ID: 1091002071

View in Genome Browser
Species Human (GRCh38)
Location 11:131918104-131918126
Sequence CCACTATCTGTAAAACCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 79, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091002071_1091002076 20 Left 1091002071 11:131918104-131918126 CCACCTGGTTTTACAGATAGTGG 0: 1
1: 0
2: 0
3: 79
4: 114
Right 1091002076 11:131918147-131918169 GCGTAAGGAGGCCTTCCAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 84
1091002071_1091002074 5 Left 1091002071 11:131918104-131918126 CCACCTGGTTTTACAGATAGTGG 0: 1
1: 0
2: 0
3: 79
4: 114
Right 1091002074 11:131918132-131918154 GTGATAATCAGTCTTGCGTAAGG 0: 1
1: 0
2: 0
3: 4
4: 33
1091002071_1091002075 8 Left 1091002071 11:131918104-131918126 CCACCTGGTTTTACAGATAGTGG 0: 1
1: 0
2: 0
3: 79
4: 114
Right 1091002075 11:131918135-131918157 ATAATCAGTCTTGCGTAAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 45
1091002071_1091002078 28 Left 1091002071 11:131918104-131918126 CCACCTGGTTTTACAGATAGTGG 0: 1
1: 0
2: 0
3: 79
4: 114
Right 1091002078 11:131918155-131918177 AGGCCTTCCAGAAGGGTGAGAGG 0: 1
1: 0
2: 4
3: 23
4: 245
1091002071_1091002077 21 Left 1091002071 11:131918104-131918126 CCACCTGGTTTTACAGATAGTGG 0: 1
1: 0
2: 0
3: 79
4: 114
Right 1091002077 11:131918148-131918170 CGTAAGGAGGCCTTCCAGAAGGG 0: 1
1: 0
2: 0
3: 1
4: 78
1091002071_1091002079 29 Left 1091002071 11:131918104-131918126 CCACCTGGTTTTACAGATAGTGG 0: 1
1: 0
2: 0
3: 79
4: 114
Right 1091002079 11:131918156-131918178 GGCCTTCCAGAAGGGTGAGAGGG 0: 1
1: 0
2: 0
3: 24
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091002071 Original CRISPR CCACTATCTGTAAAACCAGG TGG (reversed) Intronic