGAATGGAAGG + Intronic
1178597053 21:33963583-33963605 AAAATGGGCAAGAGAGTGGAGGG - Intergenic
1178673322 21:34611609-34611631 CAGACTGGCTAAGGAGGGGACGG + Intronic
1178898771 21:36582765-36582787 AAGCTTGGGAAGAGAGTGGAGGG + Intergenic
1179080973 21:38170425-38170447 AAGACTTGGAAGGAAGTGGCAGG + Intronic
1179243504 21:39611505-39611527 AAGGGTGGGAAGGGAGTGGGGGG + Intronic
1179434737 21:41352417-41352439 AAGAAAGGGAAGGGAATGGAAGG + Intronic
1180898076 22:19351887-19351909 AAGAGGGGCAACTGAGTGGAGGG + Intronic
1182534219 22:30988125-30988147 AAAAATGGCAAGGGAATGGCTGG + Intergenic
1183785648 22:40027776-40027798 AAGCCTGGCAAGGCAGGGGCAGG - Intronic
1184037023 22:41923121-41923143 AGGCCTGGCAAGGGACAGGAGGG + Intergenic
949887978 3:8711558-8711580 AAATCCGGCAAGGGAGAGGACGG - Intronic
950463364 3:13138753-13138775 CTGACTGCAAAGGGAGTGGAAGG - Intergenic
951344009 3:21523865-21523887 AAGACTGGGGAAGGAGTGAAAGG + Intronic
952208194 3:31201555-31201577 AAGATTGGGAAAGGTGTGGAAGG - Intergenic
952273758 3:31857767-31857789 AAGATTGGCAGGGGGGTGGGGGG + Intronic
952353658 3:32564868-32564890 GTAACTGGCAAGGGAGTGTATGG - Intronic
952856359 3:37773664-37773686 TTGACTGGCAAGGGACTGGTGGG + Intronic
953487690 3:43317712-43317734 AAGAGTGGCTAGGCAGAGGAGGG - Intronic
953740406 3:45533722-45533744 AAGACCTGCCAGGGAGAGGAAGG - Intronic
954612827 3:51955333-51955355 ACGGCTGGCAAGGGAGGGGCAGG - Exonic
954874800 3:53795017-53795039 GAGACTGGGAAGGGGCTGGAGGG - Intronic
956314437 3:67918499-67918521 AATAATGGCAAGGAAGTGGCTGG - Intergenic
958507309 3:94996490-94996512 GAGACTGGCAGGAGTGTGGAGGG - Intergenic
958984765 3:100767468-100767490 CGGACTGGAAAGGGAGAGGAAGG + Intronic
959007038 3:101031153-101031175 AAGTCTGGGAAGGGAAGGGAAGG + Intergenic
960102504 3:113759800-113759822 AGTACTGGCAAGGGTGTGGGGGG - Intronic
961657222 3:128449842-128449864 CAGACTGGGATGGGAGTGGGGGG - Intergenic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
962258235 3:133886576-133886598 AACACTGGCCAGGGAGTCAAAGG + Intronic
964336995 3:155665488-155665510 TAAACTAGCAAGGTAGTGGAAGG + Intronic
964548048 3:157856886-157856908 AAGAAAGGAAAGGGAATGGAGGG + Intergenic
966580920 3:181561922-181561944 CAGACTGGTAAGGCAGTGAAAGG - Intergenic
966728090 3:183126345-183126367 AGGACTGGGAAGGAAGTGGAGGG + Intronic
968555720 4:1245590-1245612 AAGAGTGGCACGGGAGGGCAGGG + Intronic
970423897 4:15929215-15929237 AAGACTGTCCAGGGAGTGTAAGG - Intergenic
970565452 4:17327812-17327834 ATCACTGGACAGGGAGTGGAGGG - Intergenic
971406501 4:26325407-26325429 AAGAGAGGCAACAGAGTGGAGGG + Intronic
971551537 4:27964247-27964269 AAGACAGGGAAGGGAAGGGAAGG - Intergenic
