ID: 1091002075

View in Genome Browser
Species Human (GRCh38)
Location 11:131918135-131918157
Sequence ATAATCAGTCTTGCGTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091002073_1091002075 5 Left 1091002073 11:131918107-131918129 CCTGGTTTTACAGATAGTGGAAG 0: 1
1: 0
2: 0
3: 18
4: 200
Right 1091002075 11:131918135-131918157 ATAATCAGTCTTGCGTAAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 45
1091002071_1091002075 8 Left 1091002071 11:131918104-131918126 CCACCTGGTTTTACAGATAGTGG 0: 1
1: 0
2: 0
3: 79
4: 114
Right 1091002075 11:131918135-131918157 ATAATCAGTCTTGCGTAAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091002075 Original CRISPR ATAATCAGTCTTGCGTAAGG AGG Intronic