ID: 1091002075

View in Genome Browser
Species Human (GRCh38)
Location 11:131918135-131918157
Sequence ATAATCAGTCTTGCGTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091002073_1091002075 5 Left 1091002073 11:131918107-131918129 CCTGGTTTTACAGATAGTGGAAG 0: 1
1: 0
2: 0
3: 18
4: 200
Right 1091002075 11:131918135-131918157 ATAATCAGTCTTGCGTAAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 45
1091002071_1091002075 8 Left 1091002071 11:131918104-131918126 CCACCTGGTTTTACAGATAGTGG 0: 1
1: 0
2: 0
3: 79
4: 114
Right 1091002075 11:131918135-131918157 ATAATCAGTCTTGCGTAAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091002075 Original CRISPR ATAATCAGTCTTGCGTAAGG AGG Intronic
911729937 1:101282437-101282459 ATAAAAAGTCTTGCTTTAGGGGG - Intergenic
919769485 1:201148128-201148150 AACAGCACTCTTGCGTAAGGTGG + Intronic
1062769431 10:87440-87462 CTAATCAGTCTTGTGTAACCAGG - Intergenic
1091002075 11:131918135-131918157 ATAATCAGTCTTGCGTAAGGAGG + Intronic
1095337446 12:41045923-41045945 ATAATCAGTCTTGGGTCACATGG + Intronic
1099296198 12:80830951-80830973 TTAATCAGTACAGCGTAAGGAGG - Intronic
1100390386 12:94141748-94141770 GCAATCAGTCTTGGGTGAGGTGG + Intergenic
1121517377 14:94561555-94561577 ATTATCAGTCTTGGGCAAAGTGG - Intronic
1125211731 15:37224488-37224510 GTGATCAGTCTTTCATAAGGAGG + Intergenic
1128811638 15:70577418-70577440 ATCCTCAGTCTTGCAAAAGGAGG - Intergenic
1133857881 16:9566513-9566535 AAAATCAGTCTAGCAAAAGGAGG + Intergenic
1152448251 17:80359127-80359149 ATCATCAGGCCTGCGGAAGGGGG - Intronic
1158709270 18:59822934-59822956 CTAATCAGTCTGGGGTAAGAGGG + Intergenic
1165313634 19:35042143-35042165 ATCATAAGTCTTGGGAAAGGAGG - Exonic
1166476401 19:43129479-43129501 TTCTTCAGTCTTCCGTAAGGAGG + Intronic
929317498 2:40497493-40497515 TAAATCAGTATTGGGTAAGGGGG + Intronic
938120204 2:128627670-128627692 ACAATCAGTCTGGGGTAAGGAGG - Intergenic
940306707 2:152234821-152234843 ATCCTCAGTCTTGAATAAGGTGG + Intergenic
940339624 2:152566577-152566599 ATAATCAGTCTTGCCCATGAAGG - Intronic
941263692 2:163331887-163331909 AGAGACAGTCTTGCCTAAGGAGG + Intergenic
946672812 2:222124363-222124385 ATAATTAGGCTTGCAGAAGGAGG - Intergenic
947738952 2:232476205-232476227 ATAATCAGTCCTGGGAAAGTGGG + Intergenic
1169272205 20:4209233-4209255 ATAATTAGACTTGGGTAATGAGG + Intergenic
1172382853 20:34511406-34511428 TCTATCAGTCTTGGGTAAGGAGG + Intergenic
1179137100 21:38689235-38689257 AAAAGCTGTCTTGCATAAGGAGG + Intergenic
954998842 3:54907419-54907441 AGATTCAGTCTTGCGTTTGGGGG + Intronic
959772361 3:110114046-110114068 ATAATCAGCTTTGTGTTAGGTGG - Intergenic
967298367 3:187987469-187987491 ATATGCAGTCTTGCCCAAGGTGG - Intergenic
970860653 4:20699153-20699175 ATAATAAGTCTTGAGGAAGCTGG + Intronic
973048001 4:45559819-45559841 ACAATCAGTGTTGTGTAATGAGG - Intergenic
983138373 4:164115235-164115257 ATAATCAGTCATGAGCAATGAGG + Intronic
983726599 4:170936933-170936955 ATGATCAGTCATGCCTAAGGAGG + Intergenic
985104915 4:186490707-186490729 CTAATCAGTCTTTTGTTAGGGGG - Intronic
988368524 5:30335222-30335244 ATAATAAGTCTTTCGTACAGAGG + Intergenic
995714790 5:115071905-115071927 ATAAACAGTCTTGCCTCAGAAGG - Intergenic
996627990 5:125593184-125593206 ACAATGAATCTTGTGTAAGGAGG + Intergenic
1002846625 6:951806-951828 ATAATCAGACTTTTTTAAGGTGG + Intergenic
1002953097 6:1835143-1835165 AGAGTCTGTGTTGCGTAAGGGGG + Intronic
1003587023 6:7400127-7400149 ATAATCAATCTTGAGTAAAATGG - Intronic
1012128981 6:95467142-95467164 AGAATCAGTCCTGTGTAGGGAGG - Intergenic
1017140534 6:151185563-151185585 ATAATCTGTGTTGAGGAAGGTGG + Intergenic
1028023789 7:85810071-85810093 ATAATCAGTGTTGTTTAAAGAGG + Intergenic
1035190040 7:157159023-157159045 ATAATCACTCCTGTGAAAGGCGG + Intronic
1035718882 8:1775903-1775925 ATTCTCAGTCTTCCGTAAGTGGG + Intronic
1046222587 8:111235407-111235429 ATAATTAGTCTTTCTAAAGGAGG - Intergenic
1048247047 8:132816960-132816982 ATCATCAGGCATGGGTAAGGTGG - Exonic
1059217022 9:112573792-112573814 ATAATAATTCCTGCCTAAGGGGG - Intronic
1189755581 X:44268231-44268253 AAAATCATTCTTGTGTAAGGAGG - Intronic
1192894313 X:75424638-75424660 ATATTCAGTCTTACCTAAGGTGG + Exonic
1199702658 X:150395251-150395273 ATAATCAGTCTTGCATACCTAGG + Intronic