ID: 1090998815

View in Genome Browser
Species Human (GRCh38)
Location 11:131891141-131891163
Sequence CAAGCTAATCCCTTGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090998815 Original CRISPR CAAGCTAATCCCTTGTAGGG AGG Intronic
907661785 1:56400004-56400026 CAGGCTTTTCCCTTGCAGGGTGG - Intergenic
910456879 1:87407116-87407138 CAAGCTATTTCCTCGTTGGGGGG + Intergenic
914024116 1:143896701-143896723 CAAGTTATTCCCCTGTAAGGTGG - Intergenic
916531157 1:165657934-165657956 CAAGCTAGTCCCTTGTCTTGTGG + Intronic
919965531 1:202519971-202519993 CAGGCTATTCCTTTGTAGAGTGG + Intronic
1074536442 10:114331621-114331643 CAAGCAAATCACCTGTAGGCAGG + Intronic
1078570049 11:12449807-12449829 CAGGATAATCCCTTGTTGTGGGG - Intronic
1084279233 11:68076262-68076284 CAAGCTAATGAATTTTAGGGTGG + Intronic
1089559672 11:119337585-119337607 CAAATTAAGCCCTTGTAGAGAGG + Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1095540199 12:43300948-43300970 CATACTAATCCCTTGGAGGCAGG + Intergenic
1097005594 12:55915120-55915142 CAAGAGAATCCCTTGAAGGCGGG + Intronic
1097294427 12:57947298-57947320 CAAGCTAAACCATTTTAGGTGGG + Intronic
1097309710 12:58105263-58105285 GAAGCTAATCCATTTTAGAGTGG + Intergenic
1102911763 12:116720494-116720516 CATGGTCATCCCTGGTAGGGAGG - Intronic
1106224150 13:27772595-27772617 CAGGCAAATCCATTTTAGGGTGG - Intergenic
1108807680 13:54180008-54180030 CGAACTAATCGCTGGTAGGGTGG + Intergenic
1124212857 15:27777324-27777346 CAAGGGACTCCCTTCTAGGGAGG + Intronic
1126269489 15:46797933-46797955 GATTCTAATCCCTTGTTGGGTGG - Intergenic
1126474200 15:49049187-49049209 CAAGCTCATCCCTTGGAATGAGG + Intergenic
1135523190 16:23193099-23193121 CAATCTAATACCTTGTGGGTTGG - Intronic
1143620394 17:8076979-8077001 CAAGCCCATACCTTGTAGAGGGG + Exonic
1145832431 17:27927527-27927549 CAAGCTAGTCCCTTGTGGCAAGG - Intergenic
1156232185 18:35164376-35164398 CAAGCCACTTCCTTGTTGGGTGG + Intergenic
1158068028 18:53437047-53437069 AAACCTAATCCCTGTTAGGGAGG - Intronic
1159886918 18:73917212-73917234 CAAACTAAACCATTGTTGGGTGG + Intergenic
1161830348 19:6598197-6598219 CAACCTAGTTCCTAGTAGGGTGG - Intronic
1164487702 19:28674637-28674659 CCAGATAATCCCTTGTTGTGGGG + Intergenic
940516446 2:154690082-154690104 CAAGCACACACCTTGTAGGGTGG + Intergenic
943767207 2:191676153-191676175 CAACCTAATCCCTTTTCTGGGGG + Intergenic
948172237 2:235914040-235914062 GAAGCTAATCCTTTTTAGAGAGG + Intronic
1170420633 20:16189532-16189554 TAATCCAATCACTTGTAGGGTGG - Intergenic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
957846902 3:85748662-85748684 CATCCTAATCCCATTTAGGGGGG + Intronic
969039371 4:4283160-4283182 CAAGTTAACCCCTTCTTGGGGGG - Intronic
975759161 4:77601090-77601112 AAAGCTATTACCTTGTAGGGTGG - Intronic
979610519 4:122684226-122684248 AAAGCCAAACCCTGGTAGGGGGG - Intergenic
986996343 5:13611622-13611644 CAAGTTCATCACATGTAGGGAGG - Intergenic
990104312 5:52237877-52237899 CAAACCATTCCCTTGTAGGTCGG + Intergenic
991100666 5:62789078-62789100 CAAGCTAATACCTTGTAAAGAGG + Intergenic
992019227 5:72605904-72605926 AAATCTAATCCCTTGTATGGAGG - Intergenic
997612085 5:135222401-135222423 CAAGCTCCTCCCATGTAGGGTGG - Intronic
998506266 5:142675012-142675034 CAAGCCAAGCCTTTGGAGGGCGG - Intronic
1000342274 5:160287035-160287057 CAAGCTAATCCCCGGTATGTGGG - Intronic
1022481854 7:30749451-30749473 CCAGGTAATTCCTTGTTGGGTGG - Intronic
1036126537 8:6068267-6068289 CAAGATGATGCCATGTAGGGTGG - Intergenic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1041152139 8:54945422-54945444 CAAGCGACTCCCCTGAAGGGTGG + Intergenic
1045332400 8:101166597-101166619 CAAGCAGATCCCTTGGTGGGGGG - Intergenic
1056388063 9:86115954-86115976 CCAGCTAATGTTTTGTAGGGGGG - Intergenic
1061616734 9:131785283-131785305 CAAGCTAATCCCTCATGGAGGGG - Intergenic
1061643534 9:131979794-131979816 CATGCTAACTCCTTGTAGAGTGG + Intronic
1186552737 X:10523605-10523627 GAGGCTAATCCCTTGGAGGAAGG + Intronic
1194780812 X:98023370-98023392 GAACCTAGTCCCTTGAAGGGAGG - Intergenic
1197155077 X:123261828-123261850 ACAGCTAATGCATTGTAGGGGGG - Intronic
1200282193 X:154786337-154786359 CAATCTGATCCCTTGCAAGGAGG - Exonic