ID: 1090991286

View in Genome Browser
Species Human (GRCh38)
Location 11:131819191-131819213
Sequence CTAGTTCAAAACTTCTCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090991280_1090991286 15 Left 1090991280 11:131819153-131819175 CCCCATGAGTCCAGGTGAAGAAG 0: 1
1: 0
2: 0
3: 15
4: 169
Right 1090991286 11:131819191-131819213 CTAGTTCAAAACTTCTCTACTGG 0: 1
1: 0
2: 0
3: 3
4: 119
1090991282_1090991286 13 Left 1090991282 11:131819155-131819177 CCATGAGTCCAGGTGAAGAAGAC 0: 1
1: 0
2: 0
3: 20
4: 372
Right 1090991286 11:131819191-131819213 CTAGTTCAAAACTTCTCTACTGG 0: 1
1: 0
2: 0
3: 3
4: 119
1090991283_1090991286 5 Left 1090991283 11:131819163-131819185 CCAGGTGAAGAAGACTGTAAGAG 0: 1
1: 0
2: 1
3: 11
4: 138
Right 1090991286 11:131819191-131819213 CTAGTTCAAAACTTCTCTACTGG 0: 1
1: 0
2: 0
3: 3
4: 119
1090991281_1090991286 14 Left 1090991281 11:131819154-131819176 CCCATGAGTCCAGGTGAAGAAGA 0: 1
1: 0
2: 2
3: 10
4: 182
Right 1090991286 11:131819191-131819213 CTAGTTCAAAACTTCTCTACTGG 0: 1
1: 0
2: 0
3: 3
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090991286 Original CRISPR CTAGTTCAAAACTTCTCTAC TGG Intronic
900893334 1:5465447-5465469 CTAGTACAGAACCTCTCTAATGG - Intergenic
908537748 1:65093733-65093755 CTAGTTCACACATTCTCAACAGG - Intergenic
910024060 1:82627863-82627885 TTAGTTCAATACTCTTCTACAGG + Intergenic
912140779 1:106723603-106723625 CTATTTTAAAACTTCTCACCGGG + Intergenic
915427506 1:155839095-155839117 CTAATTCAAAAGTTATCTAAAGG + Intronic
917345350 1:174022871-174022893 CTACTCCAAAACGTCTCTCCTGG + Intergenic
919036373 1:192314465-192314487 CTATTTCAAAACTTTGCCACAGG + Intergenic
919564375 1:199165654-199165676 CTATTTTAAAAATTTTCTACTGG + Intergenic
1068228603 10:54139699-54139721 CTAGTTCAGAAGTTATCTAAAGG + Intronic
1073924767 10:108502806-108502828 CTACTTCTAAACTTTCCTACTGG - Intergenic
1081589124 11:44408695-44408717 CTAGTTCAAAACTCCTTTCTGGG + Intergenic
1087740487 11:101881550-101881572 TTAGTTCAAAGCTTATATACAGG + Intergenic
1090991286 11:131819191-131819213 CTAGTTCAAAACTTCTCTACTGG + Intronic
1091107517 11:132936624-132936646 CTTTCTCTAAACTTCTCTACCGG + Intronic
1094062723 12:26332069-26332091 ATAGTTCAGAACCTCTCCACTGG - Intergenic
1095566055 12:43624202-43624224 CTATCTCAAAACTTCACTTCTGG - Intergenic
1097649309 12:62276203-62276225 TTACTTCATAACTTCTTTACAGG + Intronic
1100762336 12:97822938-97822960 CAGGTTGAAAACTTTTCTACAGG - Intergenic
1103529458 12:121590562-121590584 AAAGTTCAAAACTTTTCTCCAGG - Intergenic
1106871232 13:34024139-34024161 CTTGTTTTAAAATTCTCTACAGG - Intergenic
1109502742 13:63258970-63258992 CTAGATCAAAACTTCGTTAGGGG + Intergenic
1109985161 13:69971389-69971411 CAAGTAAAAAACTTATCTACTGG + Intronic
1116263108 14:42656457-42656479 CTAATTCAAAACTTGTTTAAAGG + Intergenic
1116701498 14:48249598-48249620 TTAGTTGAAAACTTCTTTCCAGG - Intergenic
1117187687 14:53258009-53258031 CTAGTTCAAAGCTTATTTAAAGG - Intergenic
1117613688 14:57510321-57510343 ATAGCACCAAACTTCTCTACAGG + Intergenic
1120760798 14:88283405-88283427 CTAGTTAAAGTCTTTTCTACCGG - Intronic
1127989098 15:64097661-64097683 ATAGCCCAAAACATCTCTACTGG - Intronic
1130848869 15:87774074-87774096 CTACTTCAGTACTTCTCAACTGG - Intergenic
1137771790 16:51021825-51021847 CTAGCCCAAAATTTCACTACTGG + Intergenic
1138964788 16:62071223-62071245 CCATCTCAAAACTTCCCTACTGG - Intergenic
1141237619 16:82233378-82233400 CTGGTTCACAACCACTCTACAGG - Intergenic
1148970695 17:51478716-51478738 CAAGTTCATAACTTGTTTACAGG + Intergenic
1149476867 17:56969122-56969144 CTAATTCAAAACTTATTTAAAGG + Intergenic
1151112323 17:71693046-71693068 TTAGTTGAAAACTTCTCAATTGG - Intergenic
1155720433 18:29004577-29004599 CTAGTTTTAAACTTTTCTAATGG + Intergenic
1158077849 18:53552088-53552110 CTCGAGCAAAACTTCTCTATGGG + Intergenic
1159473055 18:68880892-68880914 CAAGTTCAAAACAGCTCTTCTGG + Intronic
1167626195 19:50591177-50591199 CTATATCAAAACTCCTCTTCAGG - Intergenic
925443832 2:3910523-3910545 ACATTTCAAAACTTCTCAACAGG + Intergenic
926183530 2:10668329-10668351 TTAATTCAAAAGTTCTCCACAGG + Intronic
926510828 2:13775548-13775570 CTAGTTTAATACTTCTATTCTGG - Intergenic
926844479 2:17121253-17121275 CTAGTTTATAACTTCACTAGTGG + Intergenic
927406188 2:22771075-22771097 GTAGTTAAAAACTTAACTACAGG + Intergenic
937346113 2:121126588-121126610 CTCTTTTAAAACTGCTCTACTGG - Intergenic
939376690 2:141377566-141377588 CTAGTTCAAAAATTCACTGTTGG + Intronic
944354295 2:198767275-198767297 CTTCTCCAAAAATTCTCTACAGG - Intergenic
947064037 2:226199742-226199764 CTAGTTCAAACTCCCTCTACAGG + Intergenic
947279627 2:228436220-228436242 CTAGTTAAACAGTTCTCTACTGG + Intergenic
1171859985 20:30390302-30390324 ATTGTTCACAATTTCTCTACTGG - Intronic
1175122048 20:56723308-56723330 CTAGTCCAAAGGTTCTCAACAGG - Intergenic
1177585329 21:23086202-23086224 CTTGTGCAAAATTTCTCTTCTGG + Intergenic
1177687601 21:24458851-24458873 CTAATTAAAAATTCCTCTACTGG - Intergenic
949329310 3:2904058-2904080 CAAATTCAAAATTTTTCTACAGG - Intronic
949703197 3:6783389-6783411 CTAGTTCAAAAATACTCCAAAGG + Intronic
949916645 3:8969612-8969634 CTAGTTTTCAACTTCTTTACTGG - Intergenic
951648022 3:24915553-24915575 CTAGTTCAAAATTTCTCCAATGG - Intergenic
954186146 3:48918629-48918651 CTGGTTAAAAACATCTCGACGGG + Exonic
955485257 3:59428380-59428402 ATGGTTCAGAACTGCTCTACTGG - Intergenic
956452718 3:69390362-69390384 CTAGTTCAATGGTTCTCAACCGG + Intronic
956763518 3:72464328-72464350 CTAGTTTCATAGTTCTCTACTGG + Intergenic
958173362 3:89964620-89964642 CTTCTTCAAAACTTCTCTCTAGG + Intergenic
958283600 3:91707267-91707289 CTGTTTCATAACTGCTCTACAGG - Intergenic
958286944 3:91761874-91761896 CTGTTTCATAACTGCTCTACAGG - Intergenic
958300483 3:91982751-91982773 CTGTTTCATAACTGCTCTACAGG - Intergenic
958308150 3:92108820-92108842 CTGTTTCATAACTGCTCTACAGG - Intergenic
958315779 3:92233355-92233377 CTGTTTCATAACTGCTCTACAGG - Intergenic
958317276 3:92257862-92257884 CTGTTTCATAACTGCTCTACAGG - Intergenic
958319933 3:92301757-92301779 CTGTTTCATAACTGCTCTACAGG - Intergenic
958330157 3:92469874-92469896 CTGTTTCATAACTGCTCTACAGG - Intergenic
958330333 3:92472765-92472787 CTGTTTCATAACTGCTCTACAGG - Intergenic
958344259 3:92700925-92700947 CTGTTTCATAACTGCTCTACAGG - Intergenic
958348171 3:92764551-92764573 CTGTTTCATAACTGCTCTACAGG - Intergenic
958349240 3:92782239-92782261 CTGTTTCATAACTGCTCTACAGG - Intergenic
958353934 3:92859298-92859320 CTGTTTCATAACTGCTCTACAGG - Intergenic
958354799 3:92873756-92873778 CTGTTTCATAACTGCTCTACAGG - Intergenic
958360171 3:92962392-92962414 CTGTTTCATAACTGCTCTACAGG - Intergenic
958367246 3:93077369-93077391 CTGTTTCATAACTGCTCTACAGG - Intergenic
958367423 3:93080263-93080285 CTGTTTCATAACTGCTCTACAGG - Intergenic
958371831 3:93152736-93152758 CTGTTTCATAACTGCTCTACAGG - Intergenic
958377567 3:93246478-93246500 CTGTTTCATAACTGCTCTACAGG - Intergenic
958381527 3:93310942-93310964 CTGTTTCATAACTGCTCTACAGG - Intergenic
958385560 3:93376943-93376965 CTGTTTCATAACTGCTCTACAGG - Intergenic
960227931 3:115188610-115188632 CTAATTCAAAGCTTCTTTAAGGG + Intergenic
963228991 3:142890640-142890662 AACTTTCAAAACTTCTCTACAGG + Intergenic
966825500 3:183961719-183961741 TTAGTTCAGTAGTTCTCTACAGG + Intronic
974313460 4:60244574-60244596 ATATTTAAAAACTCCTCTACAGG + Intergenic
982475635 4:155846901-155846923 CTAATTCAAAGCTTATCTAAAGG + Intronic
984141517 4:176009909-176009931 CTTGTTGAAACGTTCTCTACAGG - Intergenic
984515376 4:180732569-180732591 CTAGTTCTTATCTTCTCTATGGG - Intergenic
987267511 5:16272610-16272632 CTATTTCAAAACTTTTCCAGGGG - Intergenic
988030363 5:25756087-25756109 CTAATTCAGAAGTTCTCTAAAGG - Intergenic
988113040 5:26847975-26847997 CTATTTAAAAAATTCTCTGCAGG - Intergenic
989343904 5:40407956-40407978 GTAGTTTAGAACTTCTCTCCCGG + Intergenic
991992308 5:72352122-72352144 CAACTTCAAAACTTGTTTACGGG - Intronic
996583031 5:125052723-125052745 CTACTTAAAAGCTTCTCTGCAGG + Intergenic
996658158 5:125966639-125966661 CTAGTTCATGACCTCTCAACTGG + Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1005330356 6:24743953-24743975 CTTTTTGAACACTTCTCTACTGG + Intergenic
1008417935 6:51265232-51265254 CAACTGCAAACCTTCTCTACTGG + Intergenic
1012272181 6:97226964-97226986 CTAGTTCAGTAGTTCTCAACTGG - Intronic
1012306364 6:97663067-97663089 CTAATTCATAAATTCTCTAAAGG + Intergenic
1022043672 7:26604779-26604801 CTAGTTGATAATTACTCTACAGG + Intergenic
1022481352 7:30745138-30745160 CTCTTTCAAAGCTTCTCTTCAGG - Intronic
1024906730 7:54391210-54391232 CTAATTCAAAACTTATTTAAAGG - Intergenic
1027026593 7:74856936-74856958 ATAGTTTAAAACCTTTCTACAGG + Intergenic
1027061162 7:75087178-75087200 ATAGTTTAAAACCTTTCTACAGG - Intergenic
1027356325 7:77359582-77359604 CCAGTTTAAAACTGCTGTACAGG - Intronic
1032135260 7:129270994-129271016 CAAGTGCAAAACTTCTCTATAGG + Intronic
1032640060 7:133756403-133756425 CAAGCTCAACACTTTTCTACAGG - Intronic
1045776593 8:105810632-105810654 GTATTTCAATACTTCCCTACAGG - Intergenic
1051639098 9:19207788-19207810 CTATTTTAAAATTTTTCTACAGG - Intergenic
1053052477 9:34973120-34973142 CTAGCTCAGAGGTTCTCTACCGG - Intronic
1058384055 9:104412199-104412221 CTAATTCAAAACTTATGTAAAGG + Intergenic
1058420917 9:104832613-104832635 CTCGTTGAAAGCTTCTCTCCAGG + Exonic
1185735813 X:2495443-2495465 TTAGTACAAAACTTCACTCCAGG - Intronic
1185806823 X:3065740-3065762 CCAGTTCAAAATTCCTCTCCAGG + Intronic
1186209647 X:7235913-7235935 CTAATTCAAAGCTTATCTAAAGG - Intronic
1189411313 X:40774648-40774670 CTAGTTTTACACTTTTCTACAGG - Intergenic
1196198561 X:112860210-112860232 CTAGTTCAATACTTAGCTATGGG + Intergenic
1197317702 X:124988436-124988458 CTAGTTCAAAAGTTCCCTTTTGG - Intergenic
1198927627 X:141816173-141816195 CTAGCTTATAACCTCTCTACAGG - Intergenic
1200983480 Y:9283292-9283314 CCAGTTCACAACTTCTCCCCAGG - Intergenic