ID: 1090989401

View in Genome Browser
Species Human (GRCh38)
Location 11:131802558-131802580
Sequence ATTGCCTGGTAAGTGATGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 59}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090989397_1090989401 3 Left 1090989397 11:131802532-131802554 CCAGAGTAGCCTTGCTGGACAGA 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1090989401 11:131802558-131802580 ATTGCCTGGTAAGTGATGCGTGG 0: 1
1: 0
2: 1
3: 2
4: 59
1090989393_1090989401 14 Left 1090989393 11:131802521-131802543 CCTGGCTGTCCCCAGAGTAGCCT 0: 1
1: 0
2: 1
3: 21
4: 268
Right 1090989401 11:131802558-131802580 ATTGCCTGGTAAGTGATGCGTGG 0: 1
1: 0
2: 1
3: 2
4: 59
1090989395_1090989401 5 Left 1090989395 11:131802530-131802552 CCCCAGAGTAGCCTTGCTGGACA 0: 1
1: 0
2: 1
3: 13
4: 195
Right 1090989401 11:131802558-131802580 ATTGCCTGGTAAGTGATGCGTGG 0: 1
1: 0
2: 1
3: 2
4: 59
1090989396_1090989401 4 Left 1090989396 11:131802531-131802553 CCCAGAGTAGCCTTGCTGGACAG 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1090989401 11:131802558-131802580 ATTGCCTGGTAAGTGATGCGTGG 0: 1
1: 0
2: 1
3: 2
4: 59
1090989392_1090989401 22 Left 1090989392 11:131802513-131802535 CCTGGAGGCCTGGCTGTCCCCAG 0: 1
1: 0
2: 6
3: 69
4: 635
Right 1090989401 11:131802558-131802580 ATTGCCTGGTAAGTGATGCGTGG 0: 1
1: 0
2: 1
3: 2
4: 59
1090989399_1090989401 -6 Left 1090989399 11:131802541-131802563 CCTTGCTGGACAGAAGGATTGCC 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1090989401 11:131802558-131802580 ATTGCCTGGTAAGTGATGCGTGG 0: 1
1: 0
2: 1
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090989401 Original CRISPR ATTGCCTGGTAAGTGATGCG TGG Intronic