972570072 4:40302632-40302654 AAAACTGGGAAGGGAGTACATGG + Intergenic
973544006 4:51962056-51962078 CAGACTGGCAAGGTGGTGGTGGG + Intergenic
975022706 4:69509213-69509235 CAGACTGGCAATGCAGTGGCAGG + Intronic
975655737 4:76639520-76639542 GAGATTGGCATGGGAGAGGAGGG - Intronic
976840384 4:89426060-89426082 AAAACAAGCAAGAGAGTGGAAGG + Intergenic
977131040 4:93237435-93237457 AAGACTGGAAACGGAGTTGCAGG + Intronic
977190965 4:94000302-94000324 AAGAGAGGGAAGGGAGGGGAGGG + Intergenic
977482234 4:97593307-97593329 TACACTGGCAAAGCAGTGGAAGG - Intronic
977867623 4:102048763-102048785 AAGACTGGCAAGGGATTGCCAGG + Intronic
978243764 4:106548739-106548761 AAGAGAGGGAGGGGAGTGGAGGG - Intergenic
981251398 4:142606241-142606263 GAGACTGGGAAGGGTGGGGAAGG + Intronic
981322748 4:143411556-143411578 AGGATTGGCAAGGCAGTGTACGG + Intronic
984526631 4:180866243-180866265 CAGAGTGGCAAGGGGGTGGCGGG + Intergenic
984656875 4:182328181-182328203 TAGAGTGGCAATGGAGAGGAAGG + Intronic
986458311 5:7942520-7942542 AAGCCTGGAAGGGGAGTGAATGG + Intergenic
986972205 5:13350051-13350073 GAGACTAACAAGGGAGGGGAGGG + Intergenic
987825867 5:23029690-23029712 AAGAGGGGCAAGGGAGTTGAGGG - Intergenic
988714457 5:33811364-33811386 AAGCATGGCAAGGGAGTGCAGGG + Intronic
991419792 5:66429201-66429223 GGAACAGGCAAGGGAGTGGAAGG - Intergenic
991761872 5:69924951-69924973 AAGACTGGGTAGGGCGGGGAGGG - Intergenic
991785457 5:70193149-70193171 AAGACTGGGTAGGGCGGGGAGGG + Intergenic
991841100 5:70800000-70800022 AAGACTGGGTAGGGCGGGGAGGG - Intergenic
992472683 5:77074159-77074181 AAGACTGGCATGGGGGCAGAGGG + Exonic
992947516 5:81824100-81824122 AAGCCTGGCATGGGACTGGCAGG + Intergenic
995945105 5:117635603-117635625 AAGACTGGGAAGGAGGTGGGAGG - Intergenic
996583534 5:125058537-125058559 AGGACTGGAAAGGGGGAGGAGGG + Intergenic
996584466 5:125069331-125069353 AAAACAGGAAAGAGAGTGGAAGG - Intergenic
997240470 5:132302798-132302820 AAGATAGGGATGGGAGTGGAGGG - Intronic
998064918 5:139150383-139150405 AAGACAGGGAAGGGAGAGGAGGG - Intronic
998202301 5:140134787-140134809 CAGACTGGTAAGGGAGTGACTGG - Intergenic
998232960 5:140373142-140373164 AAGAGTGGGAAGGAAGAGGAAGG + Intronic
998883392 5:146668428-146668450 AAGATTGGCAGGGAAGTGGGGGG - Intronic
999595726 5:153202064-153202086 AAGAGTGATAAGGGGGTGGATGG - Intergenic
999659128 5:153840472-153840494 AAGACTAGGAAGGAACTGGATGG - Intergenic
999998260 5:157113051-157113073 ACCAATGGCAAGGGGGTGGAGGG - Intronic
1000222476 5:159227268-159227290 AGAGCTAGCAAGGGAGTGGAAGG + Intergenic
1000641239 5:163704691-163704713 AAGACTGCCTAGCCAGTGGAGGG - Intergenic
