ID: 1090986898

View in Genome Browser
Species Human (GRCh38)
Location 11:131775551-131775573
Sequence TGGTGTCAACAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 416}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090986898_1090986906 12 Left 1090986898 11:131775551-131775573 CCCTCTTCCCTCTGTTGACACCA 0: 1
1: 0
2: 1
3: 33
4: 416
Right 1090986906 11:131775586-131775608 CATTTAGGGAACATCTCTTCTGG 0: 1
1: 0
2: 1
3: 12
4: 163
1090986898_1090986904 -3 Left 1090986898 11:131775551-131775573 CCCTCTTCCCTCTGTTGACACCA 0: 1
1: 0
2: 1
3: 33
4: 416
Right 1090986904 11:131775571-131775593 CCATTTATAGGTAGTCATTTAGG 0: 1
1: 0
2: 0
3: 12
4: 186
1090986898_1090986905 -2 Left 1090986898 11:131775551-131775573 CCCTCTTCCCTCTGTTGACACCA 0: 1
1: 0
2: 1
3: 33
4: 416
Right 1090986905 11:131775572-131775594 CATTTATAGGTAGTCATTTAGGG 0: 1
1: 0
2: 0
3: 11
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090986898 Original CRISPR TGGTGTCAACAGAGGGAAGA GGG (reversed) Intronic
902264985 1:15256867-15256889 TGCTGTCCACAAAGGGCAGAGGG - Intronic
902610710 1:17595662-17595684 GGGCGGCCACAGAGGGAAGAGGG + Intronic
902885552 1:19402274-19402296 TTGTCTCAACAGAGGCAACAAGG + Intronic
903042206 1:20539713-20539735 TGATGACAACAGAGGGGAGCTGG + Intergenic
903192336 1:21663728-21663750 TGGGGGCAGCAGAGGGAAGGTGG - Intronic
903836123 1:26204236-26204258 TGTTGGCCAGAGAGGGAAGAAGG + Intergenic
904013965 1:27406300-27406322 TGATGTGTAAAGAGGGAAGAGGG + Exonic
904871774 1:33623916-33623938 TGGCGTCAAGGCAGGGAAGAGGG - Intronic
905303931 1:37004826-37004848 CGGTCTCAAGAGTGGGAAGAGGG - Intronic
905915504 1:41681726-41681748 TGGTGGCACCTGAGGGAGGAGGG + Intronic
906674694 1:47684893-47684915 TGGGGTCAATAGAGGGGAAAGGG - Intergenic
907536701 1:55168082-55168104 AGGAGTCAACAGAGGAAACATGG + Intronic
909349987 1:74640330-74640352 GGGTGACAACAAAGGAAAGATGG + Intronic
909809817 1:79918745-79918767 TGGTTTCAGCAGAGTGCAGAGGG + Intergenic
909964065 1:81885663-81885685 TGGTGTCAAAAAGGGCAAGATGG + Intronic
911022967 1:93407555-93407577 TGGAGTCTACAGAGGCAGGAAGG + Intergenic
911559387 1:99385340-99385362 AGGAGTCCACAGAGGGAATATGG - Intergenic
912169428 1:107080517-107080539 TGGTGTGCACAGAGGGTAGCAGG + Intergenic
912265113 1:108149684-108149706 TGCTGTCACCAGAGGGACAAGGG + Intronic
913340539 1:117753733-117753755 TCGTGCCATCAGAGTGAAGAAGG + Intergenic
915495748 1:156281836-156281858 TGTTGCCAACAGAGGGCTGAAGG + Intronic
915719427 1:157973476-157973498 TGGTAACTACAGAGGGAAGTGGG - Intergenic
916188351 1:162154689-162154711 AGGTCACAAGAGAGGGAAGATGG - Intronic
916783966 1:168069463-168069485 TTATCTCAACAGAGTGAAGATGG - Intronic
916953708 1:169809437-169809459 TGGTGTCAAGAGAAGCAAGAAGG - Intronic
917398319 1:174618184-174618206 TGGAGTCTACAGAGGTAAGCAGG - Intronic
918868085 1:189929824-189929846 TGGTAACAAAAAAGGGAAGATGG + Intergenic
919065471 1:192688325-192688347 TGGTGTCTACAGAGGCAGGCAGG + Intergenic
920035170 1:203060726-203060748 TGGGGGAAACAAAGGGAAGAGGG + Intronic
921087629 1:211810947-211810969 AGGTGACAACAGAGGGAAGTAGG + Intronic
921469627 1:215532741-215532763 TGGAGTCTACAGAGGCAAGCAGG - Intergenic
922861879 1:228825997-228826019 GGGTGTCAACAGAGGCCAAATGG - Intergenic
922997587 1:229977000-229977022 TGGTGGTGACAGAGGGAAGTAGG + Intergenic
923287091 1:232506560-232506582 TGGTATCAAGAGAGGTAAGAGGG + Intronic
923380364 1:233411325-233411347 TGGAGTCTGCAGAGGGCAGAAGG - Intergenic
923450360 1:234111658-234111680 TGGAGTCAGCAGAGGGAGCATGG - Intronic
923536253 1:234854314-234854336 TTGTCTCAAAAGAGGGAAGCCGG + Intergenic
1063217741 10:3939211-3939233 TGGTGTCCTCACAGGGAGGAAGG - Intergenic
1063309012 10:4935503-4935525 TGCTGACAGCTGAGGGAAGAGGG + Intronic
1063556430 10:7084062-7084084 TGGTGGGAACAGAAGGAGGAGGG + Intergenic
1064237721 10:13591839-13591861 TGGATTCCACAGAGGCAAGAGGG - Intronic
1064347691 10:14547992-14548014 TGGTCTGAAGAGAGGGAAGTGGG - Intronic
1065439110 10:25731089-25731111 TGGTAACAAAAAAGGGAAGATGG + Intergenic
