ID: 1090985254

View in Genome Browser
Species Human (GRCh38)
Location 11:131760807-131760829
Sequence GAGCTAAGGAAACCTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090985248_1090985254 5 Left 1090985248 11:131760779-131760801 CCGGGGTGACTAAAGAAACCTGC 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1090985254 11:131760807-131760829 GAGCTAAGGAAACCTGTTCCAGG 0: 1
1: 0
2: 1
3: 12
4: 146
1090985247_1090985254 20 Left 1090985247 11:131760764-131760786 CCTCAGGAAGGGTCGCCGGGGTG 0: 1
1: 0
2: 2
3: 8
4: 115
Right 1090985254 11:131760807-131760829 GAGCTAAGGAAACCTGTTCCAGG 0: 1
1: 0
2: 1
3: 12
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090985254 Original CRISPR GAGCTAAGGAAACCTGTTCC AGG Intronic
902329244 1:15723002-15723024 GAGCTCAGGAATCCTGCTCCAGG - Intronic
904900105 1:33850367-33850389 GAGGTAAAGAAACTTGTTCATGG + Intronic
908602670 1:65757840-65757862 GAGCCAAGAAAACATGTACCTGG - Intergenic
912050155 1:105519532-105519554 CAGCTAAAGAAAACTGTTCCTGG + Intergenic
912159599 1:106965673-106965695 GAGGTAAGAAATCCTGTACCAGG - Intergenic
914423072 1:147547470-147547492 GAGCAAGGGAAACCAGTTCAAGG + Intronic
915300809 1:154950603-154950625 GTGCTAAGGAGCTCTGTTCCAGG - Intronic
915448735 1:155989993-155990015 GAGCTAAAGGAACTTGTTCAAGG + Intronic
918341228 1:183569388-183569410 GTGCTAGTGAAACCTGTACCTGG - Intronic
919330924 1:196170689-196170711 GTGCTGAAGAAGCCTGTTCCTGG - Intergenic
920696703 1:208186285-208186307 AAGAAAAGGAAACCTGTTTCAGG - Intronic
922556436 1:226536030-226536052 GGGCTCATGCAACCTGTTCCGGG + Intergenic
924097696 1:240571289-240571311 CAGATAATGAAACCTGTTCAAGG - Intronic
924240538 1:242035750-242035772 CAGCAAAGGAAACCTGTGCTTGG - Intergenic
924579345 1:245310494-245310516 GAGCTTAGGAAACTCGTTCAAGG + Intronic
1065280513 10:24132981-24133003 GAGCAAAGGAAAGTTGTTGCTGG + Intronic
1065505523 10:26426649-26426671 GAGTCCAGGAAACCTGATCCAGG + Intergenic
1069113603 10:64476741-64476763 GAGAAAAGCAAACCTGTTTCTGG + Intergenic
1071112554 10:82176793-82176815 GAGCTAAGGAAAACAAATCCAGG - Intronic
1071216273 10:83405933-83405955 CAGCTAAGGAAACCAGTACAAGG - Intergenic
1071446675 10:85755281-85755303 GAGCTAATGGAGCCTGCTCCTGG + Intronic
1072253957 10:93602617-93602639 GAGCTAGGAAAGCCTGTTTCTGG + Intronic
1073695425 10:105861069-105861091 GAGCAAAGGAAGCCTGTACGAGG + Intergenic
1073715970 10:106107851-106107873 AAGCCAAGGAAACCTGGTGCTGG + Intergenic
1075654438 10:124152055-124152077 GAGCCAAGGAAACCAGAACCAGG + Intergenic
1076164739 10:128272689-128272711 GAGGGAAGGGAACCTGTTCATGG + Intergenic
1078149623 11:8747716-8747738 AAGACAAGGAAACCTGCTCCAGG + Intronic
1087176759 11:95103567-95103589 GAGTTAAGTAAACCAGTTCTTGG - Intronic
1089413358 11:118265869-118265891 GAGTTAAGGAAACTTGATCTTGG + Intergenic
1090650038 11:128798618-128798640 GAGCAAAGGAAACCTGATCCAGG + Intronic
1090985254 11:131760807-131760829 GAGCTAAGGAAACCTGTTCCAGG + Intronic
1092223401 12:6730753-6730775 GAGCTGAGGGAACCAGCTCCTGG + Exonic
