ID: 1090996916

View in Genome Browser
Species Human (GRCh38)
Location 11:131874994-131875016
Sequence GGGCCTGATGGGGCAGCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 553}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090996907_1090996916 4 Left 1090996907 11:131874967-131874989 CCCTTCTTGGTGCCTATTTGTAT 0: 1
1: 0
2: 1
3: 29
4: 388
Right 1090996916 11:131874994-131875016 GGGCCTGATGGGGCAGCAGCCGG 0: 1
1: 0
2: 4
3: 61
4: 553
1090996908_1090996916 3 Left 1090996908 11:131874968-131874990 CCTTCTTGGTGCCTATTTGTATG 0: 1
1: 0
2: 1
3: 22
4: 226
Right 1090996916 11:131874994-131875016 GGGCCTGATGGGGCAGCAGCCGG 0: 1
1: 0
2: 4
3: 61
4: 553
1090996906_1090996916 5 Left 1090996906 11:131874966-131874988 CCCCTTCTTGGTGCCTATTTGTA 0: 1
1: 0
2: 1
3: 25
4: 209
Right 1090996916 11:131874994-131875016 GGGCCTGATGGGGCAGCAGCCGG 0: 1
1: 0
2: 4
3: 61
4: 553
1090996912_1090996916 -8 Left 1090996912 11:131874979-131875001 CCTATTTGTATGACGGGGCCTGA 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1090996916 11:131874994-131875016 GGGCCTGATGGGGCAGCAGCCGG 0: 1
1: 0
2: 4
3: 61
4: 553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090996916 Original CRISPR GGGCCTGATGGGGCAGCAGC CGG Intronic
900151017 1:1179420-1179442 CGGCCTCATGGGGCAGGGGCAGG + Intronic
900212235 1:1461815-1461837 GGGCCGGGTGTGGCAGCTGCAGG - Intronic
900337890 1:2173843-2173865 GGGCCACATGGGCCGGCAGCAGG - Intronic
900347436 1:2216410-2216432 GAGGCTGAGGGCGCAGCAGCAGG - Intergenic
900536357 1:3179626-3179648 GGGCCTGCTGGGTTGGCAGCCGG - Intronic
900620812 1:3586836-3586858 CGGCCTGATGGTCCAACAGCTGG + Intronic
900796640 1:4712231-4712253 GGGCTGGATTTGGCAGCAGCTGG - Exonic
900987265 1:6080381-6080403 GAGGCTGGGGGGGCAGCAGCAGG + Intronic
901036347 1:6338450-6338472 GTGCCTGCTGAGGGAGCAGCAGG + Intronic
901190414 1:7406789-7406811 GGGGCTGTGGGGGCAGCAGTGGG - Intronic
901490273 1:9593155-9593177 CGGCCTGTTGAGGCAGCATCTGG - Intronic
901492139 1:9602050-9602072 GAGCCTGAAAGGGAAGCAGCGGG - Exonic
901527911 1:9835681-9835703 GGGCCTGAAGGGGCAGCAGGAGG + Intergenic
902265082 1:15257493-15257515 CGTCCTGATGGGACAGCAGGTGG - Intronic
902317485 1:15633452-15633474 AGTCCTGGTGGAGCAGCAGCAGG + Exonic
902625517 1:17673988-17674010 GGGGCTGATGGGGCAGAGGACGG - Intronic
903271333 1:22190294-22190316 AGTCCTGATGGGGCAGCTGAGGG - Intergenic
903486314 1:23691763-23691785 GGGCCTTATGGGCCAGGAGGCGG - Exonic
903897792 1:26620419-26620441 GGGCGGCAGGGGGCAGCAGCGGG + Intergenic
904468835 1:30723491-30723513 GGGCCTGGAGCAGCAGCAGCAGG + Exonic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
904605643 1:31696293-31696315 GGACCTGTTGGGGCAGCCACAGG - Intronic
904806008 1:33133052-33133074 GGGCCTGATGGGGCCTCCGCAGG - Intergenic
905208214 1:36355171-36355193 TGGCCAGAAGGCGCAGCAGCAGG + Intronic
905663308 1:39745219-39745241 GGCCCTGATAGGGCTGCAGGAGG - Intronic
905800654 1:40840159-40840181 GGGCATGTTGGGGCAGAGGCTGG - Exonic
905935128 1:41817393-41817415 GGGCCGGATGGGGCAGGACATGG + Intronic
906606708 1:47177763-47177785 GGGCCTGTTGGGGCAGGGGTGGG + Intergenic
906645583 1:47472170-47472192 GGGCCTGCTGGGTCACCAGGAGG + Intergenic
906740673 1:48180795-48180817 GGGCTTGAGGGAGCAGGAGCAGG - Intergenic
907312246 1:53545299-53545321 GGGCCTGATGGGGTAGACACAGG + Intronic
907732632 1:57082679-57082701 GGGCCTGTTGGGGGATCAGGGGG - Intronic
911109679 1:94169394-94169416 GGGTGTGATGAGACAGCAGCTGG + Intronic
912510721 1:110188567-110188589 GGACAGGATGGGGCAGCTGCAGG - Intronic
912746539 1:112249953-112249975 GGGCATGATGGGGAAGCTGCTGG - Intergenic
913191750 1:116418765-116418787 GGGCCGCCTGGGGCCGCAGCCGG - Intergenic
913266351 1:117048953-117048975 GAGCTGGATGGGGCAGAAGCTGG - Intergenic
913983666 1:143546004-143546026 AGGCCAGAGTGGGCAGCAGCTGG + Intergenic
914319377 1:146544663-146544685 GGGAGTGATGGGGCAGGAGAGGG + Intergenic
915074858 1:153299598-153299620 GGGCCTGAGGGAGCAGCAGGAGG - Intronic
915076554 1:153312756-153312778 AGGCCTGAGGAGGCACCAGCTGG - Intergenic
915497391 1:156291714-156291736 GTCCCTGTTGGGGCAGTAGCAGG - Exonic
916418715 1:164616292-164616314 GGGGCTGAGAGGGCAGCAGAAGG - Intronic
916720039 1:167477899-167477921 GGTGCTGATGGGGCAGTTGCTGG + Intronic
917303607 1:173604785-173604807 GAGCCTGAGGGGACAGCAGTAGG - Intergenic
918121455 1:181544727-181544749 GGACATGGTGGGGAAGCAGCAGG + Intronic
918515585 1:185359132-185359154 GCCTCTGATGGGGCAGCAGGGGG - Intergenic
919742637 1:200990101-200990123 GGGCCTGCTGGGGCGGAGGCGGG - Intronic
919929334 1:202211021-202211043 GGGTAGGATGGGGCAGCAGTGGG + Intronic
920132245 1:203741287-203741309 GGGCTTTACTGGGCAGCAGCTGG - Exonic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
920824942 1:209416299-209416321 CGGCATGCTGGGGCAGCTGCAGG + Intergenic
920915295 1:210253562-210253584 GGGCCTGATGGGGCTGGTGGTGG + Intergenic
921047112 1:211485401-211485423 GAGCCTTCTGGGGGAGCAGCTGG - Intronic
921379752 1:214512343-214512365 GGGCCACATGGAGAAGCAGCAGG - Intronic
921496051 1:215842800-215842822 GGGCCTGTTGGGGGGGCATCAGG + Intronic
921511766 1:216040153-216040175 GGTCCTGATGGAACAGCAGTGGG + Intronic
922077929 1:222266310-222266332 GGGTCTGAAGGGGAAGTAGCAGG + Intergenic
922355881 1:224774600-224774622 GGGCCACATGGGGAAGCACCAGG - Intergenic
922616402 1:226963509-226963531 GGGAGTGATGGGGCAGAAGGAGG + Intronic
922758526 1:228109753-228109775 GGAGCTGAAGGGGCATCAGCTGG + Intergenic
922758557 1:228109841-228109863 GGGGCTGAGTGGGCACCAGCTGG + Intergenic
922792161 1:228316566-228316588 GGGCTTGCTGGGGCCGCAGGTGG + Intronic
922915376 1:229253022-229253044 GGGCCTGCAGGGACAGCAGCCGG - Intergenic