1066565935 10:36722137-36722159 TGGTTGAAACAGAGGGAAAATGG - Intergenic
1067529140 10:47057842-47057864 TTGTGTCAAGTGAGGGAAGAGGG - Intergenic
1068428504 10:56900091-56900113 TCATGTCAGCAGAGGAAAGATGG - Intergenic
1068576218 10:58687469-58687491 TGGAGTCTACAGAGGGAGGCAGG + Intronic
1068965891 10:62911806-62911828 TGCTCTAAACAGAAGGAAGAGGG + Intronic
1069598965 10:69691011-69691033 TGGTGCCAGCAGAAGCAAGAGGG - Intronic
1070814970 10:79317275-79317297 GACTGTCCACAGAGGGAAGAAGG + Intergenic
1071336398 10:84604012-84604034 TGGTGTCCACTGGAGGAAGACGG + Intergenic
1071918796 10:90326200-90326222 TGTGGCCAAAAGAGGGAAGATGG + Intergenic
1072014500 10:91333491-91333513 TGCTGTTAACAGAAGAAAGAAGG + Intergenic
1072929185 10:99646159-99646181 TGGAGTCTACAGAGGCAGGAAGG + Intergenic
1073857147 10:107690184-107690206 TGGGATCAAAAGAGGGAGGAAGG + Intergenic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076730743 10:132437666-132437688 GGGTGCCCACAGAGGGAAGTGGG - Intergenic
1077239297 11:1502313-1502335 AGGTGCCACCAGAGGGAGGAAGG + Intergenic
1077921240 11:6643249-6643271 TGTAGTCACCAGAGGAAAGAGGG + Intronic
1078761247 11:14253572-14253594 TGGTCCCAACAGAGGGCACAGGG + Intronic
1078860755 11:15244178-15244200 TGGTGACAACTCAGGGAAAATGG + Intronic
1078867150 11:15308429-15308451 TAACTTCAACAGAGGGAAGAGGG - Intergenic
1080180735 11:29422905-29422927 TGGTGTAGACAGAGGGAATATGG - Intergenic
1080471830 11:32553242-32553264 TGGTGTCAACAGAGGTCACTTGG + Intergenic
1081550064 11:44102644-44102666 TGGCCTCAGCAGAAGGAAGAGGG - Intronic
1081604510 11:44519010-44519032 TGGGGTCCTCAGAGGGCAGATGG - Intergenic
1081768270 11:45628092-45628114 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1081786528 11:45751521-45751543 TGGTGCCCCCAGAGGGAAGCTGG + Intergenic
1082054379 11:47801072-47801094 TGGAGTGACCAGAGGAAAGAGGG + Intronic
1082613813 11:55334887-55334909 TGGAGTCTACAGAGGCAAGCAGG + Intergenic
1082754752 11:57063280-57063302 TGGAGTCTACAGAGGCAAGCAGG - Intergenic
1083729643 11:64645856-64645878 TGGTTTCAAGAGAGGAAAGAGGG - Intronic
1084438521 11:69157659-69157681 TGGTGGCACCAGAGAGAACAGGG + Intergenic
1084676649 11:70639393-70639415 TGGTGTCTTCAAAGGGCAGAAGG + Intronic
1085392672 11:76190404-76190426 GGGGGTCGGCAGAGGGAAGATGG - Intronic
1087103203 11:94384741-94384763 TGGAGTCTACAGAGGGAGGCAGG - Intronic
1087503991 11:98996970-98996992 TGGAGTCTACAGAGGCAAGCTGG - Intergenic
1089054348 11:115573074-115573096 ACGTGTGAACAGAGGGAAAACGG + Intergenic
1089098893 11:115943576-115943598 TGGTGGCAAAAGAGGAAAGGGGG - Intergenic
1089342968 11:117772123-117772145 GGGTGTCAACAGAGAGAGGAGGG + Intronic
1089389250 11:118088838-118088860 TGGAGTTAATAGAGGGAAGGAGG - Intronic
1090153715 11:124413938-124413960 TGGTTTCTGCAGTGGGAAGATGG - Intergenic
1090735656 11:129610374-129610396 AGGTGTCAACAGATGGGATATGG + Intergenic
1090925599 11:131247363-131247385 CTTTGTCAACAGAAGGAAGAAGG - Intergenic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1091237441 11:134031528-134031550 TGGTGGAAACAGGGGGTAGAAGG + Intergenic
1091364309 11:135004983-135005005 TAGTGACAGCAGAGGGGAGAAGG - Intergenic
1091772629 12:3162949-3162971 TGCTGTCCACAGTGGGAGGAAGG - Intronic
1092041253 12:5386672-5386694 TGGAGAGAAAAGAGGGAAGATGG - Intergenic
1092325739 12:7529056-7529078 TGGAGTCTACAGAGGTAAGCAGG - Intergenic
1092536070 12:9388404-9388426 TGGTGACAGAAAAGGGAAGATGG - Intergenic
1092794251 12:12094525-12094547 TGGTGTCAACCAAGGGAATGGGG - Intronic
1094225295 12:28038853-28038875 TGGAGTCCACTGAGGGACGACGG - Intergenic
1095588210 12:43871797-43871819 TGCTGTGAACAAAGGGAAAAAGG - Intronic
1097793229 12:63837127-63837149 TGCTGCCAAAAGAGGGAAAATGG + Intergenic
1098725282 12:73957004-73957026 TGGTTTCAAAAAAAGGAAGAAGG - Intergenic
1098834388 12:75403745-75403767 TGGTGTGAACAGAAGGATGAAGG - Intronic
1099025485 12:77459796-77459818 TGGGGTCTACAGAGGCAAGCAGG - Intergenic
1099110537 12:78554721-78554743 TGGTGTTAACAGATGAAGGAAGG - Intergenic
1099903128 12:88737103-88737125 TGGTGTCTACAAAAGGAGGAAGG - Intergenic
