ID: 1090985576

View in Genome Browser
Species Human (GRCh38)
Location 11:131762859-131762881
Sequence CTCCTGTCCAGAGCCAGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 1, 2: 4, 3: 30, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090985576 Original CRISPR CTCCTGTCCAGAGCCAGCAG GGG (reversed) Intronic