923048016 1:230369581-230369603 GGGCCTGATGGGGGAAGAGATGG - Intronic
923078269 1:230629505-230629527 GGGCCACATGGGGAAGCACCAGG - Intergenic
923281307 1:232445584-232445606 GGGCCTGCTGGAGCAGCTGTTGG + Exonic
923651322 1:235876873-235876895 GGTCCTGGTGGGGCAGCCCCAGG + Intronic
924806996 1:247369467-247369489 GGGCCTGACAGGCCAGCAGAAGG - Intergenic
924812628 1:247416605-247416627 AGGACTGATGGGGCAGGAGCTGG + Intronic
1063535235 10:6876729-6876751 GGGCCATGTGGGGAAGCAGCAGG + Intergenic
1063748022 10:8908205-8908227 GGGCCTGTTGGGGGCGCAGGGGG + Intergenic
1066430699 10:35348669-35348691 GGCCCTGAGAGGTCAGCAGCAGG + Intronic
1067038304 10:42934667-42934689 AGGCCTGATGGGACAACAGCAGG - Intergenic
1067190205 10:44062308-44062330 GGGCCGGATGCTTCAGCAGCAGG - Intergenic
1067235777 10:44448001-44448023 GGGCCTGTTGGGGAAGCTGGGGG - Intergenic
1067682112 10:48447941-48447963 TGGCCCTATGGGGCAGCAGGTGG - Intronic
1067684123 10:48457035-48457057 GGGGCAGAAAGGGCAGCAGCTGG + Intronic
1067768540 10:49107732-49107754 GCGCCTGCTGGAGGAGCAGCGGG - Exonic
1069589746 10:69634418-69634440 GGGCCAGCTGGGACATCAGCAGG - Intergenic
1069744844 10:70708619-70708641 GGGCCTGGTGGGGGACCAGCTGG + Exonic
1069991581 10:72319749-72319771 CGGCCTGATGGGGCAATCGCTGG + Intergenic
1070321282 10:75356657-75356679 GGGCATGAGGGGATAGCAGCTGG - Intergenic
1070596930 10:77838905-77838927 AGAGCTGATGGGGCAGCCGCGGG + Intronic
1070655091 10:78265914-78265936 GAGCAGGATGGGGCAGCAGGAGG + Intergenic
1070817764 10:79335998-79336020 GAGTCTGATGGGGCTGGAGCCGG + Intergenic
1072637594 10:97187627-97187649 GGGCCCCATGGAGCAGGAGCTGG - Intronic
1072968525 10:99995867-99995889 GTGCCTGACGTGGCAGCACCTGG - Intronic
1073036939 10:100570363-100570385 AGGCAGGATAGGGCAGCAGCTGG + Intergenic
1073115876 10:101091363-101091385 GGGCCTGAGGGGGCAGAATCAGG + Intronic
1073292959 10:102422299-102422321 GGGCCTGATAGGGCGGGAGGAGG + Intronic
1073432283 10:103494258-103494280 GGCCCTGCTGGGGCTGCAGCCGG - Exonic
1074288841 10:112123047-112123069 AGGCCTGAGGGGACTGCAGCTGG + Intergenic
1074638179 10:115345101-115345123 GGACCTGCTGGGACAGCAGAGGG - Intronic
1074983209 10:118635974-118635996 GTGGCAGATGGGGGAGCAGCAGG - Intergenic
1075088489 10:119429828-119429850 GGGTCTTCTGGGCCAGCAGCAGG + Intronic
1075450746 10:122550403-122550425 GGGACTGAGGGGTCAGCACCAGG - Intergenic
1075575914 10:123577379-123577401 GGACCTGGTGTGGCAGCTGCAGG - Intergenic
1075734405 10:124655090-124655112 GGGCCTGAGGAGGCAGCCCCGGG - Intronic
1076033154 10:127176176-127176198 GGGCCAGCTGGGGGAGAAGCGGG - Exonic
1076119005 10:127921303-127921325 GGCCCAGATAGGGTAGCAGCAGG + Intronic
1076495044 10:130891398-130891420 GGGGCTGTGGGGGCAGCTGCAGG - Intergenic
1076536588 10:131181687-131181709 GGGCCAGGTGGGCCAGGAGCAGG + Intronic
1076605562 10:131687101-131687123 GGAGGTGATGGAGCAGCAGCAGG - Intergenic
1076890118 10:133279228-133279250 GGACCAGTTGGAGCAGCAGCAGG + Exonic
1077094936 11:795288-795310 CGTCCTGAGGGTGCAGCAGCGGG + Intronic
1077115726 11:883793-883815 GGGCGGCATCGGGCAGCAGCAGG + Intronic
1077168205 11:1153155-1153177 GGTCCGGGTGGGGCTGCAGCAGG - Intergenic
1077180141 11:1208581-1208603 GGGCCAGGTGGGGCAGGAGCCGG + Intergenic
1078059102 11:8032005-8032027 GGGGCTGGAGGGGCAGCAGCTGG + Intronic
1078216187 11:9314195-9314217 GGGCCTGCTGGCGCCGCGGCGGG - Intronic
1079101465 11:17544550-17544572 GGGCCTGAGGTGGCAGTAGCTGG + Intergenic
1080020035 11:27550732-27550754 GTGCCTAATGTGTCAGCAGCAGG - Intergenic
1081229061 11:40562703-40562725 GGGTCTGAAGTTGCAGCAGCTGG - Intronic
1081579850 11:44344762-44344784 GGGTCTGCAGGGGCAGCAGGTGG - Intergenic
1081789711 11:45774314-45774336 CGGCCTGATGGGGCACCTGGAGG - Intergenic
1083430967 11:62613299-62613321 GGGGCTGCAGGGGCAGCACCAGG - Exonic
1083648445 11:64186385-64186407 GGGCCGGACGGGGCGGCGGCGGG + Intronic
1083651815 11:64208557-64208579 TGGCCTCCTGGAGCAGCAGCGGG + Intronic
1084150158 11:67284384-67284406 GGGCCTGGTGCCGCAGCAGCCGG - Intronic
1084172501 11:67407222-67407244 GAGGCAGATGGGGCAGGAGCAGG + Intronic
1084534211 11:69747161-69747183 GGGCCTCACGGGGCTGCTGCTGG + Intergenic
1084940736 11:72611600-72611622 GGGAGAGTTGGGGCAGCAGCAGG + Intronic
1085493750 11:76947308-76947330 GGGCCTCATGGGGAAGCACCAGG + Intronic
1085743356 11:79095099-79095121 GGGGGTGAAGGGGCAGGAGCAGG + Intronic
1086786823 11:90979351-90979373 GGGCCTGCTGGAGAAGCAGAGGG - Intergenic
1086948432 11:92867109-92867131 GGGCCTGACGGAGCTGAAGCTGG + Exonic
1088106606 11:106213569-106213591 GATTCTGATGGTGCAGCAGCTGG - Intergenic
1088448760 11:109960567-109960589 GGGCCACATGGGGAAGCACCAGG + Intergenic
1088850483 11:113699804-113699826 TGGGCTGATGGGGCAGGAGGAGG - Intronic
1088868386 11:113870591-113870613 GGGACTGACTAGGCAGCAGCAGG - Intronic
1090662244 11:128890755-128890777 GGGCCTGATCCGCCAGCTGCAGG - Intergenic
1090996916 11:131874994-131875016 GGGCCTGATGGGGCAGCAGCCGG + Intronic
1091428456 12:412104-412126 GGGCCTGAAGGGGCAATAGCTGG - Intronic
1091773719 12:3170597-3170619 GGTCGTGATGGGGGAGCAGATGG + Intronic
1091975180 12:4818778-4818800 GTCTCTGATGGAGCAGCAGCAGG + Intronic
1092205840 12:6613823-6613845 TGGCCAGAGGGGGGAGCAGCGGG - Intergenic
1092524530 12:9301637-9301659 GCGCATGATAGGGCAGCAGGAGG - Intergenic
1092542735 12:9430175-9430197 GCGCATGATAGGGCAGCAGGAGG + Intergenic
1094319670 12:29171404-29171426 TTCCCAGATGGGGCAGCAGCCGG - Intronic
1094319706 12:29171563-29171585 TTGCCAGATGGGGCGGCAGCTGG - Intronic
1094319733 12:29171681-29171703 ATGCCAGATGGGGCAGCAGCTGG - Intronic
1094510278 12:31092253-31092275 GCGCATGATAGGGCAGCAGGAGG - Intronic