1100861241 12:98809638-98809660 TGATGTCACCAGAAGGCAGAGGG + Intronic
1101973687 12:109336311-109336333 TGGTGTTAACAGGGGTTAGAAGG - Intergenic
1102124518 12:110469171-110469193 TGTTGTGGACAGAGGGCAGAGGG + Intronic
1102527021 12:113519697-113519719 TGGGGTGAAAAGAGGGAAGGGGG - Intergenic
1103361651 12:120358200-120358222 TGTTTTCCAAAGAGGGAAGAAGG + Intronic
1103931610 12:124453667-124453689 TGGTGTCACCAGCGGGTTGAGGG - Intronic
1104035239 12:125093004-125093026 TGGTGTCCCCAGAGGGAGAATGG + Intronic
1104159813 12:126167587-126167609 TTGTGTCAACAGATGACAGAGGG + Intergenic
1104729849 12:131098679-131098701 AGGTGACTGCAGAGGGAAGAGGG - Intronic
1104963807 12:132500215-132500237 AGTTCTCAACAGAGGGAAGGTGG - Intronic
1105438851 13:20399599-20399621 TGGTGACAACAGAGTGTGGAGGG + Intergenic
1105644148 13:22298776-22298798 TGCTGGCATCAGAGGGTAGATGG + Intergenic
1105707450 13:22977066-22977088 TGGGGTAGACGGAGGGAAGATGG + Intergenic
1106353473 13:28956765-28956787 TGGCGGGGACAGAGGGAAGAAGG + Intronic
1106353487 13:28956825-28956847 TGGCGGGGACAGAGGGAAGAAGG + Intronic
1106353497 13:28956885-28956907 TGATGGCGACAGAGGGAAGAAGG + Intronic
1107380675 13:39853876-39853898 TGGAGTCTACAGAGGCAAGCAGG + Intergenic
1107392622 13:39982895-39982917 TGGTGACAGCAGAGTGGAGAAGG + Intergenic
1107562265 13:41568167-41568189 TGGTGTCATCAGGGTGATGAAGG + Exonic
1107989847 13:45810149-45810171 TGGTGTCTCCTGAGGGAGGATGG - Intronic
1110694493 13:78472323-78472345 AGATGTCAGCAGAGGAAAGAGGG - Intergenic
1113099782 13:106704615-106704637 TGTGGTCAAGAGTGGGAAGAAGG - Intergenic
1114439647 14:22735955-22735977 GGGTCTCAAGAGAGGGAAAATGG - Intergenic
1114639144 14:24207410-24207432 TGGTGTCATCAAAGGGCAGATGG - Exonic
1116711329 14:48371855-48371877 TGGAGTCTACAGAGGGAGGCAGG + Intergenic
1117653349 14:57928918-57928940 TGGTTTCAACAGAGGAAAAGAGG + Intronic
1118089832 14:62461669-62461691 TGGTGTCAACAGAGAGTAATAGG + Intergenic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1118339433 14:64881451-64881473 TGTTGTCAACAAAGGGGAGGAGG - Intergenic
1118395178 14:65330083-65330105 TGGGGTCAACAGAGCACAGATGG - Intergenic
1118710749 14:68517450-68517472 AGATGTCAACACAGTGAAGAAGG + Intronic
1119568121 14:75646172-75646194 TGAGGTCATCAGAGGGAAAAAGG - Intronic
1121586223 14:95064800-95064822 AGATGTCACCAGAGAGAAGAAGG + Intergenic
1121826392 14:97013226-97013248 TGGTGTAAACAGAGGGCAAGCGG - Intergenic
1122836870 14:104434840-104434862 TGGGGTGGACTGAGGGAAGATGG + Intergenic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1202875387 14_GL000225v1_random:203001-203023 TGGTGTCAAATGAGGCAAAATGG - Intergenic
1202877866 14_KI270722v1_random:24221-24243 TGGTGTCAAATGAGGCAAAATGG - Intergenic
1124045499 15:26146337-26146359 TGGTGACAGCAGAAGGAAGGTGG - Intergenic
1125637718 15:41203413-41203435 GAGTCTCAACAAAGGGAAGAGGG - Intronic
1127050803 15:55081440-55081462 GGGTGTCAACAGAGGCCAGGTGG + Intergenic
1127672756 15:61211666-61211688 TGATGGCCACAGAGGGCAGAGGG + Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1128065625 15:64762877-64762899 TGGTGTGAACAGAGAAGAGAAGG + Intronic
1128257206 15:66205722-66205744 TGGTGTCAACAGAGGACAAGCGG + Intronic
1128495442 15:68195888-68195910 TGGAGTCAGCAGAGGGAGCAGGG - Intronic
1129493745 15:75956105-75956127 TGTTGTAAAAAGGGGGAAGAAGG - Intronic
1129699998 15:77762413-77762435 TGGTCTCAATCCAGGGAAGAAGG - Intronic
1130002200 15:80057559-80057581 TGGTGTCCACAGAGGGTGGGGGG - Intergenic
1130278185 15:82494597-82494619 TGGTGTCAATAGATGGAGGCTGG - Intergenic
1130470514 15:84221782-84221804 TGGTGTCAATAGATGGAGGCTGG - Intergenic
1130478002 15:84336349-84336371 TGGTGTCAATAGATGGAGGCTGG - Intergenic
1130493763 15:84451781-84451803 TGGTGTCAATAGATGGAGGCTGG + Intergenic
1130592801 15:85226408-85226430 TGGTGTCAATAGATGGAGGCTGG - Intergenic
1130658783 15:85813490-85813512 TGGTGGAAAGAGTGGGAAGAGGG - Intergenic
1132771740 16:1567399-1567421 TGGGGACAGCAGAGGGCAGAGGG - Intronic