1001134299 5:169089759-169089781 AACACTGGCAAGTGTGTGAAGGG - Intronic
1002082546 5:176746072-176746094 CAGATGGGCAAGAGAGTGGAAGG + Intergenic
1002154936 5:177269771-177269793 AAGATGGGCAAAGGAGTGGATGG + Exonic
1002451449 5:179321359-179321381 GTGAGAGGCAAGGGAGTGGAGGG - Intronic
1002550008 5:179981053-179981075 AAGACTGGGAAGGGGTTAGATGG + Intronic
1002893212 6:1355804-1355826 AAGAGAGGGAAGGGAGGGGAGGG + Intergenic
1006814469 6:36840621-36840643 ACGACGGGCGGGGGAGTGGAAGG - Intergenic
1006837551 6:37008132-37008154 AAGACAGGCCAGGAAATGGAAGG - Intronic
1007341596 6:41194250-41194272 AAGGATGGCAATGGAGAGGAGGG - Intronic
1007409620 6:41654164-41654186 AAGACTGGAAGGGGAAAGGAAGG + Exonic
1007975644 6:46098675-46098697 CAGCCTGGACAGGGAGTGGAAGG + Intergenic
1008140331 6:47824457-47824479 ATGACTGGCAAAGCAGTGCAGGG + Exonic
1008413010 6:51205282-51205304 AAGAGGGGGGAGGGAGTGGAAGG - Intergenic
1008456590 6:51717780-51717802 GACACTGGGAAGAGAGTGGAAGG + Intronic
1008878852 6:56360155-56360177 AAAAGTGACAGGGGAGTGGAGGG + Intronic
1011435763 6:87334848-87334870 AAGATTGACAAGGGAATGCAAGG + Intronic
1012492297 6:99795569-99795591 AAGTATGGGAAGGGAGTGAAAGG - Intergenic
1013682311 6:112538279-112538301 AAGACATGAAAGAGAGTGGATGG - Intergenic
1014282071 6:119452822-119452844 AAGAATGGCACGGGAGGAGATGG + Intergenic
1014709286 6:124787474-124787496 AAGGCTGACTAGGGAGGGGAAGG + Intronic
1015666331 6:135633856-135633878 AGCACAGGCAAGGTAGTGGAAGG + Intergenic
1016800619 6:148165332-148165354 CTGACTGGAAAGGGAATGGAGGG - Intergenic
1017931949 6:158963481-158963503 GAGACTGGGAAGGGAAGGGAAGG - Intergenic
1018047977 6:159981432-159981454 GACACTGGCAAGGAACTGGAGGG - Intronic
1019407338 7:890411-890433 AGGACGGGCCTGGGAGTGGAGGG + Intronic
1020856232 7:13427809-13427831 AAAACTCTCAAGGGAGTGGTTGG - Intergenic
1020940118 7:14522601-14522623 ACAACTGGAAAGGGGGTGGATGG + Intronic
1020989324 7:15177724-15177746 AAGATAAGCAGGGGAGTGGAAGG - Intergenic
1022384239 7:29886992-29887014 AAGACCAGAAAGGGAGAGGAAGG + Intronic
1022573808 7:31478644-31478666 AGGACTGAAAAGGGAGTTGAAGG - Intergenic
1023935095 7:44734192-44734214 AAGGATGGGAAGGGAGGGGAGGG - Intergenic
1023938531 7:44756043-44756065 ATGGCAGGCAAGGCAGTGGAGGG - Intronic
1024523324 7:50326822-50326844 AAGACTGGACAAGGAATGGAAGG - Intronic
1025021547 7:55484343-55484365 AAGACTGGCAAGGGGGTGGAAGG - Intronic
1025971491 7:66330269-66330291 AGGAGAGGCAAGGGAGTTGAAGG + Intronic
1025985664 7:66449167-66449189 AAGACTGGCAAGGGTCTTAAGGG + Intergenic
1026314111 7:69212926-69212948 AAGACCGGCAGGGGAAAGGATGG + Intergenic
1026650218 7:72210049-72210071 AAGCCTGGGAAGGGCCTGGAAGG - Intronic