1095414600 12:41962495-41962517 GGTCCTGGTTGGGCAGCAACAGG - Intergenic
1096007178 12:48183131-48183153 GGGCCTGACGGTGCAGAGGCAGG - Intergenic
1096148066 12:49293070-49293092 GAGGCTGCTGGGGCTGCAGCTGG - Intergenic
1096377393 12:51124579-51124601 GGCCCTCATGGGGCAGCCGGAGG + Intronic
1096652342 12:53068085-53068107 GGGGCTGTTGGGGCAGCACCAGG - Intronic
1096687057 12:53295148-53295170 GGGCCTGGCGGGGTACCAGCAGG + Intergenic
1098385068 12:69909799-69909821 GGTCCTGAAGGGCCAGCAGTTGG + Intronic
1100388214 12:94123291-94123313 GGGGCTGAGTGAGCAGCAGCTGG + Intergenic
1101983471 12:109427512-109427534 GGGGCTGATGGAGCACCTGCGGG + Exonic
1103479306 12:121240929-121240951 GGCCCAGATGTGGGAGCAGCTGG - Intronic
1103703351 12:122859101-122859123 GGAGCTCATGGGGCAGCTGCAGG + Exonic
1104064432 12:125295366-125295388 CAGCCTGTTGGGGCAGGAGCTGG + Intronic
1106006436 13:25774399-25774421 GGGCCTGTTGGGGAGGCAGGGGG + Intronic
1106315625 13:28590854-28590876 GGGCCTGATGGGCCAGCTCGAGG - Intergenic
1106553602 13:30791683-30791705 GGGCCTGCTGGGGAGCCAGCAGG + Intergenic
1106558530 13:30830077-30830099 GGGTCTGAAGGTGCAGCAGCTGG + Intergenic
1106787972 13:33126042-33126064 GGGGGTGGTGGGGCAGCAGCGGG + Intronic
1107779107 13:43879518-43879540 GGAACTGCTGAGGCAGCAGCGGG + Exonic
1111312899 13:86513099-86513121 GGGACTGATGGTGCAGGAGATGG + Intergenic
1113604944 13:111598429-111598451 GGCTGTGATGGGTCAGCAGCAGG + Intronic
1114182860 14:20380353-20380375 CTGCCTGCTGGGGCAGGAGCCGG + Exonic
1114540562 14:23454454-23454476 GGGCCAGATGGAGAAGCATCCGG + Intergenic
1114660169 14:24338783-24338805 GGGGCTGGTGGGGCAGCTGGTGG + Intronic
1115028185 14:28766608-28766630 GCGCCCGAGGGGGCGGCAGCCGG + Intergenic
1116997102 14:51335569-51335591 GGGGCAGATGGGGCAACAGAGGG + Intergenic
1119418677 14:74493434-74493456 GGGCCTGAGAGGGCTGGAGCTGG - Exonic
1119739536 14:77005272-77005294 TGGGCTGCTGGGGGAGCAGCAGG - Intergenic
1119851171 14:77867668-77867690 GGGCCAGATGGGGCATCAGCAGG - Intronic
1121423946 14:93834927-93834949 GAGCCTGCAGGGGCAGGAGCAGG + Intergenic
1121465845 14:94115092-94115114 GGGCAGGGTGTGGCAGCAGCCGG + Intronic
1121531206 14:94654800-94654822 AGGCTTGATGTGGCTGCAGCTGG + Intergenic
1121742534 14:96264252-96264274 AGGCCTCATGGGGGAGGAGCAGG - Exonic
1121796896 14:96742729-96742751 TGGCCTGAGGGGGCTGCAGAAGG - Intergenic
1122316179 14:100827235-100827257 GGGCCTGGTGGGGGCGCAGGCGG + Intergenic
1122795388 14:104203483-104203505 TGGCCTCACGGGGCCGCAGCAGG + Intergenic
1123681993 15:22770153-22770175 GGGGCAGATGGGGGAGCAGGAGG - Intergenic
1123682001 15:22770174-22770196 GGGGCAGATGGGGGAGCAGGAGG - Intergenic
1123783039 15:23645738-23645760 GGGCCTGCTGGGGGGGTAGCTGG + Exonic
1123988910 15:25668663-25668685 GGGCCACATGGGGCAGAGGCTGG - Intergenic
1124363387 15:29054693-29054715 GTGCCTGCTGGGGCTGCAGCTGG - Exonic
1124962738 15:34410453-34410475 TTGCCTGCTGGGGCTGCAGCTGG - Intronic
1124979364 15:34556675-34556697 TTGCCTGCTGGGGCTGCAGCTGG - Intronic
1125461418 15:39910444-39910466 GGGCCTGGTGGGGCTGAGGCAGG + Intronic
1126805112 15:52340249-52340271 GGGCCTCTGGGGGCAGCTGCAGG + Exonic
1127606404 15:60592136-60592158 GAGCCGGAGGGGGCAGCAGAGGG + Intronic
1128080645 15:64855049-64855071 GAGGGAGATGGGGCAGCAGCAGG - Intronic
1128943625 15:71807565-71807587 AGGCTTGAGGGGGCGGCAGCCGG - Intronic
1128977710 15:72165610-72165632 GGGAGGGATGGGGCAGCAGGTGG - Intronic
1129045747 15:72732754-72732776 GGGCCACATGGGGAAGCACCAGG + Intronic
1129752858 15:78077805-78077827 GGGGCTGAGGGGGCAACGGCCGG - Intronic
1131014609 15:89048011-89048033 GGGCATGATTTTGCAGCAGCTGG + Intergenic
1131094564 15:89647337-89647359 GGGACAGGAGGGGCAGCAGCGGG - Intronic
1131152019 15:90053287-90053309 GGGCCTGAAGAGGCAGCATGGGG + Intronic
1131172917 15:90191178-90191200 GGGCCTGTTGGGGCCTGAGCTGG - Intronic
1131525018 15:93145774-93145796 GGGGAGGCTGGGGCAGCAGCTGG + Intergenic
1131827078 15:96330596-96330618 GCGCCTTATAAGGCAGCAGCCGG - Intronic
1132462997 16:64637-64659 GGGGCTGGTGGGGCAGAGGCAGG - Intronic
1132544937 16:528552-528574 GGGGCTGCTGCGGCACCAGCTGG + Intronic
1132660230 16:1057927-1057949 GGGGCAGAAGGGACAGCAGCAGG - Intergenic
1133411524 16:5573027-5573049 GGGCCATATGGGGCAGGGGCAGG + Intergenic
1134022415 16:10930177-10930199 GGGCTTGAGGGGGCTGCAGAGGG - Exonic
1134671584 16:16059801-16059823 GGGGGTGGGGGGGCAGCAGCAGG - Intronic
1134684643 16:16150171-16150193 GGCCCTTCTGGGCCAGCAGCTGG + Exonic
1136367098 16:29813878-29813900 AGGCCACATGGGGCAGAAGCAGG - Exonic
1137603973 16:49775010-49775032 GGGGCTGGTGGGGCAGCTGCTGG - Intronic
1137610717 16:49815425-49815447 GTGCCTGATGAAGCAGAAGCAGG - Intronic
1137981291 16:53072219-53072241 GGGCCTGCAGGAGCAGCAGCTGG - Intronic
1138360770 16:56425509-56425531 GCGCCGGCAGGGGCAGCAGCGGG - Exonic
1138559049 16:57789125-57789147 GTGCCTGGGGTGGCAGCAGCTGG - Intronic
1139505248 16:67395277-67395299 GGGACTGAGGGGGAAGCAGGAGG + Intronic
1140014148 16:71165420-71165442 GGGAGTGATGGGGCAGGAGAGGG - Intronic
1141266520 16:82502727-82502749 GGGCCTGGTGGGCCAAGAGCAGG + Intergenic
1141840021 16:86568217-86568239 GGGCCTGGTGGTGCCGCCGCTGG + Exonic
1142138761 16:88463300-88463322 GAGGCTGAGGGGGCAGCTGCAGG - Intronic
1142154828 16:88528180-88528202 CGGCCTGCTGGGGCAGGAGCTGG - Exonic
1142243253 16:88956653-88956675 AGGCCAGGTGGGGCAGCTGCAGG - Intronic
1142365176 16:89646334-89646356 GAGCAGGACGGGGCAGCAGCAGG + Intronic
1142630344 17:1221806-1221828 GGGCTTGACGGGGAAGCATCAGG + Intronic
1142640026 17:1280333-1280355 GGGCCAGACGGGGCAGAAGCAGG - Exonic
1142759560 17:2034818-2034840 GAGGGGGATGGGGCAGCAGCAGG - Intronic