1133325176 16:4937571-4937593 TGGTGGCAATTGAGGGAAGGGGG + Intronic
1133755333 16:8758406-8758428 TGGTCTCAGCAGAGAGAAGAGGG + Intronic
1133845716 16:9451895-9451917 GGGTGTCTACAGAGAGAATATGG - Intergenic
1134813784 16:17189176-17189198 TGGTGTTGAGAGAAGGAAGAAGG + Intronic
1136652852 16:31687734-31687756 TGGAGTCTACAGAGACAAGAAGG - Intergenic
1137371478 16:47910396-47910418 TGGTGTCTACAGAGGCAGGGAGG - Intergenic
1137405934 16:48189340-48189362 TGGTGGCGACAAAGGGAAAATGG + Intronic
1138495589 16:57407170-57407192 TGTTGTCAGCAGAGGGAAAGGGG + Intronic
1138702476 16:58878724-58878746 TGGAGTCTACAGAGGCAAGCAGG + Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140873264 16:79126241-79126263 TGCTGGAAACAGAGGTAAGAAGG + Intronic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1143287330 17:5800082-5800104 TGGTTGCAACAAAAGGAAGAAGG - Intronic
1143897253 17:10145746-10145768 AGGAGTCAACTGAGGGAAGGGGG + Intronic
1144406601 17:14957997-14958019 TTGTGACAGCAGTGGGAAGAAGG - Intergenic
1145058740 17:19719339-19719361 TCATGTCAGCAGATGGAAGAAGG + Intergenic
1146447302 17:32942615-32942637 TGGAGTCAGGAGAGGGAAGCTGG + Exonic
1146808646 17:35885737-35885759 TGGTGTCTGCAGAGCGTAGAAGG - Intergenic
1147407141 17:40220117-40220139 TGGTGTGAAGTGAGGGAAGATGG + Intronic
1147726457 17:42568728-42568750 TGGTGTCCAGAGAAGGCAGATGG - Intronic
1148575362 17:48706762-48706784 TGGAGACAAGAGAGGGAAAAAGG - Intergenic
1148828384 17:50411977-50411999 TGGAATGAACAGAGGGGAGAAGG - Intergenic
1149066810 17:52490254-52490276 TAGTGGCAACTCAGGGAAGAGGG + Intergenic
1149307622 17:55364295-55364317 TGATGTCAAGAGAGGGCAGAAGG + Intergenic
1150346085 17:64405771-64405793 TGGGGACAACAGAAGGATGAAGG + Intronic
1150451320 17:65271232-65271254 TGGTGGGAAAAGAGGGGAGAGGG + Intergenic
1150524006 17:65902545-65902567 TTGTGTCAACAGATTGAAGAAGG - Intronic
1152340173 17:79720079-79720101 TGGGCTCAGCCGAGGGAAGAGGG + Intergenic
1152807603 17:82363879-82363901 TGGTGGGAACAGAGGATAGAAGG + Intergenic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1154364096 18:13690295-13690317 TGGTGTCTACAGAGGCAGGCAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156237849 18:35221331-35221353 TGGTGTCATGAGGGGGAACAGGG - Intergenic
1156275020 18:35576071-35576093 TTGTTACAACAGAGTGAAGATGG - Intergenic
1156408139 18:36802319-36802341 TGGTGTCTACAGTTGGCAGAAGG - Intronic
1156433454 18:37100562-37100584 TGGAGTCTACAGAGGCAAGAGGG - Intronic
1156745265 18:40383298-40383320 TGATGTCACCAGAGAAAAGATGG - Intergenic
1156771700 18:40735565-40735587 TGGGGTGAAGGGAGGGAAGAGGG - Intergenic
1156985084 18:43341601-43341623 AGGTGTCAACAGAGGCTCGATGG - Intergenic
1157571566 18:48715814-48715836 TGGTATCAGCAGAGAGAAGTTGG + Intronic
1158411215 18:57207694-57207716 TTGTGTCAACAGCAGGTAGATGG - Intergenic
1159881071 18:73859088-73859110 TGGTGTCATCATAAGGAAAAGGG + Intergenic
1160118776 18:76108617-76108639 TGGTGTCAACAGAGGCCAATGGG - Intergenic
1160410311 18:78671225-78671247 TGCTGTGATCAGAGAGAAGACGG - Intergenic
1160496030 18:79376120-79376142 TGGGGGCAACAGAGGGCAGCTGG - Intronic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161649384 19:5474925-5474947 AGGTGTCCACAGAGTGAAGGTGG + Intergenic
1161762340 19:6183313-6183335 TGGGGTCAAGAGGGGGAAGGTGG + Intronic
1167748277 19:51365606-51365628 TGTTGTCCCCAGAGGGAAGCTGG - Intronic
1168503745 19:56915615-56915637 TGGAGTGAACAAAGGGGAGATGG + Intergenic
1168506144 19:56936840-56936862 TGGTGTGCACAGCAGGAAGAGGG - Intergenic
1202643644 1_KI270706v1_random:121784-121806 TGCGGTCAACAGAGGGGATAGGG + Intergenic
1202672812 1_KI270710v1_random:8712-8734 TGGTGTCAAATGAGGCAAAATGG + Intergenic
925135210 2:1522043-1522065 TGGGGTCAGGAGAGGGAGGAAGG - Intronic
926122564 2:10252777-10252799 TGGTGGCAGCAGTGGGGAGAGGG + Intergenic
926286688 2:11494248-11494270 TGGTGACAAGTCAGGGAAGACGG - Intergenic
927020435 2:19011129-19011151 TGGTAGAAACATAGGGAAGATGG + Intergenic
927326635 2:21812755-21812777 AGGTGCCAACAGAGGGGAAATGG - Intergenic
928403522 2:30996558-30996580 TGGTGTGAATAGAGAGTAGAGGG - Intronic
928922164 2:36537488-36537510 TGGGCTCAACACAGGGCAGAGGG - Exonic
930448183 2:51500923-51500945 TGGAGTCTACAGAGGCAAGCAGG + Intergenic
930553606 2:52867752-52867774 TGTTGTAAACAGAGGCGAGATGG + Intergenic
930885778 2:56324238-56324260 AGCTGCCAACAGAGGGGAGAAGG + Intronic
931115331 2:59160459-59160481 TGGAGACAACAGAGGGGAGTCGG + Intergenic
931355135 2:61530582-61530604 TGCTGATAACAGAGGGTAGAGGG + Intronic
931769900 2:65488433-65488455 TGGTGTGAAAGGAAGGAAGATGG - Intergenic
932659523 2:73640308-73640330 GGGTCTCTGCAGAGGGAAGAAGG - Intergenic
932666087 2:73699979-73700001 GGGTCTCTGCAGAGGGAAGAAGG - Intergenic
932979147 2:76642375-76642397 GGCTGGCAACTGAGGGAAGAAGG - Intergenic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
933627654 2:84619882-84619904 TGCTGTCACCAGAGGGAGAAAGG + Exonic
934520575 2:95017842-95017864 TGATGTGATCAGAGGGAGGATGG + Intergenic
935156935 2:100491709-100491731 TGGTCTGACCAGAGGGCAGAGGG + Intergenic
935280320 2:101511735-101511757 TGGGGACTACAGAGGGAGGAGGG + Intergenic
937420228 2:121747956-121747978 GGGTGTCAACAGAGGCCAAATGG + Intronic
938287408 2:130129232-130129254 TGGTGTCGACAGTGGTAGGAGGG - Intergenic
938799895 2:134752116-134752138 TGGTGTCTACAGAGGTAGGCTGG + Intergenic
939042954 2:137214262-137214284 TGTTGTAAACATAAGGAAGATGG - Intronic
939682623 2:145157538-145157560 TGCAGGGAACAGAGGGAAGAGGG - Intergenic
940845793 2:158640735-158640757 TGGTGACAACAAAGTGAAGATGG + Exonic
941536505 2:166728712-166728734 TGATGGCTAGAGAGGGAAGATGG + Intergenic
941687475 2:168461914-168461936 AGGTGGCAGCAGAGGGAAAATGG + Intronic
941918606 2:170828317-170828339 AGATGACAGCAGAGGGAAGAGGG - Intronic
941918620 2:170828383-170828405 TGGGGACAGCAGAGGGAGGAGGG - Intronic
942929492 2:181472794-181472816 AGGGGAAAACAGAGGGAAGATGG - Intronic
943068412 2:183113367-183113389 TGGTGGCAGGAGAGGGAAGTTGG + Intergenic
943140498 2:183975964-183975986 TGGAGTCTACAGAGGCAAGCAGG - Intergenic
943358898 2:186894563-186894585 TGGTAACAAAAAAGGGAAGATGG + Intergenic
944466938 2:200011154-200011176 TGGAGGCAAGAGAGGGAAAAAGG + Intergenic
944556274 2:200890699-200890721 GGTTGGCAACAGAGGGAAGGTGG - Intronic
944663007 2:201936819-201936841 TTGTCAGAACAGAGGGAAGAGGG + Intergenic
945714631 2:213343005-213343027 TGGTGTACACAGAAGGAAGGAGG + Intronic
945946801 2:216002680-216002702 AGGTCTCAATAGAGGGAAGAAGG - Intronic
947632587 2:231663603-231663625 AGGTGTCAACAGTGGGCACACGG - Intergenic
948551179 2:238773805-238773827 TGGTTTCCACAGAGGGAAAGTGG - Intergenic
949036414 2:241817534-241817556 TGGGGCCAGCAGAGGGAAGGCGG + Intergenic
1168911635 20:1452652-1452674 TGAGGTCCACAGAGAGAAGATGG + Intronic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1170358258 20:15516593-15516615 TGGTTTGAACAGAAGGTAGAGGG + Intronic
1172035875 20:32010463-32010485 TGAAGTCAAGAAAGGGAAGAAGG + Exonic
1172342695 20:34170974-34170996 TGGTGTGAACAGATGGACTAAGG - Intergenic
1172749596 20:37241215-37241237 TGGTGACAACAGAGAGACTAAGG - Intronic
1173431362 20:42989687-42989709 TGCTGTCAAGGGAGGGAGGAGGG - Intronic
1173503209 20:43568112-43568134 TGGTCACAACAAAGGGTAGAGGG + Intronic
1173976076 20:47187780-47187802 TGGTACCAACAGAGGCGAGAGGG + Intronic
1176053802 20:63134462-63134484 TGGGGCCCACAGAGGGAAGCAGG + Intergenic
1176905533 21:14496039-14496061 AGGGGCCCACAGAGGGAAGATGG - Intronic
1176928470 21:14779405-14779427 TGGAGTCTACAGAGGCAAGTGGG - Intergenic
1178485160 21:33014580-33014602 TCCAGTCAACAGTGGGAAGAGGG - Intergenic
1180182555 21:46124480-46124502 TGGTGCCAGCATAGGGAAGGAGG + Intronic
1180203254 21:46240025-46240047 TGGTGGCTAAAGAGGGAAGTGGG + Intronic
1182197066 22:28529448-28529470 TGGAGTCTACAGAGGCAAGCAGG - Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
949106876 3:210369-210391 TGGTGACAACTGAGGTAATATGG + Intronic
949272952 3:2241727-2241749 TTGTGTCAAAGGAGGGAACATGG - Intronic
949800483 3:7898363-7898385 TGGTGTGCACAGAGACAAGAGGG - Intergenic
950449772 3:13059073-13059095 TGGTGTCACCAAAGGGTGGAGGG - Intronic
951607290 3:24450040-24450062 GGAAGTAAACAGAGGGAAGAAGG + Intronic
952054395 3:29427039-29427061 TGCTGTCAACAGTGGTAACATGG - Intronic
952152125 3:30605097-30605119 TGGTGGCAGAAGAGGGAATAGGG + Intergenic
952206159 3:31182702-31182724 TGGTTTCAGCAGAGAGAACAAGG + Intergenic
953240291 3:41142623-41142645 TGGAGTCAAGAGAGGGAGCAAGG + Intergenic
953253460 3:41266773-41266795 TGATTTCAACAGAGGGGTGAAGG + Intronic
955862978 3:63352141-63352163 TGGTGTGCACTGAGGGGAGAGGG + Intronic
956039585 3:65132031-65132053 TAGAGCCAACAGAGGGAAGGAGG - Intergenic
956202988 3:66727180-66727202 TGGTGACAACAGTGGGGAGAGGG - Intergenic
956684514 3:71812418-71812440 GGGAGTCAAAACAGGGAAGAGGG + Intergenic
956712639 3:72051760-72051782 TGGAGCCACCAGAGGGATGATGG - Intergenic
958553570 3:95645560-95645582 TGGAGTCTACAGAGGCAAGCAGG - Intergenic
959468609 3:106721013-106721035 GGGTGCCAGCAGAGGGCAGAGGG + Intergenic
960570664 3:119182252-119182274 TGCAGTGAACAGAGGGAAGGTGG + Intronic
960961798 3:123076036-123076058 TGCTGGTAGCAGAGGGAAGATGG + Intronic
961194557 3:124990688-124990710 AGGTGTGAACTGAGGGAAGTGGG + Intronic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
964303634 3:155317629-155317651 TGATGTCAAAAGAGGGAATTAGG + Intergenic
966457286 3:180131919-180131941 TGGTGATGGCAGAGGGAAGAAGG + Intergenic
968574708 4:1360209-1360231 TGGAGTCAGCACAGGGAACACGG + Intronic
969341825 4:6546888-6546910 TGGGGACAAAAGATGGAAGAGGG + Intronic
971612540 4:28744172-28744194 TTATGTTAACAGAGGAAAGAAGG - Intergenic
971816325 4:31495536-31495558 TGGTTTTAAGAGAGAGAAGAAGG - Intergenic
971833143 4:31724819-31724841 TGAAGTCAACATATGGAAGAGGG + Intergenic
972075337 4:35079764-35079786 TGGTGCCAGCAGAGGCAGGAGGG - Intergenic
973683011 4:53340502-53340524 TGGAGTCTACAGAGGCAGGAAGG - Intronic
973874759 4:55206431-55206453 TGGAGTCTACAGAGGCAGGAAGG - Intergenic
976993172 4:91395531-91395553 TGGTGTCAACTGAAGGATGTGGG + Intronic
977407674 4:96620721-96620743 TGGTGTCAACATATGCAGGATGG + Intergenic
978658951 4:111100239-111100261 TGGTGTCTACAGAGGCAGGCAGG + Intergenic
979215715 4:118161476-118161498 TGGAGTCTACAGAGGCAAGCAGG + Intronic
979362855 4:119784637-119784659 TGGTGACAGGAGAGGGAAGCAGG + Intergenic
980904921 4:138939007-138939029 TGGTGACAACAGATGGAACAAGG + Intergenic
981096566 4:140788309-140788331 TGGAGTCTACAGAGGCAAGCAGG + Intergenic
982285803 4:153732968-153732990 TGATGTCAAAAGTGGAAAGAAGG - Intronic
983229799 4:165117494-165117516 TGGTGACAACACAGGAAAGATGG - Intronic
983481329 4:168277957-168277979 TGGTGTCTACAGTGTGAACATGG - Intronic
983939757 4:173526946-173526968 TGGTGTCTACACAGCCAAGAGGG + Exonic
985276418 4:188242212-188242234 TGATGTCTTCAAAGGGAAGAAGG - Intergenic
986567332 5:9127928-9127950 TGGTGACAACCGAATGAAGACGG + Intronic
986979111 5:13426443-13426465 AAGTGTCAACAGAGTGAAAAGGG - Intergenic
987192564 5:15493258-15493280 TGGTCAGAACAGAAGGAAGAGGG - Intergenic
989522446 5:42418029-42418051 TGGAGTCTACAGAGGCAAGCAGG + Intergenic
989768753 5:45117421-45117443 TGGAGTCTACAGAGGCAGGAAGG + Intergenic
990972089 5:61519320-61519342 TGGTGTAAGCACAGGGAAAAAGG - Intronic
991656121 5:68905422-68905444 TGGAGACAAAAGAGAGAAGAGGG + Intergenic
992274643 5:75102531-75102553 TGGAGTCTACAGAGGCATGAAGG + Intronic
992376186 5:76190044-76190066 TGGTGGAAGCAGAAGGAAGATGG + Intronic
993444150 5:87990992-87991014 TGGAGTCTACAGAGGCAGGAAGG - Intergenic
995159520 5:108962229-108962251 TTGTGTAAACATATGGAAGATGG + Intronic
995875317 5:116783439-116783461 TGGGGTCAGCGGAGGGGAGAGGG - Intergenic
996165872 5:120222363-120222385 TTGTGTCCACAGAGGGATTATGG + Intergenic
996514914 5:124358771-124358793 TGGAGTCTACAGAGGCAAGCAGG - Intergenic
997167038 5:131672326-131672348 TAGAGTCAACAGAGGAAACATGG - Exonic
997372079 5:133368433-133368455 TAAGATCAACAGAGGGAAGAGGG - Intronic
997600578 5:135135761-135135783 TGCTGTCAGTGGAGGGAAGATGG - Intronic
998645340 5:144055514-144055536 TGGAGTCTACAGAGGCAGGAAGG + Intergenic
999738887 5:154534268-154534290 TGGTGTTTACACAGGCAAGAGGG + Intergenic
999960957 5:156755214-156755236 ACGTGTTAACTGAGGGAAGAAGG + Intronic
1000103608 5:158038012-158038034 TGGTGTCATCAGAGGGAGACCGG + Intergenic
1000185055 5:158851346-158851368 CGCTGTCAAGAAAGGGAAGAAGG + Intronic
1001009212 5:168083051-168083073 TGGAGTCTACAGAGGCAGGAAGG + Intronic
1001275393 5:170347068-170347090 TGGAGGCAACAGAGGGAGAAAGG + Intergenic
1001488005 5:172133527-172133549 TGGTGTCATCAGAGCTAAGCTGG + Intronic
1002002555 5:176206272-176206294 TGGTGAAAGCAGAAGGAAGAGGG + Intergenic
1002224045 5:177705340-177705362 TGGTGAAACCAGAAGGAAGAGGG - Intergenic
1002309438 5:178305881-178305903 AGGTGTCTACACAGGGAAGCAGG + Intronic
1002595414 5:180318674-180318696 TGGTGGCCACAGAGGGCAGGAGG + Intronic
1002781147 6:367238-367260 TGGTGTCAAAACAAAGAAGAGGG - Intergenic
1003223908 6:4187889-4187911 TGGTGTCATGAGAGAGAAGAAGG + Intergenic
1003510096 6:6772470-6772492 TGGGGCCTCCAGAGGGAAGAAGG - Intergenic
1005421375 6:25654878-25654900 TGGTCTGACCAGAGGAAAGAAGG - Intronic
1007268782 6:40619646-40619668 TGGAGTCTTCAGAGGGAATATGG + Intergenic
1008281279 6:49599084-49599106 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1008699782 6:54085174-54085196 TGGTGTCAGGAGAGAGGAGAAGG - Intronic
1009734478 6:67659227-67659249 TGGGGTCTACGGAGGGTAGAGGG - Intergenic
1011021542 6:82819057-82819079 TGGTTTCAGCAAAGGCAAGAAGG + Intergenic
1011075074 6:83430711-83430733 TGGTGTGGGCAGAAGGAAGAAGG - Intronic
1011528453 6:88292991-88293013 TGATGTCACCAGAGGAAGGAAGG + Intergenic
1011949891 6:92952399-92952421 TGGAGTCCACAGAGGGAGGCAGG - Intergenic
1012442226 6:99271228-99271250 AGGACTCATCAGAGGGAAGAGGG - Exonic
1012491278 6:99785019-99785041 TGTGGGCAAGAGAGGGAAGAGGG + Intergenic
1012682196 6:102196192-102196214 TGGTGTCAAAATAGGGATGGAGG + Intergenic
1013211375 6:107989950-107989972 TGGTAACAAAAAAGGGAAGATGG - Intergenic
1013724489 6:113076848-113076870 AGGTATCTACAGAGGGATGAAGG + Intergenic
1014128460 6:117804551-117804573 TGGAGTCTACAGAGGCAAGCAGG + Intergenic
1014901489 6:126970751-126970773 TGGTCTAAACAGGGTGAAGAGGG + Intergenic
1015292016 6:131548003-131548025 TGGAGTCACCAGAGGGATGCAGG - Intergenic
1016382293 6:143497380-143497402 TGGGGGCAACAGAGGTAAGAGGG - Exonic
1017137582 6:151161796-151161818 TTATGTTAACAGAGGGGAGATGG + Intergenic
1018007085 6:159632291-159632313 TGATGTGATCAGAGGGAGGACGG - Intergenic
1018395320 6:163373880-163373902 TGGTGCCACCTGTGGGAAGAAGG - Intergenic
1018399778 6:163411414-163411436 TGGGGTAAGCAGATGGAAGAAGG + Intergenic
1018814885 6:167323198-167323220 TGGTGCCAACAGTGGGAAGCGGG + Intergenic
1019069527 6:169332109-169332131 TGCCGTGAAAAGAGGGAAGAGGG - Intergenic
1019267235 7:124666-124688 TGGTGCCAACAGTGAGAAGCTGG - Intergenic
1019543101 7:1560264-1560286 TGGGGGCAACAGAGGGACCAGGG - Intronic
1020470939 7:8533834-8533856 TGGTGTCAAGGGGAGGAAGAAGG + Intronic
1022079724 7:27008047-27008069 TGGAGTCTACAGAGGCAAGCAGG + Intergenic
1022879982 7:34576326-34576348 TGGAGTCTACAGAGGCAAGCAGG - Intergenic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1026019586 7:66697071-66697093 TGGTTGACACAGAGGGAAGATGG - Intronic
1027330728 7:77090135-77090157 TGGAGTCTACAGAGGCAAGCAGG + Intergenic
1027772854 7:82429378-82429400 TAGAGGCAACAGAAGGAAGAAGG + Intronic
1027990720 7:85357329-85357351 TGGTATAAATTGAGGGAAGAGGG + Intergenic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1032471118 7:132180039-132180061 TGGTGTCAAAATAGACAAGAGGG + Intronic
1032728137 7:134611288-134611310 TGGATTTAACAGAGGGAAGAAGG - Intergenic
1033865414 7:145685716-145685738 TTGTGTCCCCAGTGGGAAGAAGG + Intergenic
1034236919 7:149579399-149579421 TGGAGTCTACAGAGGCAAGCAGG + Intergenic
1034634429 7:152555962-152555984 TGGAGACCAGAGAGGGAAGAGGG - Intergenic
1034818068 7:154191504-154191526 TGGTCTGCACAGAGGGAAAAGGG - Intronic
1034870948 7:154683481-154683503 TGGTGGGAACAGAAAGAAGAAGG - Intronic
1035108852 7:156463821-156463843 AGGTGTCACCTGGGGGAAGAGGG + Intergenic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1036832304 8:12030436-12030458 TGGTTAGAACAGAGGGAAGTAGG - Intergenic
1037446421 8:18970575-18970597 TGCTGTTAAGAGAAGGAAGATGG - Intronic
1037743493 8:21625644-21625666 TGGTGTGAAGAGGGGGAGGACGG + Intergenic
1037807024 8:22063752-22063774 GGGTGTCAAGAGAGGGGAAAGGG - Intronic
1038684908 8:29707723-29707745 TGGTGTCAATAGAGGCCACATGG - Intergenic
1038938067 8:32274683-32274705 TGGGGTTAAAATAGGGAAGATGG - Intronic
1039608161 8:38899993-38900015 CGGTGTTAACAGAGGAAAGGCGG - Intergenic
1039858375 8:41435663-41435685 TGGTGTGAAAAGAGAGAAAAAGG - Intergenic
1041105746 8:54442500-54442522 TGGTGGAAACAAAAGGAAGATGG + Intergenic
1041665897 8:60444586-60444608 TGGAGTCTACAGAGGGAGGCAGG + Intergenic
1042156382 8:65848705-65848727 GGGCGTCAACAGAGGGGAGAGGG + Intergenic
1042171713 8:65998379-65998401 TGGTGTCTACAGAGGCAGGCAGG + Intergenic
1042236104 8:66614158-66614180 TGGTCTCTCCAGAGGGAAGAAGG - Intronic
1042884810 8:73536673-73536695 TGGTGTCAATAGAGGCATGGTGG + Intronic
1043344401 8:79283184-79283206 TGGTGTGAACAAAGGTAAGGAGG + Intergenic
1043375759 8:79647576-79647598 TAGTGTCAACAGATGGAATGGGG - Intronic
1043423312 8:80122811-80122833 TGGAGTACACAGAGGGAAGAAGG + Intronic
1044272593 8:90264633-90264655 TGGTGTCTACAGAGGCAGGCAGG - Intergenic
1044372814 8:91433259-91433281 GGGTGGCAAAAGAGGGAGGAGGG + Intergenic
1044956590 8:97487756-97487778 TGGAGTCTACAGAGGCAAGTAGG + Intergenic
1045371365 8:101527072-101527094 AAATGTCAACAGAGGGAATAAGG + Intronic
1047010395 8:120666689-120666711 TGGAGTCCACAAAGGGGAGAAGG - Intronic
1048436511 8:134423465-134423487 AGGTTTGAACAGAGGTAAGAGGG - Intergenic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1048884390 8:138897997-138898019 TGGTGTCCTCAGATGGCAGATGG + Intronic
1050083176 9:1936664-1936686 TGGAGTCTACAGAGGCAAGCAGG + Intergenic
1053448844 9:38175956-38175978 TGGGGCAAAGAGAGGGAAGATGG - Intergenic
1054942850 9:70762858-70762880 TGGTGTAAACAGAGGCAACATGG - Intronic
1055136522 9:72835274-72835296 TGGGATGAACAGAGTGAAGATGG - Intronic
1056280728 9:85038898-85038920 TGGTGTCAACACAACGAATAGGG + Intergenic
1056617029 9:88177601-88177623 TAGTCTCAATAGAGGGAAGAAGG + Intergenic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1058012024 9:99989072-99989094 TGGTGTCTACAGAGGCCAGCAGG - Intronic
1058247054 9:102640601-102640623 TGGTAACAAAAAAGGGAAGATGG - Intergenic
1061131866 9:128712994-128713016 TGGTGGTAGCAGTGGGAAGATGG + Intronic
1062205700 9:135335727-135335749 TGGTGTCGACGGTGGGCAGAGGG + Intergenic
1185648000 X:1628728-1628750 AGGAGACAAGAGAGGGAAGATGG - Intronic
1185808008 X:3078419-3078441 TGGAGGCCAAAGAGGGAAGATGG - Intronic
1186571091 X:10715587-10715609 TGGAGTCTACAGAGGCAAGCAGG - Intronic
1189524860 X:41809131-41809153 TGGAGTCTACAGAGGCAGGAAGG - Intronic
1190786929 X:53660532-53660554 TGGTTTCAACAGTGGGAGGGGGG + Intronic
1191654150 X:63577515-63577537 TGGTGACAGCATAGGGAGGAGGG - Intergenic
1193123408 X:77847032-77847054 TGGAGTCTACAGAGGCAAGCAGG + Intronic
1195688159 X:107603618-107603640 TGCTGTGAGCAGAGTGAAGAGGG - Exonic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1196853590 X:119961995-119962017 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1198038720 X:132827483-132827505 ATGTGTCAACAGTGGGAAAAGGG + Intronic
1198584538 X:138105796-138105818 TGGAGTCTACAGAGGCAAGCAGG - Intergenic
1198615694 X:138456372-138456394 TGGAGTCTACAGAGGCAAGTAGG - Intergenic
1198916146 X:141674411-141674433 TGGAGTCAACAAAGAGAAGCAGG - Intronic
1199455604 X:148024593-148024615 TGATGTCAGCACAGGGAAGTGGG + Intronic
1199963498 X:152799029-152799051 TGGTGTCAGCAGAGGCCACATGG - Intergenic
1200805428 Y:7428510-7428532 TGGAGTCTACAGAGGGAGGCAGG - Intergenic
1201170565 Y:11258395-11258417 TGGTGTCAAATGAGGCAAAATGG + Intergenic
1201393090 Y:13519905-13519927 TGGAGTCTACAGAGGCAAGCAGG + Intergenic
1201992422 Y:20042457-20042479 TGGTGTCTACAGAGGCAGGCAGG + Intergenic
1202034703 Y:20620429-20620451 TGGAGTCTACAGAGGCAAGCAGG + Intergenic