1092300870 12:7248976-7248998 GGGCTCATGCAACCTGTTCCAGG - Intergenic
1096332638 12:50727712-50727734 CAGCTGAGGTAACCTTTTCCTGG - Exonic
1097967022 12:65592172-65592194 TAGGGAAGGAAATCTGTTCCTGG + Intergenic
1098845804 12:75534362-75534384 GTGCTATGGAAACCTGTTATAGG + Intergenic
1099930480 12:89068543-89068565 GAGGTAAGGCAAGATGTTCCTGG - Intergenic
1100667791 12:96773150-96773172 GAGCTAAAGAAACCAATTCTAGG + Intronic
1101944440 12:109125751-109125773 GAGGTGAGGAAACTTGTTCAAGG + Intronic
1106793089 13:33176189-33176211 GAGCTGTGGAAATCTTTTCCTGG - Intronic
1112128892 13:96499541-96499563 GAGATAAGGACAGCTGTTTCAGG + Intronic
1114542316 14:23470330-23470352 TAGCTAAGGAAACCAGTGCTTGG + Intronic
1118305057 14:64648782-64648804 GGGCTAAGGAACCCTGGACCAGG + Intergenic
1119352531 14:73977887-73977909 GACTTAAGGAATCCTGTTTCAGG + Intronic
1121545928 14:94763672-94763694 GAGCTGAAGGAACCTGTCCCAGG + Intergenic
1125385192 15:39129675-39129697 AAGCAAAGCAAACCTCTTCCAGG - Intergenic
1125409951 15:39395692-39395714 AAGGAAAGGAAAGCTGTTCCAGG + Intergenic
1129199363 15:73989724-73989746 GAGGCAAAGAAACCTGTTCAAGG + Intronic
1129652154 15:77498639-77498661 GAGCTGAGGAGACCTGCTTCAGG - Intergenic
1130302315 15:82689309-82689331 GAGCTAAGGAGAGCTGCTCTTGG + Intronic
1130360033 15:83175434-83175456 AAGCTAAGAAAAACTGTGCCTGG - Intronic
1132352421 15:101148328-101148350 GAGGTCAAGAAACCTGCTCCAGG - Intergenic
1136087220 16:27894098-27894120 GAGCTAAGGTCACCTGGTCCAGG - Intronic
1139339918 16:66261752-66261774 GAGCTTAAGAAACTTGTTCCTGG - Intergenic
1141279061 16:82614172-82614194 CAGCTAAGCCATCCTGTTCCTGG + Intergenic
1142868260 17:2804402-2804424 GAGTTTAGGAAACCCGTTCAAGG + Intronic
1146580868 17:34037509-34037531 GATCTGATGAAACCTGTACCAGG - Intronic
1147596986 17:41723896-41723918 GAGCTAAGGACACTTGTTTGGGG - Exonic
1147882606 17:43663679-43663701 GAGATAAGGTGACTTGTTCCAGG - Intergenic
1147999990 17:44382085-44382107 GAAGGAAGGAAACCTCTTCCAGG - Intronic
1148121398 17:45214307-45214329 GAGCTGGGGAATCCTGTTGCGGG - Intergenic
1149865356 17:60148476-60148498 GGACTGAGGAAGCCTGTTCCTGG - Intergenic
1150122115 17:62612655-62612677 GATCTGATGAAACCTGTACCAGG + Exonic
1152335887 17:79700127-79700149 AGGCTGAGGGAACCTGTTCCAGG - Intergenic
1153386015 18:4497163-4497185 ATGCTAAGAAAACCTGTTTCAGG - Intergenic
1155717406 18:28962049-28962071 GTGCTGGGGAAAGCTGTTCCTGG - Intergenic
1156476067 18:37406190-37406212 GAGTAAAGGAAAGCTGTCCCTGG + Intronic
1158963969 18:62607756-62607778 AAGCTAAGGAGACCTGTCACGGG - Intergenic
1164795441 19:31023395-31023417 GGGCTCAGGAAATCTGCTCCTGG - Intergenic
1168319680 19:55501314-55501336 GAGCCAAGGAAAACCTTTCCAGG - Intronic
925727074 2:6883489-6883511 GAGCAATGGAAGCCTGATCCGGG + Exonic
926155600 2:10452214-10452236 GAGCTAAGGAAAACTATTTTTGG - Intergenic
926429432 2:12770933-12770955 ACACTAAGGAAACCAGTTCCAGG - Intergenic
927702913 2:25279304-25279326 GAGCTAATGAAAGGGGTTCCAGG + Intronic