1143345487 17:6245868-6245890 GGCTCTGATGGGGCTGGAGCAGG + Intergenic
1143734449 17:8900677-8900699 GGGCCAGGCAGGGCAGCAGCTGG - Intronic
1144455226 17:15413068-15413090 GGGCAGGACGGGGCAGGAGCAGG - Intergenic
1145036025 17:19541241-19541263 GGGCCCCATGGGGCAGATGCAGG + Intronic
1145909580 17:28534785-28534807 GGGCCGGATGGGGCCTGAGCCGG - Exonic
1146650157 17:34601611-34601633 GGCCCTGATGGCCCAGCTGCTGG - Intronic
1147722425 17:42547284-42547306 GGGCCTGCTGGGGCCGCTGGGGG + Intergenic
1147723607 17:42553455-42553477 GGGCCTGCTGGGGCCGCTGGAGG + Exonic
1148668259 17:49390819-49390841 GGGCTTGCTGGGTCAGCAGACGG - Intronic
1150983431 17:70169271-70169293 GGCCCAGCTGGGACAGCAGCAGG - Intronic
1151156120 17:72123892-72123914 GGGCCTGTGGGGGCTGCTGCGGG - Exonic
1151289447 17:73138973-73138995 GGCCCAGATGTGGCAGCTGCTGG - Intergenic
1151396998 17:73829857-73829879 AGGCCTGCTGGAGCAGCGGCCGG - Intergenic
1151650970 17:75469262-75469284 GGGGCAGCTGGGACAGCAGCAGG - Intronic
1152007255 17:77690431-77690453 TGGCCTGACGTGGCAGGAGCAGG - Intergenic
1152203531 17:78961127-78961149 TGGTTTGATGTGGCAGCAGCTGG - Intergenic
1152252550 17:79219536-79219558 AGGCCTGAAGGGGCAGTACCAGG - Intronic
1152388341 17:79988452-79988474 GGGGCAGAGGGGGCAGCAACCGG + Intronic
1152437714 17:80286465-80286487 GGGCATGACGAGGCCGCAGCTGG - Intronic
1152719777 17:81917832-81917854 GGGCCTGAAGCGGCGGCAGGAGG - Exonic
1152730378 17:81967050-81967072 GGGCCTCAGAGGCCAGCAGCTGG - Intergenic
1152745556 17:82037133-82037155 GGGACTGTGGGGCCAGCAGCCGG + Intronic
1152750436 17:82060090-82060112 GGGCCTGAGGGGAGGGCAGCGGG + Exonic
1152829849 17:82490565-82490587 GGCCCTGCTGGGGCAGCAGGTGG - Intergenic
1152901896 17:82947137-82947159 AGGCCAGAGAGGGCAGCAGCCGG + Intronic
1154089616 18:11344757-11344779 TTCCCAGATGGGGCAGCAGCCGG - Intergenic
1154311833 18:13272864-13272886 GGGCCTCATCGGCCAGCACCAGG - Intronic
1154406964 18:14101256-14101278 AGGCGTGGTGGGGCAGCAGGAGG - Intronic
1155498195 18:26462988-26463010 GGGGTTTATGGGGCAGCAGCAGG + Intronic
1156685961 18:39646947-39646969 GGGCCTGTTGGGGGGGCGGCAGG - Intergenic
1157615759 18:48986926-48986948 GGGCCTGACTGGGCAGCTGAGGG - Intergenic
1160018112 18:75159301-75159323 GGGCCTGAGGCGGCAGAAGAAGG + Intergenic
1160429631 18:78802567-78802589 GGGCCTGTTGGGGGCGCAGGGGG - Intergenic
1160527013 18:79544148-79544170 AGGGCTCCTGGGGCAGCAGCGGG - Intergenic
1160605371 18:80045903-80045925 GGGCCTGGTGTGGCAGGGGCAGG + Exonic
1160892716 19:1387729-1387751 GAGCCTGATGGGGAAGCGCCTGG + Intronic
1160950677 19:1665783-1665805 AGGCCTGATGGAGCAGGAGCTGG - Intergenic
1161104006 19:2434383-2434405 GGACGTGATGCAGCAGCAGCTGG - Exonic
1161515451 19:4693768-4693790 GGGCCTGCTGGGGCTCCAGGAGG - Intronic
1161703060 19:5805316-5805338 GGGCCGGAGGGGGCGGCCGCGGG - Intergenic
1161720389 19:5899016-5899038 GGGGCTGCTGGGCCAGGAGCAGG - Intronic
1161766890 19:6213244-6213266 GGGGCTCCTGGGGCAGCACCAGG + Intronic
1161945730 19:7435404-7435426 GGGCCACATGGGGAAGCACCAGG + Intronic
1162004396 19:7767991-7768013 GGGGCCGCTGGGGAAGCAGCAGG + Intronic
1162137645 19:8565605-8565627 GGGCCTAGTGGGGCAGGAGCAGG + Intronic
1162566435 19:11447677-11447699 GGGCCTCCTGGGGCAGGGGCAGG - Exonic
1162609251 19:11736989-11737011 GGACCTTATAGGGGAGCAGCTGG - Intronic
1163019742 19:14475670-14475692 GGGCGGGCTGGGGCAGCTGCAGG + Intergenic
1163123836 19:15233460-15233482 GGGCCTGTTGGGCCAGCAGGAGG - Intergenic
1163153331 19:15427524-15427546 GGGCCTGAGGCTGCAGCAGGAGG + Exonic
1163817697 19:19476927-19476949 GAGCCTGAGGGGGCAGCTGGTGG + Intronic
1163840193 19:19603128-19603150 GGGCCACATGGGGAAGCACCTGG - Intronic
1164017331 19:21264675-21264697 TTCCCAGATGGGGCAGCAGCCGG - Intronic
1164672768 19:30082361-30082383 GGGCCACGTGGGGCAGCACCAGG + Intergenic
1164889280 19:31809259-31809281 GGGCCTGTTGGGGGAGCTGGGGG + Intergenic
1165370462 19:35402474-35402496 GGGCCTGTAGGGGCAGCAGCTGG + Intergenic
1165432522 19:35780841-35780863 GGGCCTGGTGGGGTAGGGGCTGG - Intronic
1165797309 19:38526565-38526587 GGGCCAAAGGGGGCATCAGCAGG - Intronic
1166069787 19:40380422-40380444 GGCCCTGCCGGGGCAGCAGCTGG - Exonic
1166137352 19:40785870-40785892 GGGCTTGATGGTGAAGCACCGGG + Intronic
1166315541 19:41987578-41987600 GGCCCTGATGTATCAGCAGCGGG + Intronic
1166719783 19:44990322-44990344 GGGCCTGAGGGAGCTGCAGTAGG + Intronic
1166789770 19:45391935-45391957 GGAGCTGGTGGGGCAGGAGCAGG + Exonic
1166873793 19:45885489-45885511 GGGCCTGCGGGGGCGGCAGCTGG + Exonic
1166889178 19:45979885-45979907 GGGTCTGTAGGGGGAGCAGCAGG + Intergenic
1166896139 19:46022917-46022939 GGGCACTATGGGGCTGCAGCAGG + Exonic
1166922622 19:46240685-46240707 GGGCCAGATGGGGAATCAACAGG - Intergenic
1167096992 19:47379868-47379890 GGGCCTGGTGCGCCAGCTGCCGG - Exonic
1167264899 19:48478609-48478631 GGGCCTGATGGAGGAGGGGCTGG + Intronic
1167300318 19:48674013-48674035 GGGCCAGATTTGGCAGGAGCAGG + Intergenic
1167321824 19:48801353-48801375 GGGCAAGATGGGGCAGGGGCAGG + Intronic
1167428479 19:49441584-49441606 GGGCCTGGTGGGGCCGGGGCGGG - Intronic
1167645405 19:50702829-50702851 GGGCTGGTTGGGGCAGCTGCGGG - Intronic
1168113559 19:54208545-54208567 AGCCCAGATGGTGCAGCAGCTGG - Intronic
1168121138 19:54253240-54253262 GCACCTGGTGGGGCAGCAGGAGG - Intronic
1168306233 19:55437820-55437842 GGGTCTGATGGAGCAGGGGCTGG - Intronic
1168313846 19:55475245-55475267 GGCCCTGATGGAGAAGCAGACGG - Intergenic
1168540002 19:57202338-57202360 GGGCCTCATGGGGATACAGCTGG + Intronic
1168682093 19:58323464-58323486 GAGCGAGATAGGGCAGCAGCTGG - Intergenic
926515051 2:13832967-13832989 GGGCCTGCTGGGGCAGGGGTGGG + Intergenic
