ID: 1091002242

View in Genome Browser
Species Human (GRCh38)
Location 11:131919421-131919443
Sequence ATGTGTGAGCTGAAGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 496}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091002239_1091002242 16 Left 1091002239 11:131919382-131919404 CCAAGGACTTATTGGGTTTAGGA 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1091002242 11:131919421-131919443 ATGTGTGAGCTGAAGGGAGAAGG 0: 1
1: 0
2: 4
3: 40
4: 496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091002242 Original CRISPR ATGTGTGAGCTGAAGGGAGA AGG Intronic
900626397 1:3610683-3610705 ATGGGGGAGCTGAATGGAGTTGG - Intronic
900930384 1:5733469-5733491 GTGTGTGGACTGATGGGAGACGG - Intergenic
901053534 1:6437863-6437885 GTGTGTGAGAGGGAGGGAGAGGG + Intronic
901720875 1:11196370-11196392 ATATGTGAGCTTTAAGGAGATGG + Intronic
902279585 1:15364743-15364765 ATGTGTGTGCTGCAGGGAGTGGG - Intronic
902333818 1:15743621-15743643 ATCTGTTAGCTGAAGGGTGGTGG - Intronic
902480741 1:16710281-16710303 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
902849182 1:19140308-19140330 ATCTGTGAGCTTGAGAGAGAGGG - Intronic
903851839 1:26311931-26311953 ATGTGGGTGGAGAAGGGAGAAGG - Intronic
904304047 1:29575577-29575599 ATGTGTGATTTCAAGGGAGGAGG + Intergenic
904903572 1:33877103-33877125 ATGTGTGGGCAGAAGGCAAATGG + Intronic
904961495 1:34336671-34336693 AGGTGTGAGCTGAATGGAGCTGG + Intergenic
908020649 1:59894511-59894533 GTGGGTGAACTGAAGGCAGAAGG + Intronic
908146238 1:61247614-61247636 ATGTGTGAGGGGAGGTGAGAGGG + Intronic
908542850 1:65137949-65137971 ATGAGAGGGCTGAAGGGATATGG - Intergenic
908764477 1:67541961-67541983 ATGTTTGAGCTGAGCAGAGAGGG + Intergenic
908798864 1:67858311-67858333 TTGTGTAAGCTCCAGGGAGATGG + Intergenic
909587027 1:77301540-77301562 ATGTGTGGGAAGAAGGGAGCAGG - Intronic
910371212 1:86517192-86517214 ATCAGTCAGCTGAAGGTAGAGGG - Intergenic
910434630 1:87192806-87192828 ATGTGTGTGGTGAAGGTTGATGG + Intergenic
910489996 1:87757939-87757961 AAGGGTGAGCTGTCGGGAGAAGG + Intergenic
911330952 1:96525225-96525247 ATGTTTAAGCTGAAAGGTGAAGG + Intergenic
912162575 1:107003837-107003859 ATGTGTGACTTGATAGGAGAAGG - Intergenic
912700774 1:111876781-111876803 ATGTATAGGCTTAAGGGAGAAGG + Intronic
913386626 1:118264711-118264733 ATGGGTGAGCTGAACGTACAGGG - Intergenic
913434533 1:118832836-118832858 ATGAATGAAATGAAGGGAGAAGG + Intergenic
913598966 1:120404845-120404867 GGGTGGGAGCTGAAAGGAGAAGG - Intergenic
914088411 1:144474775-144474797 GGGTGGGAGCTGAAAGGAGAAGG + Intergenic
914310201 1:146459435-146459457 GAGTGGGAGCTGAAAGGAGAAGG - Intergenic
914359758 1:146923538-146923560 AGGTGTTGGCTGAAGGGGGATGG + Intergenic
914379637 1:147104750-147104772 GGGTGGGAGCTGAAAGGAGAAGG + Intergenic
914493993 1:148176356-148176378 AGGTGTTGGCTGAAGGGGGATGG - Intergenic
914591909 1:149113704-149113726 GGGTGGGAGCTGAAAGGAGAAGG + Intergenic
914676228 1:149909357-149909379 ATGGGTGAGCTGAAGGGAGGTGG - Intronic
915661767 1:157410875-157410897 TTGAGGGAGCTGAAGGGAGGGGG + Intergenic
917767281 1:178235368-178235390 ATGTGTGAGGTGCTGTGAGAAGG + Intronic
918160687 1:181896192-181896214 ATGGGTGAAATGAAGAGAGAAGG - Intergenic
918170264 1:181989631-181989653 ATGTGTGAGGAGAAAGAAGAAGG - Intergenic
918450140 1:184649956-184649978 ATGTGTGTACTGAGGGGACAGGG + Intergenic
918548167 1:185708794-185708816 ATGAGTGAAATGAAGCGAGAAGG + Intergenic
919355205 1:196513630-196513652 AAGTGAGAGCTGAAGGAAGAAGG - Intronic
919645066 1:200087207-200087229 GTGTATGTGTTGAAGGGAGAGGG - Intronic
920265439 1:204718135-204718157 ATGTGAGAGCTGGAGCAAGAAGG - Intergenic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
920906016 1:210169037-210169059 ATGTGCAAGCTAGAGGGAGAAGG - Intronic
921162922 1:212485842-212485864 ATGTGTGCTCTGAAAGGACAGGG + Intergenic
921926189 1:220711720-220711742 ATGTGTGTGTTGAGGGGAGTGGG - Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
923051018 1:230391562-230391584 AGGTGTGAGGAGGAGGGAGAGGG - Intronic
923961769 1:239093064-239093086 ATGACTGAGCTGAAGTCAGAAGG - Intergenic
924407223 1:243760653-243760675 ATAGGAGAGCTGAAGGAAGAAGG - Intronic
924802311 1:247336359-247336381 ATGTGAGAGCAGGAGGAAGAGGG + Intergenic
924825190 1:247531431-247531453 TTGTTTGAGCTCAAGGTAGATGG - Exonic
1063052210 10:2464643-2464665 ATGTGTGTTTTGTAGGGAGATGG + Intergenic
1063374985 10:5548884-5548906 ATGTGTGTGGATAAGGGAGAGGG - Intergenic
1063536337 10:6887307-6887329 ATGTGTGGGTTGATGGGGGATGG - Intergenic
1064523792 10:16231696-16231718 CTGAGGGAGCTGTAGGGAGAAGG - Intergenic
1066023395 10:31325648-31325670 ATGGGGGAGGGGAAGGGAGAGGG - Intronic
1066412924 10:35191543-35191565 TTCAGTGAGATGAAGGGAGAAGG - Intronic
1066953554 10:42144727-42144749 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1067517323 10:46962713-46962735 ATAAGTGTGCTGAAGGGATAGGG + Intronic
1067644925 10:48089116-48089138 ATAAGTGTGCTGAAGGGATAGGG - Intergenic
1067746580 10:48940812-48940834 AGGTTTCAGGTGAAGGGAGAGGG + Intronic
1068185763 10:53583915-53583937 GTGTGTGTGCTGAATGGAGGAGG + Intergenic
1069132629 10:64726214-64726236 ATGGGTGAGATGGAGGGGGATGG - Intergenic
1069178137 10:65320816-65320838 ATGTGAAAACTGAAGGGTGATGG - Intergenic
1069224998 10:65932059-65932081 GTGTGTAAGCTGAAGGGAGGAGG + Intronic
1069366693 10:67701041-67701063 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1070011302 10:72477202-72477224 ATGTTTGATTTGAATGGAGATGG - Exonic
1070050671 10:72886609-72886631 ATTTGTGTTCTGGAGGGAGAGGG - Exonic
1070202268 10:74218284-74218306 ATGAGTGAAATGAAGCGAGAAGG + Intronic
1070233563 10:74598183-74598205 ATGTGTGAGCTTAAGTGTAAGGG + Intronic
1070950263 10:80425553-80425575 AGGGTTGAGCTGAAGAGAGAAGG + Intronic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1072414266 10:95233701-95233723 ATATGTGAGCTGTAGGGGCATGG - Intergenic
1073513879 10:104060315-104060337 ATGTGCCAGGAGAAGGGAGAGGG + Intronic
1074889383 10:117722542-117722564 ATTTGTTGGCTGAAGGTAGAAGG + Intergenic
1075310032 10:121406087-121406109 AGGACTGAGGTGAAGGGAGAGGG + Intergenic
1075366854 10:121897995-121898017 ATGTGTAAGCTAAAAAGAGAGGG - Intronic
1075594944 10:123722373-123722395 ATCTGTGAGCTGAAGCCATAAGG + Intronic
1075719885 10:124578409-124578431 ATGAGTGAGCAGATCGGAGAAGG - Intronic
1075744655 10:124718397-124718419 ATGTGGGGGTAGAAGGGAGAAGG - Intronic
1076462760 10:130657588-130657610 ATGTGTGCTCTGCAGGGTGAGGG - Intergenic
1076633050 10:131863578-131863600 CTGGGAGAGCCGAAGGGAGAAGG + Intergenic
1076984203 11:223624-223646 ACGTGTGAGGAGAAGGGAGAAGG - Intronic
1077464607 11:2727711-2727733 CAGAGTGAGCTGAATGGAGAAGG + Intronic
1078242684 11:9545064-9545086 ATGTATGAAATGAAGTGAGAAGG - Intergenic
1078802685 11:14662723-14662745 ATGAATGAACTGAAGCGAGAAGG + Intronic
1079102541 11:17550891-17550913 AGGTGTGAGCGTAAGGGACAAGG + Intronic
1080763670 11:35276472-35276494 GTGTGTCAGCAGAAGGGAGTTGG - Intronic
1081589300 11:44409765-44409787 GGGTGTGAGTTGAAGGCAGAGGG + Intergenic
1081684761 11:45034515-45034537 AGGTGTGAGCAGAAGAGAGGTGG - Intergenic
1082321521 11:50818070-50818092 ATGAATGAGATGAAGTGAGAAGG - Intergenic
1082574476 11:54786268-54786290 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1083130335 11:60618961-60618983 AGGTAGGAGCTGAAGGGACACGG - Intergenic
1084751899 11:71209530-71209552 ATGTGTGTGCTGGTGGGAGGGGG - Intronic
1084903999 11:72331991-72332013 ATGTGGGAGGTGGAGGGGGAAGG + Intronic
1085254896 11:75166900-75166922 AGGTGTGAGCTGGTGGGAGGAGG - Intronic
1085329533 11:75636511-75636533 ATGTGGGGGCTGAAGAGCGAGGG - Intronic
1086127127 11:83360430-83360452 ATGTGATAGCAGAAAGGAGAAGG - Intergenic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087330650 11:96776520-96776542 ATGAGTGAAATGAAGTGAGAAGG - Intergenic
1087478561 11:98669560-98669582 GTGTGTGTGTTGGAGGGAGAAGG - Intergenic
1087673137 11:101129048-101129070 ATGACTGAGCTGAAGGCAAAGGG - Exonic
1088524052 11:110732854-110732876 ATTTGGGAACTGAAGGGAAAGGG + Intergenic
1088766286 11:112982559-112982581 CTGTGTGAGGTGATGGGAGGTGG + Intronic
1088799368 11:113291218-113291240 ATGTGTGATTTGAAGGCAGAAGG + Intergenic
1089728157 11:120501221-120501243 GTTTGGGAGCTGAAGGAAGAGGG - Intergenic
1089846315 11:121461259-121461281 ATGGGTGGGCTGGAGGGGGACGG + Intronic
1089930468 11:122305374-122305396 AGGTGTGAAATGAAGGGGGAAGG - Intergenic
1091002242 11:131919421-131919443 ATGTGTGAGCTGAAGGGAGAAGG + Intronic
1091014424 11:132037301-132037323 ATGGCTGAGGTGAAGGGAGCCGG - Intronic
1091862998 12:3803644-3803666 ATGGGTGAGCTGAAGGAGTAAGG + Intronic
1092022575 12:5214677-5214699 ATGTGTGGGATCAAAGGAGAAGG - Intergenic
1093174994 12:15903158-15903180 AAGTGTCAGATGAAGGGAGGTGG + Exonic
1094102803 12:26781209-26781231 AGGTGTTTGCTGAAGGCAGAAGG + Intronic
1094214253 12:27923563-27923585 AAGTATCAGCTGGAGGGAGAAGG - Intergenic
1094695293 12:32812085-32812107 ATATGGCAGCTGAAGGGAGCTGG + Intronic
1095043895 12:37477225-37477247 ATGAGAGAGACGAAGGGAGAGGG - Intergenic
1096289046 12:50325197-50325219 AGGTGTTTGCTGAAGGCAGAGGG + Intergenic
1096483548 12:51959809-51959831 ATTTGTGAGTGGAGGGGAGAGGG + Intronic
1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG + Intergenic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098181147 12:67848530-67848552 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1098186463 12:67901482-67901504 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1098270827 12:68768690-68768712 ATATGAGAGCTGATGGAAGAAGG + Exonic
1098372755 12:69778141-69778163 ATGAATGAAATGAAGGGAGAAGG - Intronic
1098784420 12:74732582-74732604 ATGTGTGAGAGGAAGGAATATGG - Intergenic
1101210895 12:102534343-102534365 ATGTTTCAGCTGATGGGAGGAGG + Intergenic
1101695972 12:107127171-107127193 ATCTGTGTGCTTATGGGAGATGG - Intergenic
1102180118 12:110906267-110906289 ATGTGAGAGGGGGAGGGAGAGGG + Intronic
1103147859 12:118610972-118610994 AGCTGTGATCTGAAGGCAGAAGG - Intergenic
1104433331 12:128734580-128734602 ATCAGTGAGGGGAAGGGAGAAGG + Intergenic
1104477009 12:129078963-129078985 ATGTGTGGGGTGTGGGGAGAGGG - Intronic
1105457135 13:20551424-20551446 ATGAGTAAGAGGAAGGGAGATGG + Intergenic
1105809980 13:23986410-23986432 ATGTGTTATCTGCAGGAAGAGGG + Intronic
1106080186 13:26493891-26493913 ATGTGTAGGCTCAAGGGAGGTGG - Intergenic
1106314009 13:28577842-28577864 AGCTGAGAGCTGAAGGGAGGGGG - Intergenic
1106444056 13:29808368-29808390 ATGTGTGAGGTGGGGGGAGTGGG - Intronic
1107056069 13:36104938-36104960 ATATGAGAACAGAAGGGAGAAGG + Intronic
1108114112 13:47109112-47109134 ATGTGTGAGATGCAAGCAGATGG - Intergenic
1108250495 13:48562716-48562738 ATTTCTTACCTGAAGGGAGAAGG + Intergenic
1108546703 13:51502385-51502407 ATGAGTCAGCTGGAGGCAGAAGG - Intergenic
1109161431 13:58979974-58979996 ATAACTGAGCTGAATGGAGAGGG + Intergenic
1110041882 13:70771456-70771478 ATGTGTGGACTGTTGGGAGAAGG + Intergenic
1110668149 13:78142274-78142296 GTGTGGGAGTTGAAGGAAGAAGG + Intergenic
1110721948 13:78772023-78772045 GTGTGAGAGCAAAAGGGAGAGGG + Intergenic
1111872420 13:93849492-93849514 AGGTGAGAGCTAGAGGGAGATGG - Intronic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113346530 13:109483296-109483318 ATGTGTGAGCTCCCAGGAGAAGG - Intergenic
1114861431 14:26528076-26528098 AGGTTTGAGGGGAAGGGAGAAGG + Intronic
1115705320 14:35992544-35992566 ATGTGTGAGCAGATGGGCGTAGG + Intergenic
1115719718 14:36147389-36147411 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1115967127 14:38903051-38903073 ATGTGAGTGGTAAAGGGAGAGGG + Intergenic
1116092535 14:40327483-40327505 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1116094409 14:40349337-40349359 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1116096817 14:40380729-40380751 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1116138032 14:40953635-40953657 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1117341305 14:54794598-54794620 AGTTGTGAGCTTAAAGGAGAGGG + Intergenic
1117982383 14:61354668-61354690 ATTCGTCAGGTGAAGGGAGAGGG - Intronic
1118685533 14:68286807-68286829 ATGAGTCAGCTGAAGGCAGAGGG + Intronic
1121051360 14:90820882-90820904 ATGAATGAGCTGAAGGAAGGTGG + Intergenic
1121994338 14:98590440-98590462 AGATGGGAGCAGAAGGGAGATGG + Intergenic
1125112646 15:36051179-36051201 CCTTGAGAGCTGAAGGGAGAAGG + Intergenic
1125580699 15:40783402-40783424 ATGGGTGAGAGGAAGGGAGGGGG + Intronic
1126033690 15:44526780-44526802 CTGTGTGAGCTGAAGGGGCTGGG - Exonic
1126466208 15:48963464-48963486 CTGTGAGAGCCGAAGGGAGCAGG - Intergenic
1126745016 15:51817575-51817597 ATGGGTGAGCCAGAGGGAGATGG + Intergenic
1126935950 15:53708019-53708041 ATGTGGAAGGTGAAGGCAGAGGG - Intronic
1127318891 15:57823498-57823520 ATGTGTTAGCTGATGGGGAAAGG + Intergenic
1127337792 15:58006833-58006855 ATATGAGAGCTGAAGCAAGAAGG - Intronic
1127568647 15:60218462-60218484 TTGTGAGAGCTGAATGGAGGTGG - Intergenic
1127762106 15:62149623-62149645 ATGTGTGAGCTGGAGGAATGAGG + Intergenic
1128648325 15:69393079-69393101 AAGTGGGAGCTGAGGGGAGAGGG + Intronic
1128743875 15:70100423-70100445 ATTTGGGAGCTGAGAGGAGAGGG + Intergenic
1129459059 15:75690804-75690826 AAGTCTGACCTGAAGAGAGATGG + Exonic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1129595598 15:76961559-76961581 ATGTGAGAGCTGGAAGGAAATGG - Intergenic
1129724757 15:77896089-77896111 AAGTCTGACCTGAAGAGAGATGG - Intergenic
1129882419 15:79016216-79016238 ATGTGTGTGTTGCAGGGAGGAGG + Intronic
1130042877 15:80419496-80419518 CTGGGTGATCTGGAGGGAGAAGG + Intronic
1130257599 15:82332960-82332982 ATGAGTGGGCTGCAGGGAGTGGG + Intergenic
1130597342 15:85257004-85257026 ATGAGTGGGCTGCAGGGAGTGGG - Intergenic
1130600019 15:85268361-85268383 ATGTGTAAGCTCATGGGTGACGG + Intergenic
1131353003 15:91718590-91718612 GAGTGTGTGTTGAAGGGAGAAGG + Intergenic
1132011363 15:98279474-98279496 ATGTCTGATCTGCAGAGAGAAGG + Intergenic
1132210650 15:100019845-100019867 AAGTGTGAGCTGGAGGGAGATGG - Intronic
1132232073 15:100191774-100191796 TTGTGTGAGAGAAAGGGAGAGGG + Intronic
1132306700 15:100820149-100820171 ATGTGTCAGCTGCAGGAAGCAGG - Intergenic
1132473677 16:121311-121333 ATCTGTGAGCTGAAGTAAAAAGG + Intronic
1132860782 16:2070748-2070770 ATGTGTGGACTGCAGGCAGAGGG - Intronic
1133402372 16:5498055-5498077 GTGAGTGAGCTTGAGGGAGAGGG + Intergenic
1133403419 16:5504976-5504998 AGGTGAGAGCTGAAGGGTGCAGG + Intergenic
1134254818 16:12602229-12602251 ATGAGAGATCTGAAGTGAGAGGG - Intergenic
1134909293 16:18009573-18009595 CTGTGAGAGCTGATAGGAGATGG + Intergenic
1135251715 16:20906090-20906112 ATGTGTGTGTTGCAGGGAGTAGG - Intronic
1135596303 16:23745987-23746009 ATTAGTGAGCAGAAGGGAGATGG + Intergenic
1136294321 16:29293052-29293074 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1136538269 16:30913290-30913312 AACTGTGAGCTGAAGGAAGGAGG + Intergenic
1137228365 16:46536757-46536779 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1139815554 16:69667897-69667919 ATGTGTGAACAGAATGGAAAGGG - Intronic
1140059823 16:71558907-71558929 ATGTGGGAGATGGAGAGAGATGG - Intronic
1140191559 16:72821426-72821448 ATGTGGGAACTCAATGGAGACGG - Intronic
1140915635 16:79490871-79490893 ATGTCAGAGATGAATGGAGAAGG + Intergenic
1141188883 16:81809177-81809199 AGGTGTGTGCTGAGGGGATAAGG - Intronic
1141906820 16:87032225-87032247 GGGTGTGAGCTGGTGGGAGAGGG - Intergenic
1142100227 16:88267099-88267121 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1142266489 16:89066361-89066383 ATGCGTGGCCTGCAGGGAGAGGG + Intergenic
1143003699 17:3812930-3812952 CTGTGTGAGCAGGAGCGAGAGGG + Exonic
1143206188 17:5140717-5140739 AGGCATGAGCTGAAGGCAGAGGG - Intronic
1143250237 17:5518136-5518158 ATGGGGGAGGTGAAGGAAGAAGG - Intronic
1143435456 17:6921266-6921288 ATGTGGCAGCTGTAAGGAGATGG + Intronic
1143685003 17:8506758-8506780 CTGTGAGAGCCGAAGGGAGCTGG + Intronic
1144124781 17:12192980-12193002 ATGAGTGAGGAGAAGGCAGATGG + Intergenic
1145690809 17:26737117-26737139 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1145785756 17:27592833-27592855 AAGTGTTAGCTCAAAGGAGAAGG - Intronic
1146757179 17:35443189-35443211 ATGTTTGGGCAGCAGGGAGAGGG + Intronic
1146854730 17:36253070-36253092 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1146865890 17:36335306-36335328 AGACGTGAGCTGAAGGCAGAGGG - Intronic
1146870630 17:36376962-36376984 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1146877988 17:36428043-36428065 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1147038068 17:37696487-37696509 GAGTGTGAGCAGGAGGGAGAAGG - Intronic
1147068760 17:37935918-37935940 AGACGTGAGCTGAAGGCAGAGGG - Intergenic
1147073513 17:37977586-37977608 AGACGTGAGCTGAAGGCAGAGGG + Intergenic
1147080283 17:38015455-38015477 AGACGTGAGCTGAAGGCAGAGGG - Intronic
1147085035 17:38057124-38057146 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1147096231 17:38139415-38139437 AGACGTGAGCTGAAGGCAGAGGG - Intergenic
1147100981 17:38181090-38181112 AGACGTGAGCTGAAGGCAGAGGG + Intergenic
1148125351 17:45233781-45233803 GTGGGTGAGATGCAGGGAGACGG - Intronic
1148210504 17:45805755-45805777 ATGAGTGAGGGGCAGGGAGAGGG - Intronic
1148475948 17:47928665-47928687 AGGGGTGAGGTGAAGGGAGAGGG - Exonic
1150000505 17:61434130-61434152 ATGTCACAGCTGAAGGGGGATGG + Intergenic
1151420452 17:73993662-73993684 TTGTGTGAGCTGAAAAGAGGAGG + Intergenic
1152271745 17:79328982-79329004 AGGTATGGGCTGAAGGCAGAGGG + Intronic
1153665291 18:7362761-7362783 ATGTATGAGCAGAAGTGATATGG + Intergenic
1155011638 18:21784661-21784683 ATATAGGAGCTGAAGGGACATGG + Intronic
1156108205 18:33691279-33691301 GTGTGTGACCTGAAGTGTGAAGG - Intronic
1159416437 18:68154897-68154919 ATTCTTGATCTGAAGGGAGAAGG + Intergenic
1159692226 18:71503578-71503600 ATGTGTTAGGTGGAGGGAGATGG - Intergenic
1159730659 18:72023135-72023157 ATGTGTGAGTTGGGGGAAGAGGG - Intergenic
1159788873 18:72751425-72751447 AACTGGGAGCTGCAGGGAGAGGG - Intronic
1161459948 19:4390645-4390667 ATGTGTGAGCTGAAGTGTCAGGG - Intronic
1161638844 19:5406945-5406967 ATGTGTGAGCTGAGGCTTGAAGG - Intergenic
1163014053 19:14443108-14443130 ATCTGTGAGCTGCAGGGTGTTGG - Intronic
1163704464 19:18804250-18804272 CTGTGTGCGTTGCAGGGAGATGG + Intergenic
1163779448 19:19238935-19238957 ATGGATGAGCAGAAGGCAGAGGG - Intronic
1163815954 19:19464682-19464704 ATGTGTGTGCTGCAGGTACAGGG + Intronic
1165541242 19:36493365-36493387 AGGTATGAGCTGAAGGGACATGG - Intergenic
1165869087 19:38957995-38958017 ACTTGGGAGCTGAGGGGAGAAGG + Intronic
1165966982 19:39590159-39590181 ATGTCTGAGATGAAAAGAGAAGG + Intergenic
1166299265 19:41904935-41904957 CTTTGTGATCTGCAGGGAGAGGG - Exonic
1166494259 19:43287177-43287199 AAGTGTGAGCAGAAAGGAAACGG + Intergenic
1167058895 19:47131111-47131133 AGGTGTGATTTGAAGGGAGGAGG + Intronic
1167646847 19:50710654-50710676 AAGGGAGTGCTGAAGGGAGATGG - Intronic
1202714778 1_KI270714v1_random:36186-36208 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
925175680 2:1782090-1782112 ATGAGTGTCTTGAAGGGAGAAGG - Intergenic
925330395 2:3054141-3054163 ACGTGTGAGCTGAAGGAAATGGG + Intergenic
927294256 2:21435535-21435557 AAGTGTGAGCTGAACGAAGGGGG - Intergenic
930361867 2:50390746-50390768 ATGTGTGTGTTGAGGGGAGGTGG - Intronic
930550014 2:52821851-52821873 ATTTGTAAACTGAAGAGAGAAGG - Intergenic
931037273 2:58257636-58257658 AACTGTGAACTGAGGGGAGAGGG + Intergenic
931378173 2:61726955-61726977 ATGTGTGAGCTGAAGTCAGCTGG - Intergenic
933304071 2:80575948-80575970 ATTTGGGTGCTGAATGGAGAAGG - Intronic
934250972 2:90355071-90355093 ATGAATGAAATGAAGGGAGAAGG - Intergenic
934258591 2:91448339-91448361 ATGAATGAAATGAAGGGAGAAGG + Intergenic
934526395 2:95054514-95054536 ATGTCTGGGTTGAAAGGAGATGG + Intergenic
934715853 2:96542835-96542857 ATGTGTGAGCTGAGGGTAGCAGG + Intronic
934900268 2:98154420-98154442 ATGTGTGCGCTAAGGGAAGAGGG - Intronic
935713489 2:105919425-105919447 TTGTGTGAGCTGTAAGTAGAGGG + Intergenic
936637280 2:114273219-114273241 TTGTGGGAGATGAAGTGAGAAGG - Intergenic
938143393 2:128813727-128813749 ATGAGTGTGATGCAGGGAGAGGG - Intergenic
940293721 2:152101272-152101294 AACTGGGAGCTGAAGGGTGAGGG - Intergenic
941311924 2:163943851-163943873 ATATGTGAACTCAAGGGAGATGG - Intergenic
942053868 2:172164665-172164687 ATAGGGGAGCTGTAGGGAGAAGG + Intergenic
942428990 2:175889424-175889446 ATGGGTGTGCTGCAGGAAGACGG - Intergenic
942490193 2:176482250-176482272 ATGTTGGAGCTGAAAGGACAAGG - Intergenic
943020299 2:182564779-182564801 ATGAGTGAAATGAAGCGAGAAGG - Intergenic
943544464 2:189257624-189257646 ATGTGTGATATGCAGGGAAATGG + Intergenic
943797949 2:192021795-192021817 CTGTGTGAGCTGAAGTAAGGAGG + Intronic
943815813 2:192252826-192252848 ATGTGTGAGTTACAGAGAGAAGG + Intergenic
944151065 2:196559347-196559369 ATGTCTCAGCTAAAGGGAGGAGG + Intronic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
945694813 2:213089342-213089364 AGGCCTGAGCTGAAGTGAGAAGG - Intronic
945857204 2:215083051-215083073 TTGTGTGAGCTGAAAGCTGATGG + Intronic
946109622 2:217403183-217403205 AGGTGGGAGGAGAAGGGAGAGGG + Intronic
947461927 2:230310875-230310897 ACGTGTGAGGGGAAAGGAGAAGG - Intronic
947471011 2:230401087-230401109 ACGTGTGAGGGGAAAGGAGAAGG - Intronic
947541999 2:230986040-230986062 AGGTGGGAGGTGAAGGGTGAGGG + Intergenic
947546321 2:231012896-231012918 ATGAATGGGATGAAGGGAGATGG - Intronic
947671788 2:231941651-231941673 ATGTGGGGGGTGAAGAGAGAGGG + Intergenic
948644848 2:239398053-239398075 ATGGGGGAACTGAAGGGCGAAGG - Intronic
1168797185 20:619276-619298 GTGTGAGAGCTGAAAGAAGAAGG + Intergenic
1169870803 20:10246312-10246334 GTATGTGAGGTGAGGGGAGAAGG + Intronic
1172397570 20:34619907-34619929 ACATGGGAGCTGAAGGGTGAAGG - Intronic
1173134089 20:40423942-40423964 ATGTGTGTGCAGAGGGGAGGAGG - Intergenic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173575177 20:44108462-44108484 ATCTGGGGTCTGAAGGGAGAGGG + Intergenic
1173911057 20:46671279-46671301 ATGAGTGCTCTGAAGGGGGATGG - Intronic
1174431866 20:50476004-50476026 ATGAGTCAGCACAAGGGAGATGG + Intergenic
1175831765 20:61968531-61968553 AGGTGTGAGCAGAAGAGAGGCGG - Intronic
1176769381 21:13055362-13055384 GTGTGTGGGGTAAAGGGAGAAGG + Intergenic
1178327813 21:31659785-31659807 GTGTGCGTGCTGAAGGGCGACGG + Exonic
1178497785 21:33101730-33101752 AAGTGGGAGCTGAAGGGACTTGG + Intergenic
1179945054 21:44667644-44667666 ATGTGTGAGCTGAATATAGAAGG + Intronic
1182749814 22:32632535-32632557 ATCTGTGAACTAATGGGAGATGG + Intronic
1182768609 22:32776894-32776916 CTGTGTGTGCTCAAGGGATAGGG - Intronic
1183036561 22:35144922-35144944 AAGTGTGAGATGAAGGGTGTAGG - Intergenic
1183404723 22:37624856-37624878 GTGTGTGAGGGGAAGGGAAAGGG - Intronic
1183655312 22:39181024-39181046 AGGGGAGAGGTGAAGGGAGAGGG + Intergenic
1183774223 22:39952565-39952587 ATGTGTGTGCTGAGGGGGCAAGG - Intronic
1184016586 22:41790482-41790504 TTCTGGGAGCTCAAGGGAGAGGG - Intronic
1184253289 22:43273022-43273044 ATGCGTGAGCTGAAAGGTCAAGG - Intronic
1184254703 22:43280443-43280465 ATGGGTGAGGGGAAGGGACAGGG - Intronic
1185164200 22:49249598-49249620 ATCTCTGAGCTGGAGGGAGGGGG - Intergenic
949368641 3:3310460-3310482 CAGTGTGAGCTGGAGGCAGAGGG - Intergenic
950537540 3:13588402-13588424 TTGTGTGGGGTGAAGGGAAATGG + Intronic
951117934 3:18886901-18886923 ATGTGTAAGATGGAGAGAGATGG - Intergenic
951240056 3:20276472-20276494 ATGTGTGAGATGATGGAAGGGGG + Intergenic
952822849 3:37499719-37499741 TAGTATGGGCTGAAGGGAGAGGG + Intronic
952917913 3:38263462-38263484 GTGTGTGGGGTGGAGGGAGAGGG - Intergenic
953085761 3:39665167-39665189 ATGTCTTAGCTGAATGGGGAGGG + Intergenic
953273021 3:41464624-41464646 ATCTGTGAGCTGTAGATAGAAGG + Intronic
953741820 3:45545015-45545037 GTGTGTGAGCAGGAGAGAGAGGG + Intronic
954272418 3:49520187-49520209 ATGGCTGTGCTGCAGGGAGATGG - Intronic
954370850 3:50168919-50168941 ATCCCTGAGCTGAAGAGAGATGG - Intronic
954764208 3:52899009-52899031 ATGTGGGAGCAAGAGGGAGAGGG - Intergenic
955037343 3:55281968-55281990 AGGTGTGTGCTGAAGAGGGAGGG + Intergenic
955081622 3:55663119-55663141 ATGGATGAACGGAAGGGAGATGG + Intronic
955796118 3:62639038-62639060 GTTTGTGAGCTGGAGGGTGAAGG - Intronic
956489850 3:69759416-69759438 ATGTGAGAGCTGAAATGAGAAGG + Intronic
956778617 3:72587160-72587182 ATGGGGGAGCTGAAGGGAGATGG - Intergenic
956844849 3:73173180-73173202 GTATGAGAGCTGAAGCGAGAAGG - Intergenic
959466877 3:106699214-106699236 AGGTGTGACTAGAAGGGAGATGG + Intergenic
960623595 3:119659610-119659632 ATGTGTGTGGTGATGGTAGAGGG + Intronic
962169259 3:133083302-133083324 ATGTGTGAGGTGCTGGGAGGGGG - Intronic
962202743 3:133414526-133414548 AGGGGTGAGTAGAAGGGAGAGGG - Intronic
962203425 3:133417279-133417301 AGGGGTGAGCAGAAGGGAGAGGG - Intronic
962221612 3:133569091-133569113 ATGTGTGAACTGAAGGATGAGGG - Intergenic
965035305 3:163430507-163430529 ATGTATGAAATGAAGCGAGAAGG + Intergenic
965136099 3:164770662-164770684 ATGTGAGGGCGGAAGGGAAATGG - Intergenic
965626937 3:170690962-170690984 ATGTGTGTGTTGAAGGGATGGGG - Intronic
966434392 3:179867142-179867164 ATTTGGTAGTTGAAGGGAGATGG - Intronic
966762735 3:183431596-183431618 ATGGGTGAGAGGAAGGGAGAAGG - Intergenic
966902649 3:184498059-184498081 ATGAGTCAGCTTAAGTGAGATGG - Intronic
967199645 3:187060698-187060720 ATGTGAGAAGTAAAGGGAGAGGG + Intronic
968954041 4:3709125-3709147 ATGTGTGAGTGGATGGGTGAGGG - Intergenic
969475826 4:7421992-7422014 ATCTGTGAACTGAAGTGGGAGGG + Intronic
969483129 4:7457421-7457443 AGGTGTGAGCTGCAGCCAGAGGG + Intronic
970926068 4:21453787-21453809 ATGTGCTAGCTGAAAGGAGATGG - Intronic
971443388 4:26715284-26715306 ATGTGGAAGTTGAAGGTAGAAGG - Intronic
972122777 4:35726436-35726458 ATGTGTTAGTTGTAGGGAAAGGG + Intergenic
973347604 4:49073203-49073225 ATGAGTGAAATGAAGTGAGAAGG + Intergenic
974426141 4:61745130-61745152 ATGAATGAACTGAAGCGAGAAGG + Intronic
976389795 4:84496756-84496778 AAGAGTGAGATGAAGGGACACGG - Intronic
977110656 4:92949928-92949950 ATGGGTTAGCTGAGAGGAGATGG - Intronic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
979100918 4:116613043-116613065 ATGTGTGAGCTTTAGTGAGTTGG + Intergenic
981736368 4:147956499-147956521 ATTTGTGAGATCAAGGGAGTGGG + Intronic
982487617 4:155986379-155986401 AGGAGTGAGCTGGAGGGAAATGG - Intergenic
982636190 4:157899714-157899736 ATGTGTGGGCTGAGGGAGGAGGG + Intergenic
982655160 4:158139341-158139363 ATGAGTGAGCTGAGTGGAGCTGG - Intronic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
983991070 4:174120610-174120632 GTGTGTGTGGTGTAGGGAGAGGG + Intergenic
984926041 4:184807906-184807928 ATGTGTGTTCTCAGGGGAGAGGG - Intronic
985190837 4:187370926-187370948 ATGTGTCAGCTGGAGGGGAATGG + Intergenic
985755385 5:1711094-1711116 ATGAGTGAAATGAAGTGAGAAGG + Intergenic
986703301 5:10432706-10432728 ATGTATGTGATGAAAGGAGAAGG - Intronic
988405843 5:30822700-30822722 ATGAGTGAAATGAAGCGAGAAGG - Intergenic
989039877 5:37216565-37216587 ATGTGTGGAGTGAAGGGAGATGG + Intronic
989199882 5:38752589-38752611 ATGTGAGAGCAGAAGGGAAAAGG - Intergenic
989239693 5:39189659-39189681 AAGGGTGAGCTACAGGGAGAAGG + Intronic
989304235 5:39933223-39933245 ATGTGAGAGTTTAAGGCAGAAGG + Intergenic
990191318 5:53263301-53263323 ATGTGTGAGTAGAAAGCAGAGGG - Intergenic
990912034 5:60861668-60861690 ATGAGTGAAATGAAGCGAGAAGG + Intergenic
991415410 5:66387467-66387489 ATGAGTGAAATGAAGCGAGAAGG - Intergenic
992590029 5:78285287-78285309 ATGAGTGGGCTCAAGAGAGAAGG - Intronic
992755745 5:79903703-79903725 ATGAATGAAATGAAGGGAGAAGG + Intergenic
993133299 5:83926168-83926190 ATGTGTGATAGGAAGGGAGAGGG + Intergenic
993558963 5:89379641-89379663 ATGTATGAGATGAAGACAGAGGG + Intergenic
993795174 5:92258153-92258175 TTGTGTAAGCTCCAGGGAGATGG - Intergenic
994685974 5:102952865-102952887 ATGTGTGGGTTGGAGGTAGATGG - Intronic
996533081 5:124546576-124546598 ATGAGGGAGGTGAAAGGAGATGG + Intergenic
997251416 5:132391598-132391620 ATGTTTGAGGAGGAGGGAGAAGG + Intronic
997991887 5:138551386-138551408 CTGTGTGAGCTGAGTGGGGAAGG + Intergenic
998052897 5:139051185-139051207 GTGTGTGTGTTCAAGGGAGAGGG - Intronic
998388540 5:141772459-141772481 ATGTGTGGGCCGAGGGCAGAAGG + Intergenic
998887996 5:146714834-146714856 AGGTGTGAGGTCAGGGGAGAGGG - Intronic
998950208 5:147386152-147386174 ATGTGGGAACTGTAGGGAAAAGG - Exonic
999276423 5:150333685-150333707 CTGTGTGGGGTGAAGGGAGCAGG - Intronic
999505950 5:152196445-152196467 ATGGGTGAACAGAAGGGAAAGGG + Intergenic
1000410320 5:160930544-160930566 ATTTGTGAGTTAAAGGGAGGAGG - Intergenic
1001046292 5:168374553-168374575 ATGAGTGAGGAGAGGGGAGAAGG + Intronic
1001758079 5:174186067-174186089 ATGTGTCCGCTGAAGGGAGCAGG - Intronic
1001866969 5:175114196-175114218 ATGACTGAGCTGAACAGAGAAGG - Intergenic
1003459859 6:6319866-6319888 ATTGGTGAGCTGACGGGGGAAGG + Intronic
1004661810 6:17717410-17717432 GAATGTGACCTGAAGGGAGAAGG + Intergenic
1005723188 6:28622638-28622660 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1006073116 6:31511168-31511190 AAGTGTGAGGTTCAGGGAGAAGG + Intergenic
1006078236 6:31548093-31548115 ATGTCAGAGATGGAGGGAGAAGG + Intronic
1006321473 6:33322020-33322042 ATGTGTGAGGTGAAGGGATGGGG - Intronic
1006391279 6:33760333-33760355 ATGCATGACCTGAAGGGTGAGGG + Intergenic
1006986020 6:38176136-38176158 ATGTGTGAGCTGTGGGGTGCAGG + Intronic
1007693672 6:43718460-43718482 CTGTGTGTGGTGTAGGGAGATGG + Intergenic
1007774490 6:44217348-44217370 AGGTGTAAACTGAAGGGAGGGGG + Intergenic
1007825702 6:44599086-44599108 GAGGGGGAGCTGAAGGGAGAGGG - Intergenic
1008546352 6:52587134-52587156 ATGAGTGAGCAGAAGATAGATGG + Intergenic
1009494236 6:64328893-64328915 ATGTGTGAGATGCAAGCAGATGG + Intronic
1010705670 6:79106444-79106466 ATGTGGGAGCAGAAAAGAGAAGG + Intergenic
1010712582 6:79192516-79192538 ATGTCTGAGCAGAAGGTTGATGG - Intergenic
1010769272 6:79810130-79810152 CTGTGTGAGCTTAAGGCAGAAGG + Intergenic
1010921284 6:81683967-81683989 ATGTTTGAGCTGATGAGACAAGG - Intronic
1011363256 6:86550957-86550979 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1012120095 6:95355227-95355249 AGATGTGGGCTGAGGGGAGATGG + Intergenic
1012151484 6:95759664-95759686 ATGAGTGAAATGAAGTGAGAAGG + Intergenic
1013759762 6:113503578-113503600 GTGTGTGAGTTGAAGGGGGAGGG + Intergenic
1015173959 6:130286214-130286236 GTGTGTGAGATAAAGGCAGATGG - Intronic
1015811470 6:137165639-137165661 ATGTGTGAGATGCAAGCAGATGG + Intronic
1016248074 6:142011214-142011236 AAATGTGAGCTGAAAGGAAAGGG + Intergenic
1016291087 6:142528892-142528914 AAATGTGAGCTGAAGGGGGATGG - Intergenic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1016871715 6:148824572-148824594 AGGTGTGAGCTACTGGGAGATGG + Intronic
1017065516 6:150525671-150525693 ATGTGGTAGCTGAAAGGACAGGG - Intergenic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017446338 6:154510298-154510320 CTGTGGCAGCTGGAGGGAGAGGG - Exonic
1017643011 6:156512649-156512671 GTGTGTGAGCTGCAGGAATAAGG - Intergenic
1017998523 6:159556882-159556904 ATGGGTGAATTGAAGGGAGCAGG + Intergenic
1018003593 6:159600850-159600872 ATGTGGGAGCTGGAGAGGGATGG - Intergenic
1020283556 7:6663819-6663841 AGGTGGGAGGTGAAGGGGGAGGG + Intergenic
1020396932 7:7727084-7727106 AGGTGTGTGCTGAAGGCAAAGGG + Intronic
1020451331 7:8323486-8323508 GGGGGAGAGCTGAAGGGAGATGG + Intergenic
1020454228 7:8353011-8353033 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1020891366 7:13881955-13881977 ATGTTTGAGTTGAAGTGAGTGGG - Intergenic
1020925082 7:14314547-14314569 ATGAATGAAATGAAGGGAGAAGG + Intronic
1021751564 7:23806042-23806064 ATATGTGATGTGAAGGCAGAAGG - Intronic
1022321211 7:29289474-29289496 ATGAGTAAGCCGACGGGAGAGGG + Intronic
1022571601 7:31459116-31459138 ATGTGTGAGCTTAAAGGAGAAGG - Intergenic
1023281210 7:38572570-38572592 ATATCTGAGCTGAAGGGATCAGG + Intronic
1024014314 7:45297080-45297102 CAGTGTGAGCTTAAAGGAGAGGG - Intergenic
1025289818 7:57706778-57706800 ATGAGAGAGATGAAGGGAAAGGG - Intergenic
1026284890 7:68954619-68954641 ATGTGTGGGAAGAATGGAGAGGG + Intergenic
1027721228 7:81744026-81744048 AAGTGAGAGCAGAAGGGATATGG - Intronic
1027744250 7:82053869-82053891 ATGTGTGAGCTAAAAGCATATGG - Intronic
1027989096 7:85334447-85334469 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1027994598 7:85409568-85409590 ATGTTTAAGGTGAAGGGACATGG - Intergenic
1028119470 7:87041028-87041050 ATGAATGAAATGAAGGGAGAAGG + Intronic
1028686099 7:93590470-93590492 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1030173150 7:106625197-106625219 GGGTGAGACCTGAAGGGAGATGG - Intergenic
1030256009 7:107509312-107509334 ATGAATGAACTGAAGCGAGAAGG + Intronic
1031662683 7:124445767-124445789 GTGTGAGGGCTGAGGGGAGAAGG - Intergenic
1031999514 7:128255609-128255631 ATGTTTGGGCAGAAGGGAGAAGG + Exonic
1032275640 7:130452964-130452986 ATATGTGAGCAGAAGGGGGGTGG + Intergenic
1032489012 7:132309937-132309959 ATCTGGGATGTGAAGGGAGAGGG - Intronic
1034219084 7:149430758-149430780 AAGAGAGAGCTGGAGGGAGATGG + Intergenic
1034904618 7:154933247-154933269 ATGTGTGAACTGATGGTGGAGGG - Intronic
1035617510 8:1013023-1013045 ATCTGTGAGCTGCAGGAAGAAGG - Intergenic
1035866128 8:3084073-3084095 ATCTGTGAGTGGATGGGAGAAGG + Intronic
1036174825 8:6527406-6527428 ATGAGGGAGGAGAAGGGAGAGGG - Intronic
1036610467 8:10345473-10345495 ATGTGTGTGCTGAAGTCAGGTGG - Intronic
1037232147 8:16671390-16671412 ATGAGTGAAATGAAGTGAGAAGG + Intergenic
1037383396 8:18312179-18312201 ATGTGTTTGCTGAGGGGAAAGGG + Intergenic
1037542885 8:19889274-19889296 ATGTGTAAGGGGAAAGGAGAAGG + Intergenic
1037617440 8:20532118-20532140 AAGTGTGTGCTGCACGGAGAGGG + Intergenic
1037627723 8:20622625-20622647 ATGAGTGAGAGGATGGGAGATGG + Intergenic
1037727436 8:21494661-21494683 ATGTGGATGCTGAAGAGAGAAGG - Intergenic
1038049825 8:23798146-23798168 ATGTATGAGCTGAATTGAAAGGG + Intergenic
1038276109 8:26122237-26122259 CTGTGTGTGCTGGAGGGACATGG - Intergenic
1038435406 8:27532206-27532228 ATGTGGGGGCTGAGGGGAGAGGG - Intronic
1038474630 8:27856537-27856559 AAGTGGGAGCCGACGGGAGAGGG - Intergenic
1038770415 8:30473870-30473892 AAGTGGGAGCTGAAGGATGAGGG + Intronic
1039789495 8:40863428-40863450 ATGAGGTAGCTAAAGGGAGAAGG + Intronic
1040920823 8:52614636-52614658 ATGTGTGAGCTACACTGAGAGGG + Intergenic
1041148233 8:54902686-54902708 ATGTGAGAAATGGAGGGAGAGGG + Intergenic
1041351019 8:56947653-56947675 GTGTGTGTGTTGCAGGGAGAGGG - Intergenic
1042001965 8:64134237-64134259 ATGTGTGAGCAGAATGGCCACGG + Intergenic
1042205768 8:66328197-66328219 ATGTGTGAGCTTAAGCCAAAAGG - Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042693968 8:71535221-71535243 ATTTGTGAGCAGAAGAGAAAGGG - Intronic
1042780045 8:72480710-72480732 ATGAGTGAAATGAAGCGAGAAGG + Intergenic
1042914293 8:73859898-73859920 CTGTGTGTGCTTAGGGGAGATGG - Intronic
1042974011 8:74444255-74444277 ATGTGTCAGCAGCAGGGAAAAGG - Intronic
1043324233 8:79030395-79030417 ATGTGTCAGCTAAAGGTAAAGGG - Intergenic
1044299238 8:90564663-90564685 ATGTGTGATCTGAACGTGGAGGG + Intergenic
1044403122 8:91794831-91794853 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1044409925 8:91870790-91870812 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1044448064 8:92301452-92301474 ATGTGAGAGCTGAAATGAGAAGG - Intergenic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1044931693 8:97258017-97258039 ATGTGTAAACTGTAGGGGGAGGG - Intergenic
1045077682 8:98588824-98588846 ATGAGTGAAATGAAGCGAGAAGG - Intronic
1045093762 8:98775351-98775373 ATGTCAGAGCTGAAGGGGGCTGG - Intronic
1046153875 8:110262346-110262368 ATTTGTAAAATGAAGGGAGAAGG - Intergenic
1048718950 8:137300209-137300231 ATGTGTGCTGTGAAAGGAGATGG + Intergenic
1049327463 8:142030525-142030547 ATGTGTGTGCTCCAGGGAGCAGG + Intergenic
1049386547 8:142345640-142345662 AGGTGGGAGCTGCAGGGAGGAGG - Intronic
1050263593 9:3866854-3866876 ATGTGTGAGCTGGTGGGATGAGG + Intronic
1052466980 9:28840845-28840867 ATGTATGAGATGAAGGTAAAGGG - Intergenic
1053420622 9:37975285-37975307 ATGTGTGAGCTGGTGGGAACTGG - Intronic
1054812888 9:69448667-69448689 ATGTGTGAGAGAGAGGGAGAAGG - Intronic
1056018024 9:82411923-82411945 ATGTGTGAGCTGGAGGGGTCAGG - Intergenic
1056178773 9:84061512-84061534 ATGACAGAGGTGAAGGGAGAGGG + Intergenic
1057220971 9:93257526-93257548 ATGGGTAAGCTGAGGGCAGATGG - Intronic
1057461021 9:95262004-95262026 ATGTGTGAGAAGAAGGGCAATGG - Intronic
1057975882 9:99605769-99605791 ATTTGTAAGCTGAACAGAGAAGG - Intergenic
1058137671 9:101325375-101325397 ATGGGTAGGCTGAAGGTAGAGGG - Intergenic
1058204244 9:102083394-102083416 ATCTGTGATCTGATGAGAGATGG - Intergenic
1059621308 9:116008575-116008597 ATGTGTGGGATGAATGGAGAAGG + Intergenic
1060270628 9:122138360-122138382 GTCTGTGAACTGAAGGGAGATGG - Intergenic
1060289930 9:122292555-122292577 GTGTGTGAAATGCAGGGAGAGGG + Intronic
1060320266 9:122552593-122552615 ATATGTGAGCTGAGGGCAGTAGG - Intergenic
1061834697 9:133321171-133321193 ATTTGTGGGCTGGTGGGAGAGGG - Intergenic
1185559376 X:1047524-1047546 TTATGTGAGCAGAAGGAAGATGG - Intergenic
1186336513 X:8595483-8595505 AAGTGGGAGCTAAAGGAAGATGG + Intronic
1186532219 X:10308901-10308923 ATGTGTGTGGTGAGGGGAGGGGG - Intergenic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1188734462 X:33695667-33695689 ATGTGTGTATTGAAGGGAGGAGG - Intergenic
1189169750 X:38897716-38897738 ATGTGTGAGGAGGAAGGAGAAGG - Intergenic
1189219625 X:39360203-39360225 ATCTCTCAGATGAAGGGAGAGGG + Intergenic
1189364204 X:40375678-40375700 ATCTGTGAAGTGAAGGGATAGGG - Intergenic
1189398874 X:40647103-40647125 AGGTGTGCGCTGAATGGAAAAGG - Exonic
1189474131 X:41335467-41335489 ATGTGTGATTTGAGAGGAGAAGG + Intronic
1189773924 X:44453128-44453150 ATGTGTGGAATGAAGGGAAAAGG - Intergenic
1190185319 X:48228607-48228629 ACGTGTGGGCTGTAAGGAGATGG + Intronic
1190704150 X:53012076-53012098 GATTGAGAGCTGAAGGGAGAGGG - Intergenic
1191047104 X:56150197-56150219 ATGGGTGAACAGAAAGGAGAAGG + Intergenic
1192053275 X:67746576-67746598 ATGATTGAGGTGAAGGCAGAAGG - Intergenic
1192286371 X:69742314-69742336 GGCTGTGAGCTGGAGGGAGATGG + Intronic
1194641937 X:96413082-96413104 CTTTGTGAGCTAAAGGGAGAGGG + Intergenic
1196870564 X:120109465-120109487 AAGGGTGAGCTGAAGGGCCACGG - Intronic
1197008791 X:121535932-121535954 ATGAGTGAAATGAAGCGAGAAGG - Intergenic
1197994233 X:132354823-132354845 ATGTGTAAGCAGAAAGGAAAGGG + Intergenic
1199001758 X:142647234-142647256 ATGTGTGTACAGCAGGGAGAAGG - Intergenic
1199322232 X:146454048-146454070 ATGTGTTATATGAAGGCAGAGGG - Intergenic
1200234056 X:154459792-154459814 ACGCCTGAGCTGAGGGGAGAGGG - Intronic
1200651922 Y:5849691-5849713 AAGTGTGTGCTGAAGGTAAAGGG + Intergenic
1201519998 Y:14862504-14862526 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1201779965 Y:17709763-17709785 ATGAATGAAATGAAGGGAGAAGG + Intergenic
1201821590 Y:18196229-18196251 ATGAATGAAATGAAGGGAGAAGG - Intergenic
1202163648 Y:21963260-21963282 ATGAGAGAGATGAGGGGAGAGGG - Intergenic
1202227708 Y:22623105-22623127 ATGAGAGAGATGAGGGGAGAGGG + Intergenic
1202315449 Y:23573073-23573095 ATGAGAGAGATGAGGGGAGAGGG - Intergenic
1202555352 Y:26097524-26097546 ATGAGAGAGATGAGGGGAGAGGG + Intergenic