928424218 2:31164896-31164918 GTGCTGAGGATAGCTGTTCCTGG - Intergenic
928489586 2:31767832-31767854 GAGCTAAGAAAATATGTGCCTGG - Intergenic
929490036 2:42387976-42387998 GAGCCAAGAAACCCAGTTCCTGG + Intronic
930252468 2:49050347-49050369 GAGTGAAGGAAACCTCTTCTTGG - Intronic
930539119 2:52681678-52681700 GAGCTTAGGATACCTGTCCTTGG - Intergenic
932327391 2:70872160-70872182 GTGCTAAGGAAACCTGTACAAGG - Intergenic
932343539 2:70981477-70981499 GAGCCAGGGAAAAGTGTTCCAGG + Intronic
936978418 2:118241796-118241818 GAGCTCAGGAGACTTGTTCCAGG - Intergenic
940072229 2:149701615-149701637 GGGCAAAGGAAATATGTTCCAGG + Intergenic
941106187 2:161356247-161356269 TAGCTAAGGCAACCTGTTATAGG - Intronic
942128335 2:172849930-172849952 GAGTTGGGGAAACCAGTTCCTGG + Intronic
944125204 2:196284513-196284535 GCACTAAGGAAACCTGTCCAAGG - Intronic
944235232 2:197436242-197436264 GAGCTTAGATAACCTGTCCCTGG + Intergenic
946634062 2:221705200-221705222 GAGCAAAGGACAGCTGTTTCCGG + Intergenic
948004260 2:234594277-234594299 TGGCTAAGGAAGCCTCTTCCTGG + Intergenic
1171526031 20:25812017-25812039 GAGCTAAGGAAAACGGACCCAGG + Intronic
1171550796 20:26043868-26043890 GAGCTAAGGAAAACGGACCCAGG - Intergenic
1172810391 20:37643403-37643425 GAGGTGAAGTAACCTGTTCCAGG - Intergenic
1173413449 20:42836151-42836173 AGGCTAGGGTAACCTGTTCCTGG - Intronic
1173937351 20:46878639-46878661 GGCCAAAGGAAACTTGTTCCTGG - Intergenic
1174858645 20:54069756-54069778 GGGCTGAGGGAACCTGCTCCAGG + Intronic
1176428617 21:6563244-6563266 GAGCTCAGGAAGCATGTTCCAGG - Intergenic
1179704107 21:43171560-43171582 GAGCTCAGGAAGCATGTTCCAGG - Intronic
1183315457 22:37134690-37134712 GATCCATGGAAACCAGTTCCAGG - Intronic
1183347818 22:37317641-37317663 GAGCTTAGGAAACCTGCTTAAGG - Intergenic
1203242242 22_KI270733v1_random:29655-29677 GGGCTCATGCAACCTGTTCCAGG - Intergenic
949202781 3:1399693-1399715 TGGCTAAGGAAAACTGTTCAGGG - Intronic
956001038 3:64730400-64730422 GAGATAAAGAAACTTGTCCCAGG + Intergenic
958896821 3:99838727-99838749 CATATAAGGAAAGCTGTTCCAGG - Intronic
959555663 3:107714291-107714313 TAGCTCAGGCAACCTTTTCCAGG + Intronic
962301092 3:134243746-134243768 GAGTTTAGGAAACTTGTCCCAGG - Intronic
964584509 3:158281901-158281923 TAGCTGAGGAAACTGGTTCCAGG + Intronic
970079995 4:12271444-12271466 GAGCAAAGGACTCCTGTGCCAGG - Intergenic
970491133 4:16574863-16574885 GAGCTTAGGAAACTTGTTCAAGG + Intronic
970582598 4:17487178-17487200 GAGCTCAGGAAGCCTAATCCAGG - Exonic
970862107 4:20716175-20716197 GAACTCAGGAAAGCTGTTACTGG + Intronic
971371544 4:26023321-26023343 GAGCTTAGGAAACCTGCTTCTGG - Intergenic
972995554 4:44874610-44874632 AAGGTAAGGAGACTTGTTCCAGG - Intergenic
973170455 4:47136313-47136335 GAAAGAAGGACACCTGTTCCAGG - Intronic
974507307 4:62792358-62792380 GAGCAAAGGAAACCTTGCCCTGG + Intergenic
975537046 4:75461752-75461774 GAGAAAAGGAAACCTATACCTGG + Intergenic
978020378 4:103802790-103802812 GAGCTAAGTAAAACTCATCCAGG + Intergenic
978231020 4:106399658-106399680 GAGATAAGGTAACATGTTCAAGG + Intergenic