1026765455 7:73156904-73156926 AAGCCCGGCTAGGGAGTGGGGGG - Intergenic
1027041929 7:74966598-74966620 AAGCCCGGCTAGGGAGTGGGGGG - Intronic
1027081713 7:75235757-75235779 AAGCCCGGCTAGGGAGTGGGGGG + Intergenic
1027436074 7:78165694-78165716 AAGCCTGGCTTAGGAGTGGATGG - Intronic
1027850601 7:83446573-83446595 AAGAGTGGAAAAGCAGTGGAAGG + Intronic
1028489792 7:91398583-91398605 GAGACAGGCGAGGGAGTAGATGG + Intergenic
1028952710 7:96654953-96654975 TATACTGCCAAGGGAGGGGACGG - Intronic
1030042448 7:105464407-105464429 AAGACTGGCATGTGAGTTGGTGG + Intronic
1031283898 7:119841070-119841092 ACGGCTGGCATTGGAGTGGATGG - Intergenic
1031360399 7:120843076-120843098 AAGACTGTCAAAGGAGTCAATGG + Intronic
1031866052 7:127039821-127039843 AAGAAGGGGAAGGGAGAGGAAGG + Intronic
1031923443 7:127617825-127617847 AAAACAGGAAAGGGGGTGGAAGG + Intergenic
1032012653 7:128356954-128356976 CAGAGTGGTCAGGGAGTGGAGGG + Intronic
1032019901 7:128401523-128401545 AAGAAGGCCAGGGGAGTGGAGGG + Intronic
1032467611 7:132156272-132156294 AAGTCTGGCGAGGGAGTAGAGGG + Intronic
1032619308 7:133511738-133511760 AGGAATGGGAAGGGAGGGGAGGG - Intronic
1033009568 7:137605799-137605821 AAGACTGGGAAGGGTGTGGTGGG + Intronic
1033261144 7:139845044-139845066 AAGACTGGCCAGACTGTGGAGGG - Intronic
1033825738 7:145187067-145187089 AAGGAGGGCAAGGGAGGGGAGGG - Intergenic
1034721392 7:153297142-153297164 ATAACTGGCAAGGCAGTAGAGGG + Intergenic
1034781546 7:153886788-153886810 AAGTCTGGCGAGGGAGCGGAGGG - Intergenic
1035124478 7:156597696-156597718 ATGACTGGCAATGGAGGGGTGGG + Intergenic
1037382286 8:18299125-18299147 AAGACTGGTGAGGGAATAGAAGG - Intergenic
1038180107 8:25219611-25219633 CAAACTGTCAAGGAAGTGGAAGG - Intronic
1040023979 8:42764824-42764846 AAGAGTTGCAGGGGAGTGAAAGG - Intronic
1040653947 8:49482526-49482548 AAGAATGGCAAGGTTTTGGAAGG - Intergenic
1042061655 8:64824545-64824567 GAGACTGGTCAGGGAGAGGAGGG - Intergenic
1043261969 8:78212240-78212262 AGGACTGGCAGAGAAGTGGAGGG + Intergenic
1045165943 8:99605113-99605135 AAGACTAGTAAGGGAGGTGAAGG - Intronic
1046619102 8:116509064-116509086 AAGAGGGTCAAGGGAGTTGAGGG + Intergenic
1047333651 8:123915904-123915926 AAGACAGGCAAGTGAGAGGCAGG + Intronic
1047517683 8:125569358-125569380 AAGACTGGCCAGGGAGAGTTGGG - Intergenic
1047631009 8:126708567-126708589 AAGATGGGGAAGGGAGAGGAAGG - Intergenic
1047921401 8:129638414-129638436 TAAACTGGCAAGGGGGTGGTGGG - Intergenic
1048348355 8:133595474-133595496 AAGACTGTCATGGTAGTGGTGGG + Intergenic
1049203854 8:141354325-141354347 AAGACTGGTAGGGGAGGGGAGGG + Intergenic
1049615464 8:143573963-143573985 CAGACAGGCAAGGGTGTGGGGGG - Intergenic
1050593081 9:7180045-7180067 AAGAATCTCTAGGGAGTGGAAGG + Intergenic
1051395601 9:16616758-16616780 AAGACAGGGATGGGAGGGGAGGG + Intronic
1053540957 9:38973335-38973357 GAAACTTGAAAGGGAGTGGAGGG - Intergenic
1053805378 9:41796382-41796404 GAAACTTGAAAGGGAGTGGAGGG - Intergenic
1054139876 9:61518968-61518990 GAAACTTGAAAGGGAGTGGAGGG + Intergenic
1054625182 9:67390572-67390594 GAAACTTGAAAGGGAGTGGAGGG + Intergenic
1056075821 9:83039238-83039260 AAGAGTGGCAGGGGATAGGAGGG - Intronic
1057011476 9:91606259-91606281 AAGACTGGCCAAAGAGAGGATGG + Intronic
1057192131 9:93094204-93094226 AAGGGTGGCGACGGAGTGGAAGG - Intergenic
1058425435 9:104871492-104871514 CACACTGGCCAGGGCGTGGAAGG + Intronic
1058549338 9:106097216-106097238 GATACTGGCAAGGTTGTGGAGGG + Intergenic
1058781161 9:108336946-108336968 GAAAGTGGCAAGGGAGTGGAGGG + Intergenic
1058938482 9:109791440-109791462 CAGCCTGGCATGGCAGTGGAGGG + Intronic
1059661954 9:116410344-116410366 AGGAGTGGGTAGGGAGTGGATGG - Intergenic
1059757001 9:117303087-117303109 AAGCCTGCCAGGGGAGTTGAGGG - Intronic
1060067275 9:120513553-120513575 TAGATAGGCAAGGGAGAGGAAGG - Intronic
1060161483 9:121369459-121369481 AAGACTGGGAAGGGAGGGTGGGG + Intronic
1060214437 9:121730221-121730243 AAGGGTGGAAAGGGAGAGGAGGG - Intronic
1060884532 9:127141064-127141086 AGGGCTGTCCAGGGAGTGGAGGG + Intronic
1061002081 9:127908193-127908215 ATGACTTGAAGGGGAGTGGAGGG - Exonic
1062032301 9:134367214-134367236 AAGGCAGGCAGGGGAGTGGCTGG - Intronic
1203678811 Un_KI270756v1:46281-46303 TAGAATGGAAAGGGATTGGATGG - Intergenic
1185472377 X:391800-391822 AAAACCGGCAAAGGAGAGGATGG + Intergenic
1186154387 X:6710406-6710428 AACTCTGGGAATGGAGTGGAAGG - Intergenic
1187565625 X:20446830-20446852 GAGGCTGGCAAGTGAGAGGAAGG + Intergenic
1187573778 X:20532539-20532561 ATGACCGGCATGGGAGTGGGTGG + Intergenic
1189865590 X:45323805-45323827 AAGAGTGGGAAGGGTGGGGATGG - Intergenic
1191851590 X:65589579-65589601 AAACCTGGGAAGGGAGAGGAAGG + Intronic
1194837793 X:98702588-98702610 TAGACTGGGAAGGGTGGGGAGGG - Intergenic
1195544526 X:106100334-106100356 CACACTGGCAAGGGCGTGGCTGG + Intergenic
1195768348 X:108320423-108320445 AAGAGGGGCAAGGGAGTCAAGGG + Intronic
1196755618 X:119154985-119155007 AAGGCTGGCAAAGGTGTGGGTGG + Intergenic
1196763887 X:119225588-119225610 AAGAAAGTCAAGGAAGTGGAAGG + Intergenic
1196790410 X:119459340-119459362 AAGAGCAGCAAAGGAGTGGATGG + Intergenic
1197324437 X:125074639-125074661 AAGACTGGGAAAGGACTGGTAGG - Intergenic
1197636752 X:128923334-128923356 CAGAATGCCAAGGGAGTGAAGGG + Intergenic
1201109004 Y:10785208-10785230 AAGAAGTGCAATGGAGTGGATGG - Intergenic