ID: 1091002692

View in Genome Browser
Species Human (GRCh38)
Location 11:131923837-131923859
Sequence CTGGGGATGGGAGGAGGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1473
Summary {0: 1, 1: 0, 2: 14, 3: 153, 4: 1305}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091002692_1091002703 2 Left 1091002692 11:131923837-131923859 CCCGACCCTCCTCCCATCCCCAG 0: 1
1: 0
2: 14
3: 153
4: 1305
Right 1091002703 11:131923862-131923884 TCAAATGCTGGCTCAGCCACTGG 0: 1
1: 0
2: 7
3: 36
4: 213
1091002692_1091002704 3 Left 1091002692 11:131923837-131923859 CCCGACCCTCCTCCCATCCCCAG 0: 1
1: 0
2: 14
3: 153
4: 1305
Right 1091002704 11:131923863-131923885 CAAATGCTGGCTCAGCCACTGGG 0: 1
1: 0
2: 5
3: 43
4: 219
1091002692_1091002707 24 Left 1091002692 11:131923837-131923859 CCCGACCCTCCTCCCATCCCCAG 0: 1
1: 0
2: 14
3: 153
4: 1305
Right 1091002707 11:131923884-131923906 GGTATATGACCTTTGGCACATGG 0: 1
1: 0
2: 0
3: 4
4: 205
1091002692_1091002699 -10 Left 1091002692 11:131923837-131923859 CCCGACCCTCCTCCCATCCCCAG 0: 1
1: 0
2: 14
3: 153
4: 1305
Right 1091002699 11:131923850-131923872 CCATCCCCAGTTTCAAATGCTGG 0: 1
1: 0
2: 1
3: 15
4: 152
1091002692_1091002705 17 Left 1091002692 11:131923837-131923859 CCCGACCCTCCTCCCATCCCCAG 0: 1
1: 0
2: 14
3: 153
4: 1305
Right 1091002705 11:131923877-131923899 GCCACTGGGTATATGACCTTTGG 0: 1
1: 0
2: 1
3: 35
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091002692 Original CRISPR CTGGGGATGGGAGGAGGGTC GGG (reversed) Intronic
900035300 1:402700-402722 CTGGGGAAGGGAGCTGGGGCTGG + Intergenic
900056921 1:638453-638475 CTGGGGAAGGGAGCTGGGGCTGG + Intergenic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900122765 1:1055962-1055984 GTGGGGATGGGATGGGGGTGGGG - Exonic
900316636 1:2060381-2060403 CTGGGGGTGGGAGCAGATTCAGG + Intronic
900334361 1:2154190-2154212 CTGGAGATGGGAGGAGATGCGGG + Intronic
900388043 1:2419548-2419570 CTGGGGATGTGAGGCCGGTGAGG + Intergenic
900395963 1:2453372-2453394 CTGGGGATGGCAGGCGGTGCAGG + Intronic
900503380 1:3017307-3017329 CCGGGGATGGGAGGTGGGTGGGG + Intergenic
900538323 1:3190104-3190126 CTGGGGATGAGAGATGGGGCGGG + Intronic
900540006 1:3197839-3197861 CTGGGTCAGGGACGAGGGTCAGG + Intronic
900551307 1:3257312-3257334 CTGGGGTTGGGTGGAGCATCAGG + Intronic
900586896 1:3436997-3437019 CTGGGGATGAGAGCAGGAACGGG - Exonic
900700799 1:4047543-4047565 ATGGGGAAGGGAGGAGGGGGAGG + Intergenic
900734319 1:4286171-4286193 TGGGGGCTGGGAGGAGGGTGAGG - Intergenic
900870122 1:5296391-5296413 CTGTGCATGGGAGGAGGCTGCGG + Intergenic
901044101 1:6385378-6385400 TTGGGGAGGGTAGTAGGGTCGGG - Intronic
901082189 1:6589706-6589728 CTGGGGGTCTGAGGAGGGTGGGG + Intergenic
901234986 1:7662911-7662933 TTGGGGAGGGGAGGTGGGGCAGG + Intronic
901506973 1:9690844-9690866 CTGGGGTTGGGAGAAGGGGTTGG + Intronic
901662598 1:10807985-10808007 CTGGGGCTGGGAGGTGGGGAAGG - Intergenic
901784761 1:11617262-11617284 GTGGGGAGGGGAGCAGGGTGTGG - Intergenic
902129446 1:14246182-14246204 TTGGGGATGGGAGGAGCATCAGG + Intergenic
902190583 1:14760180-14760202 ATGGGGGTGGGAAGAGGGTTGGG - Intronic
902298696 1:15486091-15486113 CTGGGGATGGGAAGAGGCTATGG + Intronic
902592237 1:17483302-17483324 CTGGAGGCGGGAGGAGGGGCAGG + Intergenic
902830795 1:19010964-19010986 CTGGGGATGGCTGGAGAGACGGG + Intergenic
903142542 1:21347594-21347616 ATGGTGAAGGGGGGAGGGTCTGG + Intergenic
903325856 1:22568163-22568185 CTAAGGGTGGGATGAGGGTCAGG - Intronic
903386503 1:22930435-22930457 TGGGGGATGGGAGGCGGGGCAGG + Intergenic
903474020 1:23607206-23607228 CTGGGGTTGGGGGCAAGGTCAGG - Intronic
903535490 1:24063675-24063697 TTGGGGATAGGAGGGGGTTCAGG + Intronic
903636229 1:24819243-24819265 CTGGGGATGAAAGGAAGGTTAGG - Intronic
903676628 1:25068478-25068500 CTGGGGATCAGGGAAGGGTCGGG + Intergenic
904325838 1:29727212-29727234 CTGGGGAGGGGTGGAGGGAAGGG + Intergenic
904325851 1:29727239-29727261 CTGGGGAGGGGTGGAGGGAAGGG + Intergenic
904359849 1:29964170-29964192 ATGGGGTTGGGAGGAGGGAGAGG + Intergenic
904384284 1:30131430-30131452 CAGGGGATGGGAGGAGAGAGAGG + Intergenic
904403397 1:30271542-30271564 CTGGTGTTGGGTGGAGGGTGGGG + Intergenic
904421690 1:30398372-30398394 CTGGGGATTGAAGGAGAGTGAGG + Intergenic
904421727 1:30398479-30398501 CTGGGGATTGAAGGAGAGTGAGG + Intergenic
904431822 1:30469227-30469249 CAGGAGTTGGGAGGAGGTTCTGG - Intergenic
904481199 1:30794602-30794624 CTGGGAATGGGAGTAGGGGAAGG + Intergenic
904564104 1:31417195-31417217 TGGGGGAAGGGAGGAGAGTCAGG - Intronic
904873507 1:33636267-33636289 CTGGGGAAGGGAGGGGGGCAAGG - Intronic
905271032 1:36787535-36787557 CTGGGGATTGCAGGAAGTTCTGG + Intergenic
905301850 1:36990982-36991004 GTGGGGAAGTGAGGATGGTCAGG - Intronic
905313983 1:37069458-37069480 CTGGGGATGTGAGGATGGCCAGG + Intergenic
905389337 1:37626223-37626245 CTGGGGCTGAGGGGAGGGTCCGG - Intronic
905442856 1:38005741-38005763 CTGGGGATGGGGGGTGGGAGGGG - Intergenic
905587956 1:39136374-39136396 CTGGACATGGGTGGAGGGTGAGG + Intronic
905806576 1:40881613-40881635 CTGGGGATTTGAGGAGCATCAGG - Intergenic
905807696 1:40888754-40888776 CTGGGTAGGGGAGGAAGGTGAGG - Intergenic
905856745 1:41319572-41319594 CTGGGGATGCCAAGAGGGTGGGG + Intergenic
905863543 1:41365183-41365205 CTGGGGATGGGGGTAGGGAAAGG + Intronic
906110483 1:43318938-43318960 CAGGGGATGGGAAGAGGGAGGGG + Intronic
906509132 1:46401005-46401027 CAGGGGAGGGGAGGAGGGAAAGG + Intronic
906726667 1:48049181-48049203 CTGAGGAGGGCAGGAGGGGCTGG + Intergenic
906745829 1:48221533-48221555 CTGGGGATGGGGTGTGGGACAGG + Intergenic
906793949 1:48681803-48681825 CTGGGGAGTGGGGGAGGGCCTGG + Intronic
907118611 1:51990276-51990298 CTGGGGCTGGGAGGAGAGATGGG - Intronic
907312032 1:53544318-53544340 CTGGAGATGGGAGAAGGGGAAGG + Intronic
907795383 1:57710920-57710942 TTGGGGCAGGCAGGAGGGTCAGG + Intronic
908253542 1:62284107-62284129 CTGGGGGTGGGAGTCGGGGCTGG - Intronic
908355111 1:63320774-63320796 CTGAGGCTGGGAGCAGGGTAGGG - Intergenic
908391571 1:63688137-63688159 CTGGGGAAGGGTTGAGGGTCAGG + Intergenic
908574901 1:65449356-65449378 CTGGGGATGGGCTGAGGGCAAGG + Intronic
908880581 1:68727279-68727301 CTGGAGATGGGAGGAGGGAGAGG - Intergenic
908926790 1:69265475-69265497 CAGAGGATGGGAGGAGGGAGAGG - Intergenic
910622639 1:89273476-89273498 CGGGAGAGGGGAGGAGGCTCAGG + Intergenic
910632908 1:89374925-89374947 CTGGGGATTAGGGGAGGGTGTGG - Intronic
911769675 1:101724397-101724419 CGGGGGAAGGGAGGAGGATGTGG + Intergenic
912016902 1:105050168-105050190 CTGGGGAGGGGAGGAGGGAAGGG - Intergenic
912379994 1:109242191-109242213 CTGGAGATGTGGGCAGGGTCAGG + Intergenic
912803815 1:112740254-112740276 CTGGGGCTTTGGGGAGGGTCAGG + Intergenic
913133485 1:115864145-115864167 CTGGGGATATGCTGAGGGTCGGG - Intergenic
913269020 1:117074671-117074693 CTGGAGAGGGGAGGAGGGCATGG + Intronic
913366009 1:118039642-118039664 TTGAGGGTGGGAGGAGGGTGAGG + Intronic
914808648 1:151010050-151010072 CTGGGGGTCGGGGGAGGCTCTGG - Intronic
915363023 1:155297210-155297232 CTGGGTTTGGGAGAAAGGTCTGG - Intronic
915455949 1:156040918-156040940 CAGGGGCTGGCAGGAGGGGCAGG - Intronic
915506003 1:156356955-156356977 CTGGGGGAGGGAGCAGGGTGGGG - Intronic
915526308 1:156478399-156478421 CTGGGAATGGCAGGAATGTCAGG + Intronic
915548818 1:156619811-156619833 CTGGGGTTGGGATGAGGGCTGGG - Intronic
916047687 1:161013073-161013095 TAGAGGATGGGAGGAGGGTGAGG - Intronic
916090416 1:161304668-161304690 TTGGGGATGGGATAAGGGGCAGG + Intergenic
916913053 1:169372602-169372624 CAAGGGATGGGAGGAGGATGAGG + Intronic
917139909 1:171825428-171825450 CTGGGAATAGTAGGAGGGTAAGG + Intergenic
917887287 1:179398864-179398886 CAGGGGTTGGGGGGAGGGTGTGG + Intronic
917925261 1:179784201-179784223 CTGGTGAAGGCAGGAGGTTCTGG - Intronic
918042028 1:180919357-180919379 CTGGGGACCAGAGGAGGGTCTGG - Intronic
918131061 1:181630112-181630134 ATGGGAATGGGGGGAGGGTGGGG + Intronic
918245730 1:182657500-182657522 CTTGGGGAGGGAGCAGGGTCTGG - Intronic
918264688 1:182831053-182831075 CTGGGGATGGTTGGAGGGACAGG + Intergenic
918374041 1:183890801-183890823 CTGGGACTGGGAGGACGGTAGGG + Intronic
918417165 1:184322460-184322482 CTGGGGATGGGGGGAGGTGGCGG - Intergenic
918449124 1:184642017-184642039 CTGCTTATGGGAGGAGGGACTGG - Intergenic
919221640 1:194638268-194638290 CGGAGGGTGGGAGGAGGGTGAGG - Intergenic
919274989 1:195402185-195402207 CTGGGAAAGGTAGGAAGGTCTGG + Intergenic
919830218 1:201535613-201535635 CTGGGGTGGGGAGGTGGGGCGGG + Intergenic
919834921 1:201567049-201567071 CTGGGGATGGGGGGTGGGAGGGG - Intergenic
919847609 1:201651387-201651409 AGGGAGATGGGAGGAGGGGCAGG + Intronic
919919731 1:202160799-202160821 CTGGGGAAAGCAGGATGGTCGGG - Exonic
920061495 1:203229756-203229778 GGGGGGATGGGAGCAGGGTGGGG + Intronic
920131731 1:203737182-203737204 CTGGGGTTGGAGTGAGGGTCTGG - Intronic
920150842 1:203906090-203906112 CTGGGGAGGGGAGTAGGGAGAGG + Intergenic
920206538 1:204296430-204296452 CAGGGCATTGGAGGAGGGTAGGG - Intronic
920255549 1:204651926-204651948 CTGGGGAAGGGAGTTGGGCCAGG - Intronic
920291040 1:204923383-204923405 CTGGGGATGGCGGGAGGGAAGGG - Intronic
920324591 1:205153012-205153034 CTGGGGTCAGGAGGAGAGTCAGG - Intronic
920494682 1:206446309-206446331 CTTGGGACGGGAGGAGGGGAGGG + Intronic
920528556 1:206685522-206685544 CCGGGGAGGGGAGGCGGGGCCGG + Intronic
920950166 1:210565057-210565079 CTGGAGATGGGAGGTGGGAAGGG + Intronic
921670321 1:217917564-217917586 CTGGGGAAAGGTGGAGTGTCAGG + Intergenic
922187092 1:223285306-223285328 CTGGGGATGGGGCCAGGTTCTGG + Intronic
922257830 1:223908260-223908282 CTGGGGAAGGGAGCTGGGGCTGG + Intergenic
922485848 1:225972553-225972575 CAAGGGGTGGGAGGAGGCTCAGG + Intergenic
922494786 1:226048048-226048070 CTGGGGAAGGGGAGAGGCTCTGG - Intergenic
922516090 1:226209347-226209369 CTGGGGGTGCGGGGAGAGTCTGG + Intergenic
922930464 1:229385242-229385264 CTGGGGATGTGTGGAGACTCTGG + Intergenic
923030187 1:230243437-230243459 CGGGGGCTGGGAGGGGTGTCAGG + Intronic
923070211 1:230557353-230557375 CTGGGGATGGGAGGGAGGTCAGG + Intergenic
924106303 1:240652779-240652801 CTGGTGATCGGAGTAGGGACAGG + Intergenic
924339028 1:243011039-243011061 CTGGGGAAGGGAGCTGGGGCTGG + Intergenic
924473900 1:244367071-244367093 CAGGGGGTGGGAGAAGGGTGCGG + Intronic
924610213 1:245567455-245567477 CTGGGGATGGGAGGGGTGAAGGG - Intronic
924735706 1:246753876-246753898 ATGGGGATAGGAGAAGGGTCTGG + Intronic
924741008 1:246794156-246794178 CAGGGGAAGGCAGGAGGGTGGGG + Intergenic
924784896 1:247185428-247185450 CTGGGGCTCGGAGGCGGGGCAGG + Intergenic
1062982505 10:1737116-1737138 CTGGGGAGCGGCAGAGGGTCTGG - Exonic
1063086040 10:2818442-2818464 CTGTGCATGGGAGGTGGGGCAGG + Intergenic
1063133416 10:3197119-3197141 CCGGGGTGGGGAGGGGGGTCTGG + Intergenic
1063401628 10:5751998-5752020 CTGGGGTTGGGAGGAGGATGGGG - Intronic
1063517597 10:6712189-6712211 GCGGGGAGGGGAGGAGGGTGCGG + Intergenic
1063589120 10:7378674-7378696 GTGTGGATGGGTGGATGGTCGGG + Intronic
1063892035 10:10640459-10640481 CTGGTGGTGGGAGGAGGGGAAGG - Intergenic
1064167218 10:12996926-12996948 GTGAGGGTGGGAGGAGGGTGAGG + Intronic
1064191780 10:13212790-13212812 CTGGGGCTGGGAAGAGGTACAGG - Intergenic
1064339330 10:14472534-14472556 CTGGGGTTGAGTGGAGGGGCTGG - Intergenic
1064619470 10:17201154-17201176 CTGGGGAGGGAGGGAGTGTCAGG - Intronic
1064632972 10:17336491-17336513 CTGGGGCTTGGCGGAGGGTCGGG - Intronic
1064748634 10:18502811-18502833 TGGAGGATGGGAGGAGGGTGAGG + Intronic
1065063473 10:21933139-21933161 TTGGGGATGTGAGGGGGATCTGG + Intronic
1065372568 10:25003813-25003835 CTGGGGGTGGAAGGAGGGAGAGG - Intronic
1065493647 10:26307630-26307652 CTGAGGAAGGGAGCAGGCTCTGG + Intergenic
1066003383 10:31125299-31125321 TTGGGGATGGGAGGAAAGTGGGG + Intergenic
1066021192 10:31304167-31304189 ATGGGGAGGGGAGGAGAGTGGGG + Intergenic
1066031102 10:31426304-31426326 ATGGGGGTGGGATGAGGGTAGGG - Intronic
1066124515 10:32327296-32327318 CTGGGGATATCAGGAGGGACGGG + Intronic
1066221988 10:33344311-33344333 ATGGGGATGGGAGCACTGTCAGG + Intergenic
1066317021 10:34258273-34258295 CTGGAGATGGGAGAGGGGTCAGG + Intronic
1066359636 10:34717724-34717746 CTGGGGATGGCAGGATGGCATGG + Intronic
1066453031 10:35548677-35548699 CTGAGGAGGGGAGGAGGGGTTGG + Intronic
1066460540 10:35608561-35608583 CTGGAGCTGGCAGGCGGGTCAGG - Exonic
1066561674 10:36676376-36676398 TTTGGGGTGGGAGGAGGGTCTGG + Intergenic
1067023954 10:42827435-42827457 CTGAGGATGGAAGAAGGGTGTGG + Intronic
1067077141 10:43194447-43194469 CTGGGGCAGGGAGGAGGGTGAGG - Intergenic
1067157018 10:43790716-43790738 CTGGGGAAGGGGGAATGGTCAGG + Intergenic
1067160281 10:43819578-43819600 CTGGGGCCAGGGGGAGGGTCTGG + Intergenic
1067217725 10:44316671-44316693 CTAGGGTTGGTGGGAGGGTCTGG - Intergenic
1067258138 10:44663024-44663046 GTGAGGACGGGGGGAGGGTCGGG + Intergenic
1067346455 10:45441974-45441996 CTGGGGAAAGGAGGAAGGTTGGG - Intronic
1067758507 10:49025491-49025513 CTGGGGATGGGAGGTGTGTGTGG - Intronic
1067830558 10:49609329-49609351 CCGGGGCTTGGAGGAGGCTCTGG + Intronic
1068116977 10:52746512-52746534 CTGAGGATAGCAGGAGGGCCAGG - Intergenic
1068397678 10:56485479-56485501 TGGAGGATGGGAGGAGGGTGAGG - Intergenic
1068445094 10:57110496-57110518 CTGGGAAAGGGAGTGGGGTCTGG + Intergenic
1068523431 10:58102684-58102706 CTGGGGATTGTAGGGGGGGCAGG + Intergenic
1069215323 10:65812186-65812208 CTACGGATGGGGGGAGGCTCAGG + Intergenic
1069642693 10:69966071-69966093 CTGGGAAGGGCAGGAGGGTTGGG - Intergenic
1069719701 10:70541566-70541588 CTTGGGATGGGAGGAGGAGGAGG + Intronic
1069724901 10:70571361-70571383 ATGGGGGTGGGGGTAGGGTCAGG - Intergenic
1069840144 10:71334749-71334771 ATGGGGATGGGGGGAGGCTGGGG - Intronic
1069872977 10:71544438-71544460 CTGGCGATGGGAGTAGGCTGGGG + Intronic
1070515636 10:77203435-77203457 CTCTGGGTGGGAGGAGGATCAGG - Intronic
1070660588 10:78302979-78303001 ATGAGAATGGGAGGAGGGGCAGG + Intergenic
1070751963 10:78969170-78969192 ATTGGGGTGGGAGGTGGGTCTGG - Intergenic
1070808643 10:79286214-79286236 GCTGGGATGGGAGGAGGGTCTGG - Intronic
1070831821 10:79422422-79422444 CTGGGGAGGGGTGCAGGGGCTGG + Intronic
1071316864 10:84409901-84409923 CAGGGGGTGGGAGGAGGGATTGG - Intronic
1071476408 10:86029074-86029096 CTGGAGATGAGAGGAGAGGCTGG - Intronic
1071820222 10:89272234-89272256 CAGGGGGTGGGAGGAGGGAGAGG - Intronic
1072079228 10:92012130-92012152 CAGGGGAGGGGAGGAGGGGATGG - Intronic
1072161649 10:92772197-92772219 CTGGGGAGGGATGGAGGGTTGGG + Intergenic
1072312772 10:94172193-94172215 CTGGGATAGGGAGGAGCGTCAGG + Intronic
1072520600 10:96226959-96226981 CTAGGCATGGGAGGAAGGTGAGG + Intronic
1072693024 10:97584054-97584076 CTGGAGATGTGAGAAGGGGCAGG - Intergenic
1073290703 10:102411953-102411975 GGGGTGATGGGTGGAGGGTCAGG - Intronic
1073328455 10:102656174-102656196 CTGGGGAGGGCAGGGGGGCCAGG + Intronic
1073391759 10:103183679-103183701 GTGGGGGTGGGAGGAGGGTGAGG + Intronic
1073433049 10:103499319-103499341 CTGGGGATGAGAGCAGGGGCAGG + Intronic
1073462459 10:103673902-103673924 CTGGGGAGGGGAGGGGTGACAGG + Intronic
1074357583 10:112799677-112799699 CTTAGGCTGGGAGGAGGGTGGGG - Intronic
1074375901 10:112940523-112940545 CTGGGGGAGTGAGGAGGGTCTGG + Intergenic
1074504868 10:114060588-114060610 CAGGGGCTGGGAGGAGGGGGAGG + Intergenic
1074580199 10:114711834-114711856 CTGAGGGTGGGAGGAGAGTGTGG - Intergenic
1074644453 10:115430642-115430664 TTGTGGATTGGAGGAGGGTGAGG - Intronic
1074814077 10:117131701-117131723 CTTGGGAAGCGAGGAGGGCCGGG - Intronic
1074898391 10:117796205-117796227 CTGGGGAAGGGATGAGGGGTGGG + Intergenic
1074899532 10:117804339-117804361 CTGGGGATCGGGGGAGGGGTGGG - Intergenic
1074943118 10:118254240-118254262 CTGGGGAGGGGAGGGGAGACAGG + Intergenic
1075008024 10:118844228-118844250 CTGGGGTGGGGGGGCGGGTCTGG + Intergenic
1075358175 10:121802689-121802711 CTGGGGATGGGAGCAGTGGGTGG - Intronic
1075528968 10:123210965-123210987 TGGGGGGTGGGAGGAGGGACAGG - Intergenic
1075572875 10:123558321-123558343 CTGGGGGTGGAGGGAGAGTCAGG - Intergenic
1075646854 10:124102472-124102494 CTGGGGATGGCGGGAGGGGCAGG - Intergenic
1075663760 10:124216461-124216483 CTGGGGAGGGGTGGCGGGGCAGG - Intergenic
1075943981 10:126416611-126416633 CTGGGGGTGGGAGGAGGAAGAGG + Intergenic
1076059254 10:127400772-127400794 CTGGGGGTGGGAGGTGGGTGAGG - Intronic
1076325454 10:129617117-129617139 TTGAGGGTGGGAGGAGGGTGAGG - Intronic
1076384337 10:130045987-130046009 CTGGGCATGGGAGGTGGGGCTGG + Intergenic
1076412746 10:130263686-130263708 CCAGGGAGGGGTGGAGGGTCAGG + Intergenic
1076442960 10:130492819-130492841 CTGGGCATGGGATGCAGGTCTGG + Intergenic
1076572099 10:131439606-131439628 CTGGGGATGGAAGCAGACTCTGG + Intergenic
1076745710 10:132512552-132512574 TTGGGGATGAGAGGAGGGCTCGG - Intergenic
1076745730 10:132512626-132512648 TTGGGGATGAGAGGAGGGCTCGG - Intergenic
1076878559 10:133229282-133229304 TTGGGGATGGGCTGAGGGGCCGG + Intergenic
1076981068 11:205056-205078 CTGGGGGAGGGGGGAGGGGCTGG + Exonic
1077170116 11:1162328-1162350 CTGGGGATCCCAGGAGGGGCAGG - Intronic
1077358276 11:2128532-2128554 CTGAGCATGGGAGGAGGGGTAGG - Intergenic
1077406628 11:2385339-2385361 CTGGGACGGGGAGGAGGGGCAGG - Intronic
1077582115 11:3423211-3423233 CAGGGACTGGGAGGCGGGTCGGG + Intergenic
1077746521 11:4913244-4913266 CTGGTGTTGGGAGCAGGGACAGG + Intronic
1077976289 11:7251939-7251961 CTGGGGAGGGACGGAGGGACCGG + Exonic
1078268108 11:9770077-9770099 CTGGGGGTGAGAGGAGGGGGAGG - Intergenic
1078662988 11:13302109-13302131 GTGGGGATGGGAGGAGGGTTTGG + Intronic
1078895677 11:15594886-15594908 CTGGGGCTGGCAGGAAGCTCGGG - Intergenic
1079163639 11:18016362-18016384 GTAGGGATGGGAGGAGGGAATGG + Intergenic
1079466587 11:20736724-20736746 AGGGGGAGGGGAGGAGGGTAGGG - Intronic
1079479035 11:20861633-20861655 CTGGGTTTGTGATGAGGGTCAGG + Intronic
1081206410 11:40280814-40280836 CTGTGGATGGAAGCAGGGTTGGG - Intronic
1081460325 11:43266948-43266970 CTGGGGGTGGTAGGAGGAGCTGG - Intergenic
1081570826 11:44289827-44289849 TTGGGGATGGGACGAGGAGCCGG - Intronic
1081641820 11:44761186-44761208 CTGGGGCTGGGAGGGTTGTCGGG + Intronic
1081673349 11:44954170-44954192 GTGGGGATGGGAGTGGGGTTGGG + Intergenic
1081906538 11:46673923-46673945 CTGAGGATTGGAGCAGGCTCTGG + Intronic
1081938315 11:46919378-46919400 CTGGGGCTGGAAGGAGGCTGAGG - Intergenic
1081967625 11:47179118-47179140 GTGGGGATGGGAGGTGGGATGGG - Intronic
1082028148 11:47587402-47587424 ATAGGGAGGGGAGGAGGGTGGGG + Intronic
1082795552 11:57376154-57376176 GTGGGGATGGGAGTAGGGTTGGG - Intergenic
1083095025 11:60241863-60241885 CCGGGGTGGGGAGGAGGGGCGGG - Intronic
1083114754 11:60449773-60449795 TGGAGGATGGGAGGAGGGTGAGG + Intronic
1083327355 11:61879576-61879598 CTGGCGATGGGAGGAGCGGCTGG - Intronic
1083333327 11:61909189-61909211 CTGGGGATGGGGGGCTGGGCGGG + Intronic
1083430930 11:62613143-62613165 CTGAGGATGGGAGGATGCTCAGG + Exonic
1083617785 11:64035181-64035203 CTGGGGATGGGAGGGGGCGCTGG + Intronic
1083621703 11:64052516-64052538 CTGAGGTTGGCAGGATGGTCAGG + Intronic
1083799758 11:65039834-65039856 CTGGGGAGAGGAGAAGGGGCTGG - Exonic
1083904321 11:65660258-65660280 CTGGGCAAGGCAGGAAGGTCTGG - Intronic
1083911912 11:65714798-65714820 CTGGGGAAGAGAGGAGGATCAGG - Intronic
1083991139 11:66246458-66246480 CCGAGGATGGGAGCAGGGTGGGG - Intergenic
1083998800 11:66284967-66284989 CTGGGGGTGGGAGGAGGAAAGGG + Intronic
1084062782 11:66686950-66686972 CTCGGGATGGGAGGAGAGTTGGG - Intronic
1084165485 11:67373151-67373173 CTGCGGGTGGGAGGAGGGGCTGG - Intronic
1084185248 11:67467973-67467995 CTGGGGATAGGAGCTGGGGCTGG + Intronic
1084323254 11:68385156-68385178 CTGGGGACAGGAGGATGCTCAGG - Intronic
1084539119 11:69775486-69775508 CGGGGGAAGGGAGGAGGCTGGGG + Intergenic
1084698900 11:70773043-70773065 CTGGGGATGGGCGGAGACTGGGG - Intronic
1084888566 11:72225269-72225291 CTGGGGGGTGGAGGCGGGTCTGG - Intronic
1085031087 11:73271237-73271259 CTGGGGAGGGGAGGATTGCCTGG + Intronic
1085364546 11:75927631-75927653 CTGAGGATGGTAGGATGATCAGG + Intronic
1085527683 11:77173671-77173693 CTGGGGAGGGAAGGAAGGCCGGG + Intronic
1085586015 11:77706810-77706832 TGGAGGGTGGGAGGAGGGTCAGG - Intronic
1085863166 11:80257832-80257854 CCACGGATGGGGGGAGGGTCAGG - Intergenic
1086247399 11:84770447-84770469 CGGAGGATGGGAGGAGGGAGAGG - Intronic
1086374965 11:86190774-86190796 CTGGGTCTGGGAGCAGGCTCAGG + Intergenic
1087064156 11:94011705-94011727 CAGGGGCTGGGTGGAGGGTGTGG + Intergenic
1087607195 11:100391077-100391099 TTGGGGGTGGGAGGAGGGAGAGG + Intergenic
1087634452 11:100687165-100687187 CGGCGGCGGGGAGGAGGGTCTGG + Intergenic
1088136301 11:106559825-106559847 CCGAGGATGGGTGGAGGGTTGGG - Intergenic
1088289077 11:108216495-108216517 GTGGGGAGGAGAGGAGGGTCAGG + Intronic
1088365685 11:109037657-109037679 CTGGGGACAGAAAGAGGGTCAGG - Intergenic
1089004866 11:115082851-115082873 CTGGGGATGGGAGGATGCCTGGG + Intergenic
1089062772 11:115639571-115639593 CTTGGGATGGGAGCAGGAGCGGG + Intergenic
1089448410 11:118572485-118572507 CTGGGGATAGGGGTAGGGTCTGG - Exonic
1089500694 11:118929699-118929721 CTGTGGGTGGGAGTGGGGTCCGG - Intronic
1089632819 11:119794190-119794212 CTGGGGGTGGGGGGCGGTTCTGG - Intergenic
1089679370 11:120110802-120110824 TTGAGGCTGGCAGGAGGGTCAGG - Intergenic
1090357773 11:126151416-126151438 CTGGAGCGGGCAGGAGGGTCTGG - Intergenic
1090571598 11:128053217-128053239 CTGGAGATGGAAGAAGGGCCAGG - Intergenic
1090663049 11:128895378-128895400 CTGGGGTTGGGGGGGGGGTGGGG - Intronic
1090919535 11:131195864-131195886 GTGGGCATGGGGGGAGAGTCAGG + Intergenic
1091002692 11:131923837-131923859 CTGGGGATGGGAGGAGGGTCGGG - Intronic
1091015843 11:132050149-132050171 CTGGGGAAGGGAGAAGGGTGAGG + Intronic
1091025080 11:132135041-132135063 GTGGGGAGGGGAGGAGGATTTGG - Intronic
1091218804 11:133918926-133918948 CTGGAGAAGGAAGGAGGGGCAGG + Intronic
1091277598 11:134362838-134362860 CTGGGGCTGGGAGTGGGGTGAGG + Intronic
1091278757 11:134370210-134370232 CTGTGGATGGGAGCCGGGTGGGG + Intronic
1091304723 11:134530201-134530223 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304737 11:134530231-134530253 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304744 11:134530248-134530270 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304751 11:134530265-134530287 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304758 11:134530282-134530304 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304765 11:134530299-134530321 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304772 11:134530316-134530338 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304779 11:134530333-134530355 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304806 11:134530393-134530415 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304820 11:134530423-134530445 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304834 11:134530453-134530475 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304848 11:134530483-134530505 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304855 11:134530500-134530522 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304869 11:134530530-134530552 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091434239 12:460615-460637 CTGAGGATGGGATGAGAGGCGGG - Intronic
1091455926 12:607812-607834 ATGGGGATGAGAGGAGGCTGGGG + Intronic
1091479362 12:810867-810889 CTGGGGGTGGGGTGGGGGTCAGG - Intronic
1091833108 12:3564189-3564211 GTGGGGTTGGCAGGGGGGTCAGG + Intronic
1092145225 12:6210179-6210201 CTGGGGAAGGGCAGAGGCTCCGG + Intronic
1092167015 12:6348514-6348536 CTGGGGGTGGTGGGAGGGACAGG - Intronic
1092245876 12:6863979-6864001 CTGGGGTGGGGAGCAGGGTGGGG + Intronic
1092253488 12:6914407-6914429 GTGGGGAAGGGAGGAGGATGGGG - Intronic
1092295011 12:7190301-7190323 TTGTGGATGTGAGAAGGGTCTGG + Intronic
1092428324 12:8390777-8390799 CTGGGGTGGGGAGGAGGTGCAGG - Intergenic
1092441100 12:8505159-8505181 TGGAGGATGGGAGGAGGGTGAGG - Intergenic
1092743222 12:11649816-11649838 CTGCGGGTGGGAGGAGAGACCGG + Intergenic
1092833122 12:12464321-12464343 GTGGGGAGGGCAGGAGGGGCGGG - Intronic
1093030333 12:14282648-14282670 CGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1093541568 12:20293383-20293405 TGGAGGATGGGAGGAGGGTGAGG - Intergenic
1093925642 12:24905829-24905851 TTGGAGATTGGAAGAGGGTCTGG + Intronic
1093954379 12:25199734-25199756 CTGGGAATGGGAGTAGGGGCTGG - Intronic
1094386503 12:29900226-29900248 TTGGGGGTGGGAAGAGGGTGAGG - Intergenic
1095048401 12:37534856-37534878 CTGGGGATGGGAATAAAGTCTGG - Intergenic
1095473927 12:42565936-42565958 CCGGGGATCAGAGGAGGGACAGG + Intronic
1095520193 12:43054728-43054750 CTAGGGGTGGGAGGAGGGTGTGG - Intergenic
1095825309 12:46524806-46524828 ATGGAGATGGGAGGAGGCTAGGG + Intergenic
1096230141 12:49892219-49892241 CCTGGGACGGGAGGAGGGACAGG - Intronic
1096466371 12:51849150-51849172 CTGGGGTTGGGGTGGGGGTCGGG + Intergenic
1096526484 12:52213084-52213106 CTGGAGAAGGGAGGAGGCACAGG + Intergenic
1096539139 12:52294471-52294493 ATGGGGAAGGGAGGAGGGGAGGG + Intronic
1096574399 12:52543706-52543728 CAGGGTCTGGGAGGAGGGGCAGG - Intergenic
1096682409 12:53265203-53265225 CTGAGGCTGGGAGGAGGCTGAGG - Intergenic
1096699265 12:53371517-53371539 CTGGGGGCGGGCGGAGGGCCGGG - Intergenic
1096743849 12:53713004-53713026 CAGGGGTTGGGAGCAGGGCCTGG + Intronic
1096779637 12:53984624-53984646 TTGGGGATGGGAGTGGGGTGAGG - Intergenic
1096792693 12:54054773-54054795 CTGAGGATGGGGTGAGGGTGGGG + Intronic
1096849859 12:54428606-54428628 CTGGAGGTGGGAGGTGGGGCAGG - Intergenic
1096877745 12:54643884-54643906 CTGGGGATGGGAGGTTGGTGGGG + Intergenic
1097122946 12:56749962-56749984 CAGGGGGTGGGAGGAGTGGCAGG + Intronic
1097184390 12:57188856-57188878 CTGAGGATGGCAGGAGTGGCTGG + Intronic
1097651491 12:62303596-62303618 CGGGGGATGGGGGGAGGGTCGGG - Intronic
1097683925 12:62674788-62674810 CTGGGGATGTGAGAAAGGGCTGG + Intronic
1097740057 12:63231347-63231369 TGGAGGATGGGAGGAGGGTGAGG + Intergenic
1097957761 12:65504061-65504083 ATGGGGGTGGGAGCAGGGTCTGG + Intergenic
1098706151 12:73692356-73692378 ATGGGGATGGGAGGAGGAAGAGG + Intergenic
1098900007 12:76102754-76102776 ATGGGGGTGGGATGAGGGACAGG - Intergenic
1099225337 12:79962419-79962441 CTGGGGGTGGGAGGATGGAATGG - Intergenic
1099860059 12:88215028-88215050 TGGAGGATGGGAGGAGGGTGAGG + Intergenic
1099901624 12:88717728-88717750 CTAGGGCTGGGAGGAGGGAGAGG + Intergenic
1099954953 12:89344696-89344718 CTGGGAGAGGGAGGTGGGTCAGG - Intergenic
1100786847 12:98087602-98087624 ATGGGGCTGGGAGGAGAGTTAGG + Intergenic
1101193682 12:102360971-102360993 CTGGGGTAGGGAGAAGGGGCAGG + Intergenic
1101725607 12:107385849-107385871 GTGAGGATGGCAGGAGGGTGGGG - Intronic
1102236730 12:111298466-111298488 CTGGGGGTGTCAGGAGGGGCGGG + Intronic
1102597072 12:114001071-114001093 CAGAGCCTGGGAGGAGGGTCCGG - Intergenic
1102637492 12:114336890-114336912 CTGGGGAGTGGTGGAGGGTGAGG - Intergenic
1102777297 12:115531680-115531702 GTGGGGATGGGGTGAGGGTGAGG - Intergenic
1102864268 12:116361571-116361593 CTGGGGGTGGGAGGTGGGACAGG - Intergenic
1103370686 12:120416881-120416903 TTGGGGAAGGGGGGAGGCTCTGG + Intergenic
1103383596 12:120514263-120514285 CTGGGGGTGGGAGGAGGAAGAGG + Intronic
1103497576 12:121374691-121374713 CAGGGGGTGGGGGGAGGCTCAGG - Intronic
1103521900 12:121541644-121541666 CTGGGGGTGGCAGGAGGAACTGG - Intronic
1103656361 12:122474191-122474213 CGGGGGAGTGGAGGAGTGTCAGG + Exonic
1103704110 12:122862194-122862216 CGGCTGATGGGACGAGGGTCAGG + Exonic
1103796463 12:123506423-123506445 CTGTGCAAGGCAGGAGGGTCAGG + Intronic
1103978340 12:124718976-124718998 GTGGGGGTGGGAGGAGGATGAGG + Intergenic
1103994144 12:124818148-124818170 CTGGGGATGGGAGAATGACCAGG + Intronic
1104114256 12:125734277-125734299 CTGGTGGTGGGAGGGGCGTCAGG + Intergenic
1104751941 12:131245462-131245484 CTGGCAATGGGAGGAGGCTCTGG - Intergenic
1104786919 12:131455861-131455883 GTGGGGAGGGGAGGTGGGCCAGG + Intergenic
1104965301 12:132506225-132506247 CTGTGGATGGGAGGAGGGGCCGG + Intronic
1104966105 12:132509438-132509460 CTGGGGATGGAAGGAGCCGCTGG - Intronic
1104998487 12:132673944-132673966 CTGAGGATGGGAGGAAGGCGAGG - Intronic
1105203463 13:18199381-18199403 CTGGGGAGGTGGAGAGGGTCTGG - Intergenic
1105405958 13:20132907-20132929 CAGGGGCTGGGTGGAGGGGCAGG - Intergenic
1105520895 13:21130044-21130066 CTGAGGATGGGACAAGGGTGTGG + Intergenic
1105702608 13:22944385-22944407 TGGGGGATGAGAGGAGGCTCCGG - Intergenic
1105855233 13:24366168-24366190 TGGGGGATGAGAGGAGGCTCCGG - Intergenic
1105884020 13:24627208-24627230 AGGGGAAGGGGAGGAGGGTCAGG - Intergenic
1106246271 13:27953458-27953480 GTGGGGCAGGGAGGAGGGTGGGG - Intergenic
1106597749 13:31161435-31161457 GGGTGGATGGGAGGAGGTTCTGG - Intronic
1108323355 13:49307115-49307137 CTGGGGATGGGGGGCGGGTATGG - Intergenic
1108334156 13:49421722-49421744 CTGGGTAGAGGAGGAGGTTCAGG - Intronic
1108501297 13:51072185-51072207 CTGGGGATGGGGGTGGGGTGGGG - Intergenic
1108529321 13:51314300-51314322 GTGGAGCTGGGAGGAGGGTGAGG + Intergenic
1108807803 13:54181404-54181426 CAGAGGGTGGGAGGAGGGTGAGG - Intergenic
1108964808 13:56284791-56284813 TTGAGGGTGGGAGGAGGGTTAGG - Intergenic
1109364667 13:61339434-61339456 CTGGGGGTGGGTGGAGACTCAGG - Intergenic
1109589618 13:64460932-64460954 CGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1109673993 13:65648711-65648733 CTGAGGAAGGGAGGAGTGTACGG + Intergenic
1109958214 13:69596855-69596877 TTGGGGGTGGGTGAAGGGTCTGG + Intergenic
1110054921 13:70955523-70955545 CTGGGGATGGGGGGAAATTCAGG + Intergenic
1110482092 13:75990553-75990575 CAGAGGGTGGGAGGAGGGTGAGG + Intergenic
1110606320 13:77437109-77437131 CTGGGGATTGTCGGAGGGTGGGG + Intergenic
1110829757 13:80017514-80017536 CTGGGGGTGGGGGCAGGGTTAGG + Intergenic
1110992061 13:82054589-82054611 TGGAGGATGGGAGGAGGGTGAGG + Intergenic
1111192948 13:84833057-84833079 CCGGGGATGGGAGGGGGATGAGG - Intergenic
1111749963 13:92317141-92317163 CTGGGGGTTGGAGAAGGCTCTGG - Intronic
1112049823 13:95634193-95634215 CCAGCCATGGGAGGAGGGTCTGG - Intronic
1112174548 13:97009055-97009077 GAGAGGATGGGAGGAGGGTGAGG + Intergenic
1112505793 13:99974955-99974977 CTGGGGTTGGAAGGAGGTTGGGG - Intergenic
1112927724 13:104697107-104697129 ATGGGGGTGGGAGGTGGGTAGGG - Intergenic
1113081289 13:106523074-106523096 CTGGGCTTCAGAGGAGGGTCAGG + Intronic
1113095965 13:106664001-106664023 CTGGGCATGGGAGGTGGGGGTGG - Intergenic
1113362985 13:109648682-109648704 TTGGGGGTGGGAGGAGGGAGAGG - Intergenic
1113521937 13:110947551-110947573 CAGGGTATGGGGGGAGGGGCTGG + Intergenic
1113705956 13:112433148-112433170 CAGGGTATGGGGGGAGGGGCTGG - Intronic
1113750982 13:112776284-112776306 CCGGGGATGGAAGGAGGGTCTGG - Intronic
1114233383 14:20803312-20803334 CCGGGGATGGGAGGCGGGGTCGG + Intergenic
1114376146 14:22148666-22148688 CTGGGGCTGGCAGCAGGGTTTGG - Intergenic
1114426428 14:22627710-22627732 CTGAGGCTTGGAGGAGGGGCGGG - Intergenic
1114594840 14:23902824-23902846 CGGAGGATGGGAAGAGGGTGAGG - Intergenic
1114613677 14:24057452-24057474 CTGGGGAAGGGAGCAAGGGCTGG - Intronic
1114668761 14:24398159-24398181 CTGGGGATGTGAGCAGAGCCTGG + Intergenic
1115320753 14:32077141-32077163 CTGGGGAAGGGGGGAGGGACGGG + Intronic
1115918297 14:38342390-38342412 CTGGAGTTGGGAGAAGGGTGAGG - Intergenic
1116135784 14:40921765-40921787 CCGGGGATGGGAGGAGAGGGAGG - Intergenic
1116472722 14:45305135-45305157 CTGGGGAGAGGATGTGGGTCAGG + Intergenic
1116559342 14:46358750-46358772 CTGGGGAAGGGAGGAGGAAAAGG + Intergenic
1117026351 14:51624151-51624173 CAGGGGATGGGAGGAGGGAGAGG + Intronic
1117080076 14:52142719-52142741 CTGGAGGTGGGAGCAGGGCCAGG + Intergenic
1117291071 14:54333536-54333558 CGGGGGATGGGGGGAGGTTAGGG - Intergenic
1117515979 14:56501861-56501883 CTGGGGGTGGGGGGTGGGACAGG - Intronic
1117657168 14:57967329-57967351 CTGGGGAGAGGAGGAGGGACTGG - Intronic
1117745484 14:58865299-58865321 CTGGGAGTGGGAAGAGGGTAGGG + Intergenic
1118163143 14:63310973-63310995 CAGGGGATGGGAGGAGAGTGAGG + Intergenic
1118289089 14:64504125-64504147 CTGGGGAAGGGATGAGGGCGCGG + Intronic
1118542410 14:66842551-66842573 CTGAGGAAGGGAGAAGGTTCAGG + Intronic
1118780625 14:69005407-69005429 CTTGGGATGAGAGGATGGCCAGG - Intergenic
1118823153 14:69358153-69358175 CTAGGGATGGCAGGAGAGTCTGG + Intergenic
1118893828 14:69929941-69929963 CTGGAGATGCAAGTAGGGTCTGG + Intronic
1119414022 14:74457463-74457485 CAGAGGATGGAAGGAGGGTGCGG - Intergenic
1119431358 14:74570088-74570110 CAGGAGATTGGAGGAGGGGCTGG + Intronic
1120147550 14:80995681-80995703 TGGGGGATGGGAGGAGGGAGAGG + Intronic
1120660459 14:87242789-87242811 CTAGGGATGGGAGGAGGAACAGG + Intergenic
1121088996 14:91168379-91168401 CTGGGGATGACTGGAGTGTCAGG - Intronic
1121194352 14:92056596-92056618 CTGGGGAAGGGAGGAAGGATAGG + Exonic
1121274380 14:92657727-92657749 GTGGGCGTGGAAGGAGGGTCAGG + Intronic
1121333546 14:93063090-93063112 GTGGGGCTTGGAGAAGGGTCTGG - Intronic
1121437987 14:93931538-93931560 CTGGGGCTGTGAGCAGGGACAGG - Intergenic
1121447519 14:93988187-93988209 GAGGGAATGGGAGGAGGGTATGG + Intergenic
1121447617 14:93988497-93988519 TAGGGGATGGGAGGAGGGGATGG + Intergenic
1121447636 14:93988546-93988568 GAGGGGATGGGAGGAGGGGATGG + Intergenic
1121447668 14:93988631-93988653 GAGGGGATGGGAGGAGGGGATGG + Intergenic
1121447749 14:93988843-93988865 GAGGGGATGGGAGGAGGGGATGG + Intergenic
1121448747 14:93994748-93994770 CGTGGGAAGGGACGAGGGTCTGG + Intergenic
1121456580 14:94042487-94042509 TTGGGGGTGGGAGGGGGGGCAGG + Intronic
1121502694 14:94450881-94450903 CTGAAGATGGGTGTAGGGTCGGG - Intronic
1121569557 14:94937033-94937055 CTGGGGTTGGCGGGAGGGCCAGG + Intergenic
1121732595 14:96196966-96196988 CTGGGGGTAGGAGGGGGTTCTGG + Intergenic
1121765012 14:96478737-96478759 GTGGGGCTGGGGGGAGGGTGGGG + Intronic
1121869808 14:97396706-97396728 CTGGGGTTCTGAGGAGGATCTGG - Intergenic
1122117393 14:99534760-99534782 CTGGTGAGGGCAGGAGGGGCTGG - Intronic
1122263854 14:100537819-100537841 CTGGGGAGGAGAGGAGGTGCGGG + Exonic
1122297353 14:100712976-100712998 CTGGGGCTGGAAGGAGAGCCTGG - Intergenic
1122690909 14:103531815-103531837 CTGGGGATGGGAGTGGCATCAGG + Intronic
1122879086 14:104681989-104682011 CCAGGGAGGGGAGGAGGGCCTGG + Intergenic
1122890493 14:104729961-104729983 CTGGGGACGAGCTGAGGGTCAGG - Exonic
1122897530 14:104767710-104767732 CTGGGGCTGCTAGGAGGGTCGGG + Intronic
1123000740 14:105292855-105292877 CTGGGGAGGGGATGTGGGCCTGG - Intronic
1123120708 14:105915143-105915165 CATGGGCTGGGAGGAGGGGCAGG - Intergenic
1123403425 15:20006706-20006728 CGTGGGCTGGGAGGAGGGGCAGG - Intergenic
1123512763 15:21013360-21013382 CGTGGGCTGGGAGGAGGGGCAGG - Intergenic
1125119514 15:36137852-36137874 TTGGGGGTGGGAGGAGGGAGAGG - Intergenic
1125400902 15:39301669-39301691 CAGGGGATGGGAGGAGGGAAGGG + Intergenic
1125503002 15:40251212-40251234 TTGGGGATGGCAGCAGGGTATGG + Exonic
1125536230 15:40442131-40442153 CTGGGGCTGGGGGCCGGGTCAGG + Intronic
1125541220 15:40471123-40471145 CTGGGGGCGGGAGGAGGGTCTGG - Exonic
1126195944 15:45932063-45932085 TGGAGGATGGGAGGAGGGTGAGG - Intergenic
1127596908 15:60493999-60494021 ATGGGGGTGGGCTGAGGGTCAGG - Intronic
1127725341 15:61744089-61744111 CTGGGGAGGAGAGGAGGGAGCGG + Intergenic
1127849108 15:62897679-62897701 CTGTGGCTGGGAGCGGGGTCAGG + Intergenic
1127905687 15:63374151-63374173 CAGGGGAGGTGTGGAGGGTCAGG - Intronic
1128145840 15:65332101-65332123 CTGGGGCTGCGAGTAGAGTCAGG + Exonic
1128161635 15:65426463-65426485 CTGGGCAGGGGAGCAGGGGCAGG + Intergenic
1128387181 15:67158066-67158088 CTTGGGCTGGGAGGAAGGGCTGG + Intronic
1128796224 15:70468665-70468687 CTGGGGGTGGGGGCAGGGTAAGG + Intergenic
1129265832 15:74392636-74392658 CTGGGGGAGGGAGGACAGTCAGG - Intergenic
1129653573 15:77508126-77508148 GTGAGGTTGGGAGGAGGGACGGG + Intergenic
1130485538 15:84396307-84396329 CTGGGGAAGGCAGGAAGGGCAGG + Intergenic
1130510705 15:84587045-84587067 ATGGGGAGGGGAAAAGGGTCGGG - Intergenic
1130559257 15:84945567-84945589 GTGGGGAGGGGAGGAGGCTTTGG - Exonic
1130649000 15:85751573-85751595 CTGGGGATGGCGGAAGGGGCAGG - Intergenic
1130991615 15:88879135-88879157 CCGGGCCTGGGAGGAGGGCCTGG - Exonic
1131030644 15:89183724-89183746 GTAGGGAAGGGAGGAGGGTGTGG - Intronic
1131032066 15:89194860-89194882 CTGGGGGTGGGAGGTGGGAGAGG - Intronic
1131109951 15:89758801-89758823 TTGGGGCTGGGAGGGGGGCCGGG - Intergenic
1131145416 15:90008222-90008244 CTAGGGATGGGGGAAGGGTCAGG - Intronic
1131175962 15:90210004-90210026 CTGGAGATGGGAGGCTGGTTGGG + Intronic
1131257585 15:90872103-90872125 CCGGGGAGGGGAGGAGCGGCCGG + Intronic
1131291702 15:91112118-91112140 CTGGGGGTGGGGTGAGGGTTGGG + Intronic
1131418674 15:92284465-92284487 CTGGGGATGGGATGGAGGCCGGG + Intergenic
1131515418 15:93073399-93073421 CTGGAGATGGCGCGAGGGTCGGG - Intronic
1131678531 15:94697347-94697369 CTGGGCCTGGGAAGAGTGTCTGG + Intergenic
1131950304 15:97674120-97674142 CTGGGGATGCAAGAAGGGTGGGG + Intergenic
1132339527 15:101069197-101069219 CTGGGGATGGCAGGAAGGCCCGG - Exonic
1132406144 15:101542829-101542851 CTGGGGTTGGGTGGGGGGTCAGG - Intergenic
1132481294 16:167488-167510 CTGGGGCTGGGTGGAGGGGTGGG - Intergenic
1132518400 16:376492-376514 CTGGGGATCTGGGGAGGGGCAGG + Intronic
1132883614 16:2172864-2172886 GTGGGGGTGGGAGGAGAGGCAGG + Intronic
1132906074 16:2283421-2283443 CTGGGGAGGGGAGTGGGGGCCGG - Intronic
1133019172 16:2959297-2959319 ATGGGCAAGGGAGGAGGGACTGG + Intergenic
1134278086 16:12794448-12794470 TTGGGGGTGGGGGGAGGGACAGG - Intronic
1134299353 16:12975733-12975755 GTGGGGCTGGGAGGGGGGACTGG + Intronic
1134564864 16:15242720-15242742 TAGAGGATGGGAGGAGGGTGAGG + Intergenic
1134592204 16:15463726-15463748 CTGGGGTGGGGATGGGGGTCAGG - Intronic
1134634079 16:15778930-15778952 CAGAGGATGGGAGGTGGGGCGGG + Intronic
1134660860 16:15983426-15983448 CTGCGGTTGGGAGGGGAGTCAGG + Intronic
1134737632 16:16513978-16514000 TAGAGGATGGGAGGAGGGTGAGG - Intergenic
1134929873 16:18198182-18198204 TAGAGGATGGGAGGAGGGTGAGG + Intergenic
1135086433 16:19478243-19478265 CTGGGGTTGGAAGTAGAGTCAGG + Intronic
1135592103 16:23712129-23712151 CTGGTGTTGAGTGGAGGGTCAGG + Intronic
1135873599 16:26176084-26176106 GTGGGGGTGGCAGGAAGGTCAGG - Intergenic
1135895641 16:26399488-26399510 CTGGGCATGGGGGCAGGGTAAGG - Intergenic
1136097426 16:27967232-27967254 ATGGGGCTGGCAGGAGGTTCAGG - Intronic
1136143373 16:28301287-28301309 CTGGGGAGGGCAGGAGAGGCTGG + Intronic
1136287613 16:29253654-29253676 CTGCAGATGTGAGGAGGGTGAGG + Intergenic
1136317917 16:29465089-29465111 CTGGGGAGGGGAGAAGGGTTTGG + Exonic
1136381842 16:29899576-29899598 CTGGGGACGGGCGGAGGGAGGGG + Intergenic
1136398441 16:30005304-30005326 TAGGGGGTGGGAGGGGGGTCAGG - Exonic
1136413393 16:30090140-30090162 CAGGGGAGGAGAGGAGGGTGGGG - Intronic
1136432492 16:30204438-30204460 CTGGGGAGGGGAGAAGGGTTTGG + Exonic
1136673316 16:31876992-31877014 GTTGGGATGGAAGGAGGGTTGGG + Intronic
1136683497 16:31981288-31981310 CTGGAGAGGGAAGGAGGGGCTGG + Intergenic
1136784127 16:32924848-32924870 CTGGAGAGGGAAGGAGGGGCTGG + Intergenic
1136859756 16:33691269-33691291 CTGAGGATGGAAGAAGGGTGCGG - Intergenic
1136885655 16:33928958-33928980 CTGGAGAGGGAAGGAGGGGCTGG - Intergenic
1137054718 16:35738893-35738915 GCGGGGCTGGGAGGAGAGTCTGG + Intergenic
1137496161 16:48970986-48971008 CTGGGGATGGGATGTGGTTCAGG + Intergenic
1137502092 16:49019499-49019521 CTGGGGAAGGGAGCAGAGCCAGG - Intergenic
1137582492 16:49641841-49641863 CTGGAGATGGGAGCAGGGACTGG + Intronic
1137603026 16:49769444-49769466 ATGGGGTTGGGAGCAAGGTCAGG - Intronic
1137722135 16:50633529-50633551 CTAGGGAGGGGAGGAGGGCCGGG - Exonic
1138519108 16:57560673-57560695 TTGGGGATGGTAGGATGGTGAGG + Intronic
1139440502 16:66964249-66964271 CTGGGGAGCAGAGAAGGGTCTGG + Intronic
1139442331 16:66974497-66974519 CGGGGGGTGGGGGGAGGGTCAGG - Exonic
1139532529 16:67549545-67549567 CTGGGGTGGGGAGGGGGGTATGG - Intergenic
1139676282 16:68526232-68526254 AGGGGGATGGGAGGAGGGAAGGG - Intergenic
1140078378 16:71723114-71723136 TTGCGGAAGGGAGGAGGGGCCGG - Intronic
1140255927 16:73336373-73336395 TGGGGGGTGGGAGGAGGGTAAGG - Intergenic
1140479892 16:75256834-75256856 CTGGGGCTGGCAGGTGGGGCAGG + Intronic
1140807915 16:78550697-78550719 CTGGGGATGGCAGCAGAGTGGGG + Intronic
1140915821 16:79492245-79492267 CTGGGGCTGGGATTAGGGTGAGG + Intergenic
1141030204 16:80581119-80581141 GTGGAGAGGGGAGGAGGATCAGG + Intergenic
1141179350 16:81742030-81742052 CTGGGAAGGGGAGGAGGGAGGGG - Intronic
1141424087 16:83934392-83934414 CTGGGGCTGGGAGGAAGAGCAGG - Intronic
1141508275 16:84495425-84495447 CAGGGGAAGGAGGGAGGGTCTGG - Intronic
1141569885 16:84928116-84928138 CTGGGAGTGGGAGGAGGGGCAGG - Intergenic
1141599939 16:85119503-85119525 CAGGGGCTGGGCGGAGGCTCAGG + Intergenic
1141611268 16:85182342-85182364 CAGAGGATGGGAGGAGGCTCGGG + Intronic
1141912234 16:87067908-87067930 CCGGGCCAGGGAGGAGGGTCCGG + Intergenic
1142002324 16:87670861-87670883 ATGGGGACGGGAGGGGGGTCAGG + Intronic
1142006280 16:87690951-87690973 CTGGGGCTGGGAGTCAGGTCTGG + Intronic
1142093236 16:88226282-88226304 CTGCAGATGTGAGGAGGGTGAGG + Intergenic
1142096106 16:88240823-88240845 CTGGGGAGGGGAAGTGGGCCGGG - Intergenic
1142126031 16:88411193-88411215 CTGAGGTTGGGTGGAGGGTGGGG - Intergenic
1142155665 16:88531887-88531909 CTGGGGTGGGGAGGACGGTGGGG + Intronic
1142294526 16:89211639-89211661 CAGGGGAGGGGAGCAGGGTGAGG + Intergenic
1142367378 16:89657361-89657383 CTGGGGATGGGGTCCGGGTCGGG + Intronic
1203086782 16_KI270728v1_random:1188850-1188872 CTGGAGAGGGAAGGAGGGGCTGG + Intergenic
1203121262 16_KI270728v1_random:1539448-1539470 CTGAGGATGGAAGAAGGGTGCGG - Intergenic
1142491343 17:281690-281712 ATGGGGATGGGTGGACGGTCAGG - Intronic
1142711612 17:1726757-1726779 TTGGGGATGAGGGGAGGCTCGGG - Exonic
1142712915 17:1733055-1733077 CTGGGGAAGGCAGGAGAGTCAGG + Intronic
1142743786 17:1945002-1945024 CTGGGGAGGGAAGGAGGGGGTGG - Intronic
1142809044 17:2386781-2386803 CTGGGGGTGGGTGGGGGGGCTGG + Exonic
1142977