ID: 1090994795

View in Genome Browser
Species Human (GRCh38)
Location 11:131856074-131856096
Sequence CACAGTATTGTGCCCTAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090994795_1090994800 1 Left 1090994795 11:131856074-131856096 CCCTTCTAGGGCACAATACTGTG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1090994800 11:131856098-131856120 TTGGAGCACTGGTACTTGCTGGG 0: 1
1: 0
2: 2
3: 4
4: 102
1090994795_1090994799 0 Left 1090994795 11:131856074-131856096 CCCTTCTAGGGCACAATACTGTG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1090994799 11:131856097-131856119 TTTGGAGCACTGGTACTTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 91
1090994795_1090994798 -10 Left 1090994795 11:131856074-131856096 CCCTTCTAGGGCACAATACTGTG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1090994798 11:131856087-131856109 CAATACTGTGTTTGGAGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 138
1090994795_1090994801 2 Left 1090994795 11:131856074-131856096 CCCTTCTAGGGCACAATACTGTG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1090994801 11:131856099-131856121 TGGAGCACTGGTACTTGCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090994795 Original CRISPR CACAGTATTGTGCCCTAGAA GGG (reversed) Intronic
902743762 1:18459096-18459118 CAACGTAATGTGCCCTAGGAGGG - Intergenic
903644311 1:24884577-24884599 AACAGTATTCAGCCCTAAAAAGG - Intergenic
905868143 1:41387513-41387535 AACATTATTGGGCCCTAGAGAGG + Intergenic
905942676 1:41876263-41876285 CACAGTGTTGGGTCCTAGAGAGG + Intronic
911034882 1:93531794-93531816 CACAGAATTGCTCCATAGAAAGG - Intronic
912949104 1:114108261-114108283 CACAGTGTTGTGCTATAGATAGG - Intronic
916532598 1:165672033-165672055 CACTGTACTGTGCCCTACAATGG - Intronic
916982104 1:170149105-170149127 CAAAGTATTGTGCATTAGAAAGG + Intronic
917705675 1:177631892-177631914 CATACTCTTGTGTCCTAGAATGG - Intergenic
918740924 1:188129138-188129160 CACAGTCATATGCCCTAGAGAGG + Intergenic
918848810 1:189656115-189656137 TCCAGTATTGTGTCCTACAAAGG + Intergenic
919712839 1:200745368-200745390 CACACTATTGTGATCTAAAAAGG + Intronic
921251323 1:213301010-213301032 CACAGTAGAGAGCCCCAGAAAGG - Intergenic
1070461741 10:76677139-76677161 CATGGTATTGTCCCCTAGAAGGG + Intergenic
1072230730 10:93412043-93412065 CACAGAATGTTGTCCTAGAAGGG + Intronic
1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG + Exonic
1088396027 11:109370711-109370733 CACAGTCTTGTGTTCTATAATGG - Intergenic
1088422353 11:109662637-109662659 CACAGTAATTTCCCCTTGAATGG + Intergenic
1090994795 11:131856074-131856096 CACAGTATTGTGCCCTAGAAGGG - Intronic
1097280009 12:57839290-57839312 CAGAGAATTGTGCCCTAGCAAGG - Intronic
1099679181 12:85802926-85802948 CACTGTATTTTTCCATAGAATGG + Exonic
1102315295 12:111882689-111882711 CACAGTATCTTCCCCCAGAATGG + Intronic
1102602636 12:114043705-114043727 CACAGTATGTTGCACTTGAAGGG - Intergenic
1103861184 12:124015620-124015642 CACCTTAGTGTGCCCGAGAAAGG - Intronic
1104802177 12:131561377-131561399 CTCAGCATTGTGCCCTGCAAAGG - Intergenic
1106119813 13:26850859-26850881 TACACTAGTGTGCTCTAGAAAGG - Intergenic
1109795366 13:67305196-67305218 CACAGAATTCTACACTAGAAAGG - Intergenic
1110907647 13:80912650-80912672 CACAGTTCTATGCACTAGAAAGG + Intergenic
1111651864 13:91101190-91101212 CACAGTATTGTGCATAAGATTGG - Intergenic
1123414105 15:20082603-20082625 TACAGTTTTTTGCCCTAGGAGGG - Intergenic
1123523447 15:21089714-21089736 TACAGTTTTTTGCCCTAGGAGGG - Intergenic
1126038951 15:44572395-44572417 AACGTTATTGTCCCCTAGAAGGG - Intronic
1129603682 15:77014483-77014505 AACAGGACTGTGCCCTAGAGGGG + Intronic
1131663362 15:94542710-94542732 CACATTATTGCTCCTTAGAATGG - Intergenic
1135472922 16:22747843-22747865 CACAGTAGAATCCCCTAGAAAGG - Intergenic
1138653975 16:58479945-58479967 CTCCTTATTGAGCCCTAGAATGG + Intronic
1139592580 16:67941775-67941797 CACAGAGTTGTGCTCCAGAAAGG + Intronic
1141302920 16:82834752-82834774 CACAATATTATGCTCTGGAAAGG + Intronic
1154388392 18:13916152-13916174 CACAGCATTGCACCCTAAAATGG - Intergenic
1157681913 18:49614012-49614034 CACTGTAATGTGCCCGGGAAGGG + Intergenic
926344205 2:11930719-11930741 CACAGTTTTGTTCCCCAGCATGG - Intergenic
926655162 2:15395973-15395995 CAATGTATTATGCCCTAAAAAGG + Intronic
928135357 2:28683601-28683623 CACAGGACTGTGCCATATAAAGG - Intergenic
933038152 2:77427020-77427042 CACAGCACTGTGCCCTAGTCTGG - Intronic
934634739 2:95974005-95974027 CACACTATTGTGCTCTAGCCTGG + Intronic
935609136 2:105002606-105002628 CTCAATATTGTGCCCAGGAAAGG - Intergenic
936909229 2:117573252-117573274 CTCTGTATTGTGCTCCAGAAAGG - Intergenic
937715371 2:125026038-125026060 CACGGTTTTGTCCCCTAGCAAGG + Intergenic
938682814 2:133709515-133709537 CACCATATGGTACCCTAGAAGGG + Intergenic
939379015 2:141410236-141410258 TATAGGATTGTGCCCTACAATGG - Intronic
939856273 2:147362632-147362654 CATAGTTTTGTGGACTAGAAGGG - Intergenic
940468851 2:154066597-154066619 AAAAGCATTTTGCCCTAGAATGG + Intronic
1172749415 20:37239651-37239673 CACAGAATTGTACACTAAAAAGG - Intronic
1173733334 20:45343256-45343278 CACTGCATGGTGCCCTAGAGAGG - Intronic
1174898067 20:54471642-54471664 CACAGTATGGTGCCTTAGGCTGG + Intergenic
1182546010 22:31076965-31076987 TACAGTTTTTTGCCCTAGGAGGG + Intronic
953538826 3:43796434-43796456 CACAGTACTGTGCCCCAGTACGG + Intergenic
955204181 3:56880363-56880385 CACAGTCTTGTGACCTTGATGGG + Intronic
958642992 3:96832625-96832647 CACAATATTGTGCCCAATATTGG + Intronic
961589581 3:127966788-127966810 CACAGTGATGTGCCCTAGTTTGG - Intronic
965129488 3:164677963-164677985 TACAGTATTGTGTCCTAGATTGG + Intergenic
967125540 3:186420333-186420355 TACAGTACTGTACACTAGAAAGG - Intergenic
967967938 3:194976882-194976904 CACAGTATTATATCCTAAAAAGG - Intergenic
973252386 4:48074146-48074168 CAAAGTATTTTACCCCAGAAAGG + Intronic
974575741 4:63718862-63718884 CTCAGTTTTGTGCCCATGAAGGG + Intergenic
975298699 4:72765323-72765345 CACAGAATCTTGACCTAGAATGG + Intergenic
978275535 4:106945080-106945102 GACAGTGCTGTGCTCTAGAAGGG - Intronic
980294486 4:130893165-130893187 CATAGCATTTTGTCCTAGAATGG + Intergenic
981330966 4:143509819-143509841 CTCAGCATTGTGTCCTTGAATGG - Intergenic
989073702 5:37539665-37539687 CACAGGAATGTGCCCAATAATGG + Intronic
989135350 5:38148814-38148836 CATATTTTTGTGACCTAGAAGGG + Intergenic
993653258 5:90547736-90547758 CTCAGTATTTTGCAATAGAAAGG + Intronic
997269642 5:132526055-132526077 CATAGTATTCTGCCCTCGAGGGG + Intergenic
1000421452 5:161042668-161042690 CACAGTATTGATCCCTTGAGTGG + Intergenic
1000844597 5:166263947-166263969 CACACTCTTGTTGCCTAGAAAGG - Intergenic
1007866700 6:44978628-44978650 CACAGTGTTGTGACATAGCATGG + Intronic
1008055410 6:46940593-46940615 CACACTTCTCTGCCCTAGAATGG - Intronic
1012081765 6:94767309-94767331 CACAGTATTATGACCTTGCAAGG + Intergenic
1015943324 6:138474115-138474137 CACAGTGCTTTCCCCTAGAAGGG - Intronic
1018762801 6:166905993-166906015 CACAGAGTTGTGCTCTGGAAGGG - Intronic
1021540256 7:21749504-21749526 CACAGTGCTGTCCCCTAGAATGG + Intronic
1021657336 7:22885046-22885068 CACAGTCATGTGTCCTGGAAAGG - Intergenic
1021699119 7:23300408-23300430 CACAGAATTGTGAGCTGGAAGGG - Intronic
1021960904 7:25872076-25872098 CACACTGTAGTGCCCAAGAAGGG + Intergenic
1022030618 7:26488605-26488627 CACAGAAATTTGCCCAAGAATGG - Intergenic
1027582624 7:80017711-80017733 CAGAGTCTTATGCCCTGGAATGG - Intergenic
1027680190 7:81210653-81210675 CAGAGTATTTTGACCTAGATGGG + Intergenic
1029624050 7:101708763-101708785 CACACTATTGTGCTCTAGCCTGG - Intergenic
1031556055 7:123177818-123177840 TACAGTATAGTGAGCTAGAAAGG - Intronic
1031801710 7:126254825-126254847 CACTGTAATGTGCCTTAGAGAGG - Intergenic
1037919602 8:22796359-22796381 CACTGTATGGGGCTCTAGAAGGG - Intronic
1044580774 8:93823934-93823956 CAAAGGATTGTTACCTAGAAGGG + Intergenic
1045602502 8:103733498-103733520 CGCAGTCTGGTGGCCTAGAATGG + Intronic
1049140962 8:140953722-140953744 CACAGTGTTGTGCTCTTGACTGG - Intronic
1055144526 9:72916797-72916819 CACAGCATTGTCACCTAGGAAGG + Intronic
1058104983 9:100959836-100959858 CACAGAATTGTAACCTATAACGG - Intergenic
1187153134 X:16699846-16699868 CACAGTTATGTACCTTAGAATGG - Intronic
1189573253 X:42322180-42322202 CACACTATGGTGACCTGGAAAGG - Intergenic
1199722756 X:150554063-150554085 CACAGGATTATGCACTAGAGGGG - Intergenic