981477268 4:145199482-145199504 GAGATAAGGAAGCCCATTCCGGG - Intergenic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
985028151 4:185759776-185759798 TAACTAAGGAACCCTGTTACAGG - Intronic
985984995 5:3507656-3507678 GACCGATGGAAACCTGATCCGGG - Intergenic
986607640 5:9538015-9538037 GAGCTGAGGAAGCCTGTGGCAGG + Intronic
991658045 5:68922734-68922756 GAGCTAAGGAAAGCTTTCCCTGG - Intergenic
992162111 5:74013858-74013880 GAGCTGGGGAAACTTGGTCCTGG + Intergenic
993457624 5:88143816-88143838 GAGAAAAGGAAACTTGTGCCTGG + Intergenic
993886631 5:93422822-93422844 CAGCTGAGGAAAATTGTTCCAGG - Intergenic
995066938 5:107873090-107873112 AAAGTAAGGAAAACTGTTCCTGG + Intronic
996402908 5:123082769-123082791 GAACTGAGGAAAAGTGTTCCAGG - Intergenic
1000232066 5:159325240-159325262 GAGCTCAGGAACCTTGGTCCTGG - Intronic
1010160266 6:72845988-72846010 GAGGTTAGGAAGCCTGTTCAGGG + Intronic
1011550546 6:88527763-88527785 GAGACAGGGAAACCAGTTCCAGG + Intergenic
1012039121 6:94182617-94182639 GAGCAAAGGAAACCTAGTCATGG + Intergenic
1013186677 6:107765290-107765312 GAGCTCAGGATGCCTGTACCCGG - Intronic
1017663349 6:156695376-156695398 GAGTTTAGGCAACCTGTTCAAGG - Intergenic
1019512049 7:1422592-1422614 GAGGGAAGGGAGCCTGTTCCCGG - Intergenic
1023822956 7:43990271-43990293 GCGCTAGGGGAAGCTGTTCCTGG + Intergenic
1026220038 7:68387605-68387627 GAGCTCACAAAACCTGTTCTGGG + Intergenic
1029751219 7:102543700-102543722 GTGCTAGGGGAAGCTGTTCCTGG + Intronic
1029769171 7:102642805-102642827 GTGCTAGGGGAAGCTGTTCCTGG + Exonic
1033356590 7:140605595-140605617 GAGCTAAGGAGCTCTTTTCCAGG - Intronic
1034096993 7:148418622-148418644 GAGCTCAAGAAAGCTGGTCCAGG + Exonic
1037341203 8:17847521-17847543 GTTCCAAGGAAACCTGATCCTGG + Intergenic
1037890324 8:22620663-22620685 GAGCAGAGGAAACCCCTTCCTGG - Exonic
1038022535 8:23562249-23562271 GAGCCAAGGCAACCTGTCCCAGG - Intronic
1042657446 8:71115444-71115466 TAGCTAAGGAAAAGTCTTCCAGG + Intergenic
1042884123 8:73529001-73529023 GAGGTAGGGAAACTTCTTCCTGG + Intronic
1044983116 8:97735682-97735704 GGGCTCACGCAACCTGTTCCAGG + Intergenic
1047616194 8:126564381-126564403 GGGCTAAGGAAAGCAGTTACAGG - Intergenic
1050191299 9:3029388-3029410 GAGGGAAGGAAGCCTGTTTCTGG + Intergenic
1050984661 9:12067245-12067267 GAGTTAAGGAAACCTTTTTATGG + Intergenic
1051546516 9:18281674-18281696 GGGCTCAGACAACCTGTTCCGGG + Intergenic
1051734639 9:20186065-20186087 GAGCTAAGGAAGCCTCATCATGG - Intergenic
1051734917 9:20188281-20188303 GAGCTAAGGAAACCTCATGATGG - Intergenic
1060721805 9:125984523-125984545 GAACCAAGGAGACCTGTGCCTGG - Intergenic
1203458570 Un_GL000220v1:12732-12754 GGGCTCATGCAACCTGTTCCAGG - Intergenic
1185980809 X:4775506-4775528 GGGCTTAGACAACCTGTTCCAGG + Intergenic
1187235261 X:17461253-17461275 GAGCCAAGGAAAGCTTTTCAGGG + Intronic
1189205597 X:39235994-39236016 GAGCTAAAGAAAACTCTCCCAGG - Intergenic
1189297507 X:39929328-39929350 GGGCTAAGGCAAGCTATTCCAGG + Intergenic
1190528713 X:51353517-51353539 GAGCTAAAGTAACCTGAGCCTGG - Intergenic