ID: 1090999259

View in Genome Browser
Species Human (GRCh38)
Location 11:131894676-131894698
Sequence GCTGCTGGTGGTTTGCAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090999259_1090999270 16 Left 1090999259 11:131894676-131894698 CCAGATTGCAAACCACCAGCAGC 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1090999270 11:131894715-131894737 TATCAAACCAGAGCAGCCCAGGG 0: 1
1: 2
2: 2
3: 14
4: 130
1090999259_1090999271 19 Left 1090999259 11:131894676-131894698 CCAGATTGCAAACCACCAGCAGC 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1090999271 11:131894718-131894740 CAAACCAGAGCAGCCCAGGGAGG 0: 1
1: 0
2: 0
3: 32
4: 273
1090999259_1090999269 15 Left 1090999259 11:131894676-131894698 CCAGATTGCAAACCACCAGCAGC 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1090999269 11:131894714-131894736 CTATCAAACCAGAGCAGCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090999259 Original CRISPR GCTGCTGGTGGTTTGCAATC TGG (reversed) Intronic
900952609 1:5866287-5866309 GCTGCTGGTGGATTGAAAGTGGG - Intronic
911745333 1:101435663-101435685 GCTGGTGGTGTTTTGAAATTTGG - Intergenic
917122894 1:171659859-171659881 GCTGCTCATGGTTTCCACTCTGG - Intergenic
919844406 1:201632300-201632322 GCTGCTGGTGGATGGCCTTCAGG - Intronic
920178328 1:204117118-204117140 GCTGCTGCTGCTTTGCAATCTGG - Exonic
923751421 1:236749980-236750002 GCTTCTTATGGTTTACAATCTGG - Intronic
1065341567 10:24711611-24711633 GTTGCTGTTGGCTTGCTATCTGG - Intronic
1065565636 10:27005702-27005724 GCTGCTGCTGAATTGGAATCTGG - Exonic
1066575814 10:36823525-36823547 GCTGTTGGTGGTTTGTAATTTGG + Intergenic
1066620970 10:37349351-37349373 GCTGCTGGTGATTTGCTTTGTGG + Intronic
1071980559 10:91000791-91000813 GCTGCTGGTGCTTAGCCCTCAGG + Intergenic
1073579525 10:104651795-104651817 GGTGCTGGTGGTTGGAAATCAGG - Intronic
1077704344 11:4469899-4469921 GATGCTGGTGGTTTGCACAAGGG + Intergenic
1078448488 11:11422798-11422820 GCAGCTGGTGGCAAGCAATCTGG + Intronic
1078819865 11:14867629-14867651 GATGCTGCTGGTTTGCTACCAGG + Exonic
1079009096 11:16813680-16813702 GTTGCTGGTGGTTATCATTCTGG - Intronic
1080168662 11:29271906-29271928 GCTGGTGGTGGTATGCAAAGAGG - Intergenic
1081701794 11:45157060-45157082 GCTGTCGGTGGTTTGTAAGCAGG + Intronic
1083752770 11:64770262-64770284 TCTGCAGGTGGCTTGAAATCCGG + Exonic
1085406491 11:76266176-76266198 TCTGCTGGCTGTCTGCAATCTGG - Intergenic
1089353185 11:117832930-117832952 ACTGCAGGTGGTCTGCAAACAGG + Intronic
1090577538 11:128123573-128123595 GCTGCTGGTGGGGTGTAATATGG + Intergenic
1090999259 11:131894676-131894698 GCTGCTGGTGGTTTGCAATCTGG - Intronic
1092070456 12:5627390-5627412 AGTGCTGGTCATTTGCAATCTGG - Intronic
1102416420 12:112766847-112766869 GCTGCTGGGGGTTTGAATTTTGG - Intronic
1103130106 12:118460682-118460704 GCTGCTGGTTGTTTCCAACATGG - Intergenic
1103992714 12:124809947-124809969 GCTGGTGGTGGTTTGCAGCCAGG - Intronic
1104804127 12:131574173-131574195 TCTGCTGGAGGTCTGCAACCAGG - Intergenic
1104968417 12:132520265-132520287 GCTGCTGGAGGTGTGCAAGGAGG - Intronic
1106006361 13:25773576-25773598 GCTGCTGGTGGGTCCCAAGCTGG - Intronic
1109419373 13:62090406-62090428 TCTGCTAGTGGCTTGCAATCAGG + Intergenic
1110477427 13:75932827-75932849 GCTGGTGGAGCTTTGCATTCTGG + Intergenic
1112220884 13:97488579-97488601 TCTGCTAGTGGTTCTCAATCAGG + Intergenic
1113929888 13:113962655-113962677 GCTGCTGGTGGCGTGCAGTGGGG - Intergenic
1119232639 14:72993042-72993064 GGTGCTGGTGATTGGAAATCTGG - Intronic
1122703441 14:103605581-103605603 GCTGCTGGTGCTCCTCAATCTGG - Intronic
1124138825 15:27059289-27059311 GCTACAGGTGGTTTGGAAGCGGG + Intronic
1125697183 15:41648959-41648981 GCTGCTGGTGGTTTGGACTAGGG + Intronic
1127284805 15:57523197-57523219 GCTGCTGGTGGTGGGAATTCAGG - Intronic
1127845463 15:62866570-62866592 GCTGCTGTGGGTCAGCAATCAGG + Intergenic
1129297103 15:74605542-74605564 GCTTCTGGTGCTTTGCCAGCAGG - Intronic
1131270223 15:90942702-90942724 GCTGCAGGTTGTTTGGAATACGG + Intronic
1136318781 16:29469064-29469086 GCTGCTGGGGGCTTGCATGCAGG + Intergenic
1136433353 16:30208408-30208430 GCTGCTGGGGGCTTGCATGCAGG + Intronic
1138174093 16:54880479-54880501 GCTGCTGGTGTTCTGGAAGCAGG - Intergenic
1138291758 16:55853977-55853999 GAGGCTGGTGGTTTTTAATCAGG + Intronic
1141962961 16:87421575-87421597 GCTGCTGCTTGTTTGCGACCTGG - Intronic
1141969666 16:87472477-87472499 GCTGCTGGTGGTCTGCTCTGTGG - Intronic
1143820580 17:9558394-9558416 GCTGCTGGATGTGTGCAGTCTGG - Intronic
1147768445 17:42851983-42852005 GCTCCCCGTGGTCTGCAATCAGG + Exonic
1147771034 17:42867915-42867937 GCTCCCCGTGGTCTGCAATCAGG + Intergenic
1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG + Intronic
1151651846 17:75475137-75475159 GATGCTGCTGCTCTGCAATCTGG - Intronic
1152555210 17:81049691-81049713 GCTGCTGTTGGTTTTCATTCCGG + Intronic
1152862068 17:82702306-82702328 TCTGCTGGGGGTTCGCAAACAGG + Intergenic
1153874754 18:9359186-9359208 GCTGCTGGTTGGTTGGAAGCTGG + Intronic
1159018852 18:63126409-63126431 TCTGCTGGTCATTTGCCATCTGG + Exonic
1163351563 19:16779377-16779399 GCTGCTGGTGATTGGCACCCAGG + Exonic
1164866099 19:31605665-31605687 GATGCTGGTTGGTTGCAAACAGG + Intergenic
1168352477 19:55684576-55684598 GCTCCTGGTGGTGTGGAACCTGG + Intronic
929858188 2:45652695-45652717 GCTGCGGGAGGTTTGCAAACTGG + Intronic
931711196 2:64989916-64989938 GCCGCTGGTGGTCTGCAGCCTGG + Exonic
933901244 2:86851686-86851708 GCTGCTTGTGGTTTGTTTTCTGG + Intronic
935779306 2:106497550-106497572 GCTGCTTGTGGTTTGTTTTCTGG - Intergenic
935826546 2:106957046-106957068 GCTGATGGTGGTTTCCAGGCAGG + Intergenic
937320958 2:120960448-120960470 TGGGCTGGTGGTTTGCAAACCGG - Intronic
937707071 2:124933329-124933351 GCTGCTGTTGATGTGGAATCAGG - Intergenic
941159572 2:162021110-162021132 GTTGGGGGTGGTTTGCAATTTGG + Intronic
942163899 2:173222393-173222415 TCTGCTGTTGGTTTCAAATCAGG - Intronic
944915613 2:204357573-204357595 GCTGCCGCTGGTTAACAATCTGG + Intergenic
1170126213 20:12967189-12967211 GCTGCTGGTAGCTTTCACTCAGG + Intergenic
1184839267 22:47043118-47043140 GATGCTGCTGGTTTGCTGTCAGG - Intronic
949613353 3:5727243-5727265 GCTGCTGATGGCTTTCCATCAGG + Intergenic
950140991 3:10615177-10615199 GCTGCTGGAGGGTTACAGTCAGG + Intronic
952095372 3:29945240-29945262 CCTGCTGGTGGTTTTCAAGCAGG + Intronic
952124962 3:30289965-30289987 GCTGCTTTTGGTTTGAATTCAGG + Intergenic
953582047 3:44166368-44166390 GGTGCTGGTGGTTAGAAGTCTGG - Intergenic
955793009 3:62607688-62607710 GCTGTTGTTGGTTTGCATTGGGG + Intronic
955817502 3:62861013-62861035 TCTGGTGTTGGTTTGGAATCTGG - Intronic
960904733 3:122589122-122589144 GAGGCTGGAGGTTTGCGATCAGG + Intronic
962198752 3:133384450-133384472 ACTGGTTGTGGCTTGCAATCTGG - Intronic
967949769 3:194831835-194831857 GTTGCTGGTGGGTTTGAATCGGG + Intergenic
979649002 4:123107718-123107740 GCTGAGGGTGGTTTGCCATAGGG - Intronic
981184932 4:141789771-141789793 GTTGCTTGTGGTTTTCATTCAGG - Intergenic
983820834 4:172192388-172192410 GCTGCTTCTAGTTGGCAATCTGG - Intronic
985542561 5:493696-493718 GGGGCTGGTGTTTTGGAATCTGG - Intronic
987788934 5:22538403-22538425 GATGCTGGTGTTTAGAAATCTGG - Intronic
991978059 5:72202473-72202495 TTAGCTGGTGGTTTTCAATCTGG + Intronic
994171175 5:96661557-96661579 GTTGCTGCTGGTTCACAATCAGG - Intronic
994729591 5:103476199-103476221 GGAGCAGGTGGTTTGCAGTCAGG + Intergenic
997341378 5:133147660-133147682 GCTGCAGTTGGTGTGCAATATGG - Intergenic
998134785 5:139668883-139668905 GGTGCTGATGGTTTACAAACGGG - Intronic
1002017214 5:176334518-176334540 GCTACTGGGGGGTTGCAAGCTGG - Intronic
1002096225 5:176832716-176832738 GCTGCTGAAGATTTTCAATCAGG + Intronic
1002607035 5:180389626-180389648 GCTGTTTGTAATTTGCAATCAGG - Intergenic
1003515114 6:6811431-6811453 GCTCCTGGTGATTTGGAAGCCGG + Intergenic
1003863152 6:10340259-10340281 GCTGATGGTGGTCTGCAGTATGG - Intergenic
1007200942 6:40108713-40108735 GGGGCTGGTGGATTCCAATCTGG - Intergenic
1007685380 6:43664482-43664504 GCTGCTGGTGGCTTGTGAGCAGG + Intronic
1008810237 6:55487784-55487806 GCTACTGGAGGTTTTTAATCAGG - Intronic
1008933325 6:56962705-56962727 CTTCCTGGTGGTTTGCCATCTGG + Intronic
1011112631 6:83854519-83854541 GCTGCTTTTGTCTTGCAATCTGG + Intronic
1015863317 6:137702853-137702875 GGTGCTGGTGGCTTGCACTGAGG - Intergenic
1019069657 6:169333232-169333254 GCTGCTGGTGGGTAGAAAACAGG - Intergenic
1019903313 7:4041608-4041630 GCTGCTGGGGGTCGGCAGTCAGG - Intronic
1022027963 7:26466406-26466428 TTTGCTGGTGGATTGCAATATGG + Intergenic
1026844464 7:73690302-73690324 GCTGCTTGAGGTTTTAAATCTGG + Intronic
1027673561 7:81131914-81131936 TCTGCTCGTGGATTTCAATCAGG - Intergenic
1030070643 7:105694730-105694752 GCTGTTTGTGGTTTGCAGTGTGG - Intronic
1037584758 8:20268768-20268790 GCTGCTGGTGGGTTGGGAGCAGG + Intronic
1037734816 8:21557199-21557221 GCTGCTGGTAGTTCACAATAGGG + Intergenic
1038247296 8:25870647-25870669 TATCCTAGTGGTTTGCAATCTGG - Intronic
1039354014 8:36795327-36795349 GCTGCTGGGTATCTGCAATCAGG - Intronic
1041320172 8:56604376-56604398 CCTGCTGGTGAGTTGCATTCAGG + Intergenic
1042768855 8:72356812-72356834 GCTGCTGGTGGAGTACATTCAGG + Intergenic
1045385490 8:101667762-101667784 TCTGCAGGGGGTTTGCCATCAGG + Exonic
1049775496 8:144401998-144402020 GCTGCTGTAGGTGTGCAACCAGG - Intronic
1055341260 9:75286015-75286037 TCTGCTGGTGGTTTGTATTTTGG + Intergenic
1055931814 9:81566800-81566822 GATTCTGTTGGTTGGCAATCTGG + Intergenic
1056974431 9:91238276-91238298 GCTGCTGAAGCCTTGCAATCAGG + Intronic
1061744133 9:132727420-132727442 GTTCCTGGTGGTTGGCAGTCTGG - Intronic
1186722499 X:12320440-12320462 GCTGGGGGTGCTTTGCATTCAGG - Intronic
1189463298 X:41259622-41259644 GCTGCTGCCGGCTGGCAATCTGG + Intergenic
1196157616 X:112448452-112448474 GCTGCTGGTTTTCTGCAATCTGG - Intergenic