927515326 2:23668800-23668822 GGCCTTGATGGAGCAGCAGTGGG - Intronic
928024725 2:27730250-27730272 AGGCCTGGTGGAGCAGCATCTGG - Intergenic
928380181 2:30810819-30810841 GTGCGTGGTGGGGCAGCAGGAGG + Intronic
929303681 2:40334888-40334910 GGGGGTGAGGGGGCAGCAGTAGG + Intronic
929885326 2:45872843-45872865 GGGCATGGAGGGGCAGCGGCAGG + Intronic
931025275 2:58106512-58106534 GGTCCTAATGGGGCAGTAGATGG + Intronic
932207135 2:69893195-69893217 GGGCCTGTAGGGGGAGGAGCTGG + Intergenic
932468538 2:71939326-71939348 GGGCAGGATGGGGCTGCCGCTGG - Intergenic
932594004 2:73083116-73083138 AGTCCTGAAGGGGCAGAAGCCGG + Intronic
932794553 2:74683016-74683038 GGGCCACATGGGGAAGCACCAGG - Intronic
933839587 2:86275709-86275731 GGGCCACATGGGGAAGCACCAGG - Intronic
935194037 2:100800840-100800862 GGACCTCAAGGGGCATCAGCTGG + Intergenic
936049848 2:109214344-109214366 GGGGCTGTGGGGGCAGCAGGAGG + Intronic
936937599 2:117853255-117853277 AGGCATTCTGGGGCAGCAGCAGG + Intergenic
937004500 2:118499102-118499124 AGACCTGAGGAGGCAGCAGCTGG - Intergenic
937615152 2:123913377-123913399 GTGTGTGATGGGGAAGCAGCCGG - Intergenic
937856454 2:126675115-126675137 GGGCCTGGTAGGGCTGCAGCAGG - Intronic
938223971 2:129599437-129599459 GGGCCTGTTGGGGGCGCAGGGGG - Intergenic
938243557 2:129760956-129760978 GGGAATGATGGGGCCACAGCAGG + Intergenic
938340242 2:130531359-130531381 GGGCCACATGGGGCAGCCCCAGG + Intergenic
938349594 2:130589389-130589411 GGGCCACATGGGGCAGCCCCAGG - Intergenic
939310373 2:140468192-140468214 GGGCCTGCTTGGGCCACAGCTGG - Intronic
939459719 2:142484262-142484284 GGGCTTATTAGGGCAGCAGCTGG - Intergenic
941010753 2:160297052-160297074 GGGCATGCTTGGGCAGAAGCTGG + Intronic
942077224 2:172367103-172367125 GGGGCTGATGGTGCAGCAGTGGG + Intergenic
942252545 2:174059781-174059803 GGGCCACATGGGGAAGCACCAGG - Intergenic
943465417 2:188223102-188223124 GGGCCTGTTGGGGTGGCAGTAGG - Intergenic
943820667 2:192315732-192315754 GGGCCCCATGGGGCAGCAAGAGG - Intergenic
944095888 2:195967980-195968002 GGGCCAGTGGTGGCAGCAGCAGG - Intronic
945474858 2:210269317-210269339 GAGCCTGCTGGAGGAGCAGCAGG - Intergenic
945761899 2:213924074-213924096 GGGACTGATGGGCTAGAAGCTGG + Intronic
945794116 2:214340582-214340604 AGGCCTGCTGGAGCAGCAGCAGG - Intronic
946246898 2:218393027-218393049 GGGCAGGATGGCGCAGGAGCGGG - Exonic
946375013 2:219302632-219302654 GAGGCTGTGGGGGCAGCAGCAGG + Exonic
946478287 2:220029957-220029979 GGGCCTGCTGAGGGAGGAGCGGG + Intergenic
947533395 2:230926503-230926525 GAGCCTGCTGGGACAGTAGCAGG + Intronic
948264485 2:236627041-236627063 GGCACTTATGTGGCAGCAGCAGG - Intergenic
948718915 2:239883825-239883847 CGGCCTGGTGGGGCAGCTGGTGG - Intergenic
948981834 2:241498475-241498497 GGGCCTGCTGAGGCATCAGCTGG - Intronic
948983128 2:241505189-241505211 GGGCCTGCTGGAGGAGGAGCAGG - Intronic
949052462 2:241904476-241904498 GGGCCTGCGGGGGCTGCAGTGGG + Intergenic
1168757228 20:325918-325940 AGGCGCGATGGTGCAGCAGCGGG + Exonic
1169141174 20:3228184-3228206 GGGCGGGCTGGGGCAGCGGCTGG - Intronic
1169207794 20:3749790-3749812 GGACCTGACGGTGCACCAGCTGG + Exonic
1169402200 20:5292287-5292309 AGGTCTGATAGGGGAGCAGCCGG + Intergenic
1170299096 20:14861842-14861864 GGTCCTGCTTGGCCAGCAGCAGG - Intronic
1170630383 20:18059475-18059497 GAGGCTGATGGGGCAGCTTCCGG + Intergenic
1171484817 20:25479029-25479051 GGGCCTGCAGGAGCAGCTGCAGG - Exonic
1172183850 20:33019535-33019557 GGCCCTGCTGAGGCAGCGGCTGG - Intronic
1172449271 20:35010329-35010351 GGGGCTGCTGGGTCAGCACCAGG + Intronic
1172760340 20:37317006-37317028 GCACCTGATGGAGCAGAAGCAGG - Exonic
1174253252 20:49235017-49235039 GGGGCTCATGGGGCTGCAGGTGG + Exonic
1174295001 20:49539588-49539610 GGGCCAGTTTGGGGAGCAGCCGG + Exonic
1175203003 20:57290852-57290874 GGGCCAGGTGGAGCAGCAGCAGG - Intergenic
1175265938 20:57703554-57703576 GGGCCTCTTGGGCCAGCAACGGG + Intronic
1175540298 20:59743915-59743937 GGGTGTGAGGGGGCAGCAGGAGG - Intronic
1175560551 20:59925207-59925229 GTGCCTGGTGGGGCAGCAGGAGG + Intronic
1175701084 20:61137607-61137629 GGTCCTGTTGGGGAAGGAGCCGG - Intergenic
1175822518 20:61918073-61918095 GGGCCTGGGGGGGCAGCTGCAGG + Intronic
1175915181 20:62422762-62422784 GAGCCTGGTGGGGCAGCAAGGGG + Intronic
1176034235 20:63028554-63028576 GGGGCGGGTGGGGCAGCGGCCGG + Intergenic
1176082828 20:63282486-63282508 GGGCCTGCTGGAGCAGAAGACGG - Intronic
1176114909 20:63427984-63428006 GGGCCTGAAGGAGAGGCAGCAGG + Intronic
1176512494 21:7759248-7759270 GGGAGTGAGGTGGCAGCAGCTGG + Intronic
1178646607 21:34389773-34389795 GGGAGTGAGGTGGCAGCAGCTGG + Intronic
1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG + Intronic
1179913699 21:44463059-44463081 GGGCCTGGTGGTGCTGCAGGGGG - Intergenic
1179958895 21:44757454-44757476 GGGCCTGATGGGGAAGATACGGG + Intergenic
1179958908 21:44757484-44757506 GGACCTGATGGGGCAGCTGGGGG + Intergenic
1179984828 21:44914380-44914402 GGGGCTGAGGGGGCAGGACCAGG + Intronic
1179987537 21:44930011-44930033 GGGCCTTGTGGGGCAGAGGCTGG - Intronic
1180245834 21:46546685-46546707 GGGGCTGGTGGGGCAGCATCAGG - Intronic
1180823558 22:18848045-18848067 GGGGCTGCTGCGGCAGCTGCAGG - Exonic
1180951899 22:19724221-19724243 CGGCCAGATAGGGCAGCAGGCGG - Exonic
1181123987 22:20691144-20691166 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
1181189181 22:21126501-21126523 GGGGCTGCTGCGGCAGCTGCAGG + Exonic
1181210018 22:21283994-21284016 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
1181263276 22:21614073-21614095 GGGCCTGAGGAGGCAGCAAGGGG - Intronic
1181319151 22:21991393-21991415 GGGGCTGATGGAGCTGAAGCAGG - Intergenic
1181399501 22:22642950-22642972 GGGGCTGCTGCGGCAGCTGCAGG + Intergenic
1181467227 22:23116770-23116792 GTGCCTGATGGGGAAGGAGTGGG + Intronic
1181649917 22:24253118-24253140 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
1181707462 22:24657628-24657650 GGGGCTGCTGTGGCAGCTGCAGG + Intergenic
1182422179 22:30253972-30253994 GGGCCGGGTGGGGGAGCCGCTGG + Intergenic
1182519553 22:30877719-30877741 GGGACTGGAGGGACAGCAGCAGG - Intronic
1182587141 22:31350611-31350633 GGGCCCGACAGGCCAGCAGCAGG - Intergenic
1182660066 22:31918888-31918910 GGGACTGCAGGGGCAGCTGCTGG - Intergenic
1183650168 22:39149074-39149096 GTTCCTGATGGGGCCTCAGCAGG + Intronic
1183948013 22:41337802-41337824 GGGCTGGATGGGCCAGCAGGTGG - Intronic
1183976623 22:41515959-41515981 GGGCCTGATGGGTCTCCAGTTGG + Intronic
1184047394 22:41979873-41979895 AGGCCTGATGGAGCAGCAGATGG - Intronic
1184272401 22:43392370-43392392 GGGCTTGGTGGGGCAGCACGTGG - Intergenic
1184293982 22:43512393-43512415 GGGCCTGCTGGGGCATCTCCTGG - Intergenic
1184474778 22:44714523-44714545 GGGCCTGATGGGCAACCAGGGGG + Intronic
1184665855 22:45988719-45988741 CGCCCTGATGGGGCAGCTCCAGG + Intergenic
1185047608 22:48536917-48536939 GGGCCTGGCTGGGCTGCAGCTGG + Intronic
1203216929 22_KI270731v1_random:11439-11461 GGGGCTGCTGCGGCAGCTGCAGG + Intergenic
950431463 3:12953397-12953419 GGGCCTTATCGGGCCTCAGCAGG - Intronic
950569387 3:13790742-13790764 GGGCCTGAAGGGGCAGGGGAGGG - Intergenic
950789821 3:15462936-15462958 GGGCGTGATTGGGCAGAGGCTGG + Intronic
952748046 3:36800635-36800657 GGGCCATATGGGGAAGCACCAGG + Intergenic
953464369 3:43105933-43105955 GGGCCTCCTGGGCCAGAAGCTGG - Exonic
954115716 3:48465941-48465963 GGGCATGAAAGGGCCGCAGCAGG + Exonic
954277384 3:49551521-49551543 GTCCCTGGTGGGGCAGCAGTTGG + Intergenic
954368111 3:50156711-50156733 GGAGCTGAAGGGGGAGCAGCAGG - Intronic
954421255 3:50420202-50420224 GGAGCTGATGGGGCAGCAAGGGG + Intronic
955548649 3:60059043-60059065 AGGCGTGATGGGGCAGGAGAGGG + Intronic
956510174 3:69985134-69985156 GGGCCACATGGGGAAGCACCAGG + Intergenic
956741867 3:72281656-72281678 GGACCAGATGGGGCAGGACCTGG - Intergenic
956750736 3:72342084-72342106 GGGCCAGATGGGGGAGCTCCTGG + Intergenic
957040119 3:75329862-75329884 TGGCCTGGTGGGGCAGCTCCTGG + Intergenic
959883004 3:111468043-111468065 GGGCCTGTCGGGGCAGCAGAGGG - Intronic
960091008 3:113637971-113637993 GGCCCTGATAGCACAGCAGCGGG - Intergenic
960263386 3:115593378-115593400 GGGCCACATGGGGAAGCACCAGG + Intergenic
960637460 3:119797314-119797336 TGGCCTCATGAGGAAGCAGCAGG + Intronic
960985687 3:123279174-123279196 GGCCCTGATGGAGTAGCAGTAGG + Intergenic
962301804 3:134250365-134250387 GGGCCGGCTGGGGCAGCTTCCGG - Intronic
962853568 3:139325624-139325646 GGCACTGAGGAGGCAGCAGCTGG + Intronic
963258520 3:143170167-143170189 GGACCTCGTGGGTCAGCAGCAGG - Intergenic
963532564 3:146489156-146489178 GGGCATGTTGGGGCAGTAGTAGG + Intronic
968473724 4:793288-793310 GGCCCTGCTGGGGCAGGAGCTGG + Intronic
968602734 4:1518023-1518045 TGGCCTCCTGGGGCAGCACCAGG + Intergenic
968695932 4:2026672-2026694 GGGCCTGCTGGGGGAGGAGAGGG - Intronic
968728518 4:2259238-2259260 GGGCCTGTTGGTGCAGCGGGTGG - Intronic
968958999 4:3733382-3733404 GGGCCTCAGGGGTCAGCTGCTGG - Intergenic
969090552 4:4690851-4690873 GGGACTGGTGGGGCATCAGCTGG + Intergenic
969184026 4:5462437-5462459 GGGCCGGCAGGGGCAGCTGCGGG + Intronic
969640883 4:8397741-8397763 TGGCCCGATGGGGCAGCACGGGG - Intronic
969675075 4:8610114-8610136 GGGCTTCCTGGGGCAGGAGCTGG + Intronic
970422095 4:15914883-15914905 GGGCCACATGGGGAAGCACCAGG + Intergenic
970451252 4:16168490-16168512 AGGCCTGATGGAGGAACAGCAGG - Intronic
973375816 4:49285953-49285975 GGGCGTGGTGGGGGAGTAGCTGG + Intergenic
973376716 4:49291972-49291994 GGGCGTGGTGGGGGAGTAGCTGG + Intergenic
973380505 4:49317243-49317265 GGGCGTGGTGGGGGAGTAGCTGG - Intergenic
973381594 4:49324288-49324310 GGGCGTGGTGGGGGAGTAGCTGG - Intergenic
973386114 4:49515360-49515382 GGGCGTGGTGGGGGAGTAGCTGG - Intergenic
974102769 4:57436094-57436116 AGGTCTGATGTGGCAGCTGCGGG + Intergenic
974549074 4:63349056-63349078 GGCCCTGTGAGGGCAGCAGCCGG + Intergenic
977935416 4:102797314-102797336 AGGTCTGATAGGGGAGCAGCCGG + Intronic
978205948 4:106081509-106081531 GGGCCTGTTGGGGGAGCTGGGGG + Intronic
978376262 4:108077722-108077744 TTCCCAGATGGGGCAGCAGCCGG - Intronic
980963404 4:139498522-139498544 GGGCCACATGGGGAAGCACCAGG - Intronic
982370838 4:154631166-154631188 GGGGCTGCTGGGGAGGCAGCAGG - Intronic
983660697 4:170128043-170128065 GGCCCTCATGGTGCAGCAGCAGG + Intergenic
984633868 4:182090356-182090378 TGGACTGATGGAGCAGCTGCTGG - Intergenic
985069988 4:186158391-186158413 GGGCCTGAAGGGGTGGCTGCTGG + Intronic
985750509 5:1671365-1671387 GAGCCTGTTTGGGCAGGAGCTGG - Intergenic
985769021 5:1797508-1797530 AGGCCTGGTGGGGCGGCAGAGGG - Intergenic
987708481 5:21483008-21483030 GGGGCTGCTGCGGCAGCTGCAGG + Intergenic
987843983 5:23257894-23257916 GGGCCTGATGGCACAGCAAGTGG + Intergenic
988751130 5:34191137-34191159 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
988751306 5:34191947-34191969 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
988751475 5:34192763-34192785 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
990352638 5:54934268-54934290 GGGAGTGATGGGGTGGCAGCAGG + Intergenic
991441759 5:66658077-66658099 GGTCCTGAAGTGGCAGCACCAGG - Intronic
991736270 5:69633061-69633083 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
991736440 5:69633868-69633890 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
991758623 5:69901275-69901297 GGGGCTGCTGTGGCAGCTGCAGG + Intergenic
991758796 5:69902082-69902104 GGGGCTGCTGCGGCAGCTGCAGG + Intergenic
991812766 5:70488700-70488722 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
991812938 5:70489507-70489529 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
991816072 5:70510806-70510828 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
991837852 5:70776341-70776363 GGGGCTGCTGTGGCAGCTGCAGG + Intergenic
991838025 5:70777148-70777170 GGGGCTGCTGCGGCAGCTGCAGG + Intergenic
992071135 5:73150635-73150657 GGGCAGGAGTGGGCAGCAGCTGG + Intergenic
993887696 5:93435650-93435672 AGCCCTGATGGGGCATCAGGAGG - Intergenic
994420376 5:99523206-99523228 GGGGCTGCTGCGGCAGCTGCAGG + Intergenic
994420544 5:99524025-99524047 GGGGCTGCTGCGGCAGCTGCAGG + Intergenic
994486496 5:100390289-100390311 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
994486833 5:100391927-100391949 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
995009751 5:107243816-107243838 GTGGCTGATGTGGCAGCAGTTGG - Intergenic
996142491 5:119929238-119929260 GGGACTGCTGGGCCAGAAGCTGG + Intergenic
996716200 5:126589952-126589974 TTTCCAGATGGGGCAGCAGCTGG - Intronic
997608114 5:135191300-135191322 AGGCCTGAGGGGGCAGCTGCGGG + Intronic
998172459 5:139880719-139880741 GGGCTTGATATGGCAGCAGCAGG + Intronic
998294478 5:140953936-140953958 GGGCCTGTTGGGGGAGCAATGGG - Intronic
999314503 5:150575248-150575270 GGGCCAGGTGGGGCAGCCTCAGG - Intergenic
999376073 5:151087256-151087278 GGGCAGGATGGGGCCTCAGCTGG - Intronic
1001117039 5:168948419-168948441 GAGCCTGAGGGGGCTGCAGATGG + Intronic
1001541452 5:172542711-172542733 GGGCCTGCCGGGGCGCCAGCAGG - Intergenic
1001748340 5:174109222-174109244 GAGCCTGATGGGGAAGATGCTGG + Intronic
1001945338 5:175773359-175773381 GGCTTTGTTGGGGCAGCAGCAGG + Intergenic
1002189787 5:177472566-177472588 GTCCCTGATGGGGGAGGAGCTGG - Intronic
1002500381 5:179643915-179643937 AGGCCTGATGGGGAAGCTCCTGG - Intronic
1002522853 5:179800984-179801006 AGGCCTTTTGGGGCAGCAGCAGG - Intronic
1002656638 5:180753740-180753762 GGCCCTGATGGGGCAGTGACTGG - Intergenic
1003330199 6:5123157-5123179 GGGCCTGACAGGGCCTCAGCTGG + Intronic
1005418595 6:25626919-25626941 GGGCCACATGGAGAAGCAGCAGG + Intergenic
1005426339 6:25706642-25706664 AGGCAAGAAGGGGCAGCAGCCGG + Intergenic
1006453780 6:34120644-34120666 GGGGGTGATGTGGCAGGAGCTGG - Intronic
1007231246 6:40348986-40349008 GGGCATGATGGAGCAGCAGAAGG - Intergenic
1007662971 6:43497725-43497747 GGGCCTGAGGGGAAAGCGGCTGG - Intronic
1007697526 6:43743296-43743318 GGGCCTGCTTGGGTAGCAGGGGG - Intergenic
1007939759 6:45769406-45769428 GGGCATGATGTGGCAGCATAGGG - Intergenic
1008308298 6:49933599-49933621 GGGTCCCATGGTGCAGCAGCGGG - Intergenic
1014465426 6:121750883-121750905 GGGCCTGTTGGGGGAGCAAGGGG - Intergenic
1015929527 6:138343908-138343930 TGGCATGATGGGGCAGGAGGAGG + Exonic
1018375000 6:163202074-163202096 AGGCCCGTTGGGGCAGCAGGAGG + Intronic
1018724985 6:166605008-166605030 GGGCCTGAGGGGCCAGCTGTGGG - Intronic
1018906616 6:168079529-168079551 GGGGAAGATGGAGCAGCAGCAGG + Intronic
1019279514 7:192895-192917 GGGGCGGCTGGGGCCGCAGCAGG - Intergenic
1019394972 7:813111-813133 AGGCAGGATGGGGAAGCAGCTGG + Intergenic
1019478372 7:1254946-1254968 GGGCTGGAAGGGGCCGCAGCGGG + Intergenic
1019706183 7:2498249-2498271 AGTCCTGATGAGGAAGCAGCCGG - Intergenic
1019713276 7:2526976-2526998 GGGCCTCGTGGAGCTGCAGCAGG + Intronic
1020006163 7:4784736-4784758 GGCCGTGATGGGGAAGCTGCCGG + Intronic
1020020019 7:4860304-4860326 GCACATGATGAGGCAGCAGCTGG + Exonic
1020116284 7:5478223-5478245 GGGCCTCTGGGGGCAGCAGATGG + Intronic
1021406281 7:20270774-20270796 AAGCCAGCTGGGGCAGCAGCTGG + Intergenic
1023075999 7:36483247-36483269 GGGACTGTTGGGCCAGAAGCTGG + Intergenic
1023512576 7:40969006-40969028 GGGCCGGCTGGAGCAGGAGCTGG - Intergenic
1023837936 7:44079498-44079520 GGGCCTGGTGAGACAGCAGAGGG - Intronic
1023863876 7:44229661-44229683 GGGCCTGTGGTGGCCGCAGCAGG + Intronic
1024152809 7:46590012-46590034 GGGCCTGATGGTCCAGCCCCTGG + Intergenic
1024620464 7:51152798-51152820 GGCCCTGTTGGGGCAGAGGCTGG + Intronic
1024671800 7:51602505-51602527 GTGGCTGTTGGGGCAGGAGCAGG - Intergenic
1027270321 7:76515269-76515291 GGGCCTGTGGGTGCAGGAGCTGG - Exonic
1027420795 7:78015798-78015820 GGGCCAGATGTGGCTGCATCTGG + Intergenic
1029690768 7:102179824-102179846 GGGCCTGAACGGGCAGCCCCCGG - Intronic
1029692380 7:102190879-102190901 GGGGCTGATGGGACAGCAGGAGG - Intronic
1029954131 7:104619852-104619874 GGGGCAGGTGGGGCAGCAGGGGG + Intronic
1032427857 7:131835959-131835981 GGGCCTGATGGGGCCACAAGTGG - Intergenic
1032864740 7:135914320-135914342 GAGCCTGCAGGGGCTGCAGCAGG - Intergenic
1034344611 7:150378907-150378929 GGCCCTGATGGGTCCCCAGCAGG + Intronic
1034356883 7:150457937-150457959 GGGCCTGTTGGGGAAGGAGCAGG - Intronic
1034445925 7:151114497-151114519 CGGCCTGCTGGGGCAGCCCCTGG - Intronic
1034896189 7:154877902-154877924 GTGGCTGCTGGGTCAGCAGCGGG + Intronic
1035069860 7:156135962-156135984 AGGCAGGATGGGGCAGGAGCTGG - Intergenic
1035195104 7:157211936-157211958 GTGCCAGATGACGCAGCAGCTGG - Intronic
1035225226 7:157428887-157428909 GGGCCTGAAGTGGCCACAGCTGG + Intergenic
1035332083 7:158102964-158102986 GAGCCTGACGGGACAGGAGCTGG + Intronic
1037711352 8:21357915-21357937 GGTCCTGAAGGGTGAGCAGCAGG - Intergenic
1037752628 8:21692712-21692734 GGGGCTGGTGGGTCTGCAGCTGG - Exonic
1037920913 8:22804853-22804875 GGGACTGGTGTGGCTGCAGCAGG - Intronic
1037939986 8:22944061-22944083 GGGCCACATGGGGAAGCAGCTGG - Intronic
1037951038 8:23018958-23018980 AGCCCCCATGGGGCAGCAGCTGG + Intronic
1038808090 8:30812750-30812772 GGGCCTGAAGCGGCAGCGGGCGG - Exonic
1040310468 8:46234197-46234219 GGGGATGTTGGGGCAGGAGCGGG + Intergenic
1041689107 8:60672015-60672037 GGGACAGATGGGACAGCACCAGG - Intergenic
1041982050 8:63873464-63873486 AGGCCTGAAGGGGCAGCAGGAGG + Intergenic
1042927671 8:73983078-73983100 GAGGTTGATGGGGAAGCAGCAGG + Intergenic
1044436537 8:92170921-92170943 GTGGCTGTTGGGGCAGCAGCAGG + Intergenic
1044996309 8:97841096-97841118 ATCCCAGATGGGGCAGCAGCCGG + Intronic
1045358055 8:101406658-101406680 GGCCATGAGGAGGCAGCAGCAGG - Intergenic
1046034213 8:108821644-108821666 GGGCCTGTTGGAGCTACAGCTGG - Intergenic
1047349070 8:124056030-124056052 GGTCCTTATGAGGCAGCAGCAGG - Intronic
1048877716 8:138850216-138850238 GGGCCTTCTGGGGAGGCAGCTGG - Intronic
1049136632 8:140907839-140907861 GGGAGAGATGAGGCAGCAGCGGG - Intronic
1049214576 8:141401879-141401901 GGCCCTGCTGGGGCCACAGCGGG - Intronic
1049544090 8:143221512-143221534 AGGCCTGGAGGGGCAGGAGCAGG - Intergenic
1049608494 8:143541145-143541167 GGCCCTGCTGGGGCTGCAGAGGG - Intronic
1049672035 8:143874146-143874168 GGGCATGCCGGGGCTGCAGCCGG - Intronic
1049680781 8:143917041-143917063 GGGGCTGATGGGGTAGGAGGAGG + Exonic
1049681924 8:143922857-143922879 GGAGCAGATGGCGCAGCAGCTGG - Exonic
1049701029 8:144012681-144012703 GGGCTTGGTGAGGCAACAGCAGG + Exonic
1049745319 8:144260790-144260812 GGTCCTGCAGGTGCAGCAGCAGG - Exonic
1049779630 8:144423021-144423043 GGGCCTGGTGGGGAGGCAGCGGG - Intergenic
1049787717 8:144459012-144459034 GGGCCTCATCTGACAGCAGCAGG + Intronic
1050180003 9:2911960-2911982 GGGCCTGATGGGGAAGAAAAGGG + Intergenic
1050426724 9:5519050-5519072 GGGCCACATGGGGAAGCACCAGG + Intronic
1051689689 9:19697273-19697295 GGGCCTGCCGGGGGTGCAGCGGG + Intronic
1052513653 9:29452600-29452622 TGGCATGATGTTGCAGCAGCTGG - Intergenic
1052916679 9:33928631-33928653 GGGGCTGATGGAGCATCCGCTGG - Intronic
1053168660 9:35862586-35862608 TGGTCTGATGAGGCTGCAGCAGG - Intergenic
1053300689 9:36947184-36947206 GGGCCTGATGGTGCTGCCTCTGG - Intronic
1053492891 9:38523904-38523926 GGGCATGATGGGGAAGCAGAGGG - Intergenic
1055823595 9:80297807-80297829 GGGCCTGTTGGGGGTGTAGCAGG + Intergenic
1056785717 9:89591332-89591354 GGGCTGCATTGGGCAGCAGCTGG + Intergenic
1056810082 9:89757364-89757386 GGTCCTGCTGGGACTGCAGCTGG + Intergenic
1057031058 9:91775538-91775560 GGGCCTGTTGGGGCCACAGGTGG - Intronic
1057114119 9:92504375-92504397 TGGCTTGCTGGGGCTGCAGCCGG + Intronic
1057673123 9:97112822-97112844 GGGCATGATGGGGAAGCAGAGGG - Intergenic
1058643772 9:107111675-107111697 GGGGCTGAAAGGTCAGCAGCAGG - Intergenic
1059262183 9:112988298-112988320 GGGCCTGTTGGGGGTGCAGCAGG - Intergenic
1059386515 9:113969039-113969061 GAGCTTGATGGGGTGGCAGCAGG + Intronic
1060240580 9:121898998-121899020 GGGGCTGATGGAGCAGGAGAGGG - Intronic
1060817357 9:126642169-126642191 GGCCCTGTTGTAGCAGCAGCAGG - Intronic
1060923092 9:127436432-127436454 GGGCCAGATGGGGTGGCAGCAGG - Intronic
1061050182 9:128190722-128190744 GGGACTGCTGGAGCAGCTGCTGG + Exonic
1061398125 9:130354508-130354530 GGGCTTGCCGGGGTAGCAGCGGG + Intronic
1061566151 9:131441833-131441855 GCCACTGGTGGGGCAGCAGCTGG - Intronic
1061783563 9:133009700-133009722 TGGACTGATGTGGCAGCAGATGG + Intergenic
1061805630 9:133136250-133136272 GGGGCCCATGGGGCAGGAGCAGG + Intronic
1061882943 9:133577121-133577143 GGACCTGCTGGGGGAGCCGCTGG - Intergenic
1062426536 9:136508688-136508710 GAACCTGATGCGGAAGCAGCAGG - Intronic
1062454273 9:136628439-136628461 CGGCCGGAGGTGGCAGCAGCTGG + Intergenic
1062630236 9:137460062-137460084 GGGCCTCACAGGGCAGCAGGTGG + Exonic
1203791981 EBV:156575-156597 GCGCCAGATGTCGCAGCAGCCGG - Intergenic
1203548731 Un_KI270743v1:151430-151452 GGGCGTGGTGGGGGAGTAGCTGG + Intergenic
1203549686 Un_KI270743v1:156975-156997 GGGCGTGGTGGGGGAGTAGCTGG - Intergenic
1185643583 X:1601320-1601342 GGGCCAGGCGGGCCAGCAGCAGG + Exonic
1186649241 X:11541160-11541182 GGGCCACATGGGGAAGCACCAGG + Intronic
1187432790 X:19240079-19240101 GGCACAGATGGGGCAGCAACAGG - Intergenic
1187784883 X:22872682-22872704 GGGCCTGTTGTGGCAGTAGGGGG + Intergenic
1189053721 X:37675762-37675784 CAGCCTGATTGGGCTGCAGCAGG - Exonic
1190055575 X:47179407-47179429 GGGCCTGGTAGGGCTGCGGCAGG - Exonic
1190084696 X:47384978-47385000 GGGACTGATGGAGGAGGAGCTGG + Intronic
1190330122 X:49230606-49230628 CAGCCTGATGGGGGAGCACCGGG + Exonic
1190465129 X:50718460-50718482 GGGGCAGCTGGGGCAGCAGGAGG + Intronic
1190641438 X:52484607-52484629 GGCCATGGTGGGGCAGGAGCAGG + Intergenic
1190646234 X:52528258-52528280 GGCCATGGTGGGGCAGGAGCAGG - Intergenic
1190712686 X:53081612-53081634 GGGGGTGAAGGGGCAGAAGCGGG + Intergenic
1192358631 X:70424998-70425020 GGCCCAGACGGAGCAGCAGCCGG - Exonic
1192588464 X:72339732-72339754 GGCCATGATGGGGCAGCAGCTGG - Intronic
1195064229 X:101225157-101225179 GAGTCTAATGGGGCAGCACCAGG - Intronic
1196828517 X:119758892-119758914 GGAACTGCTGGGGCTGCAGCGGG + Exonic
1198210298 X:134509928-134509950 GGGCCTGCTGGGGAGCCAGCAGG - Intronic
1198259573 X:134953760-134953782 GGGCCTGCTGGGGTGGCAGGGGG + Intergenic
1198361280 X:135897827-135897849 GGGCCTGTTGGGGGAGGAGTTGG - Intronic
1199659817 X:150037809-150037831 GGGCCACATGGGGAAGCACCAGG - Intergenic
1199793766 X:151177187-151177209 GGGCCTGATGCGGAGGGAGCCGG + Intronic
1199941107 X:152628661-152628683 GTGCCAGGTGTGGCAGCAGCAGG + Intergenic
1200048971 X:153418399-153418421 GGGCATGAGGAGGCAGCAGACGG - Intronic
1200115010 X:153766081-153766103 GGGGCCCATGGGGCAGGAGCAGG + Intronic
1201073188 Y:10168766-10168788 GCTCCTGGTGGGGCTGCAGCCGG - Intergenic
1201934792 Y:19396754-19396776 GGGACAGATAGGGCAGCAGGTGG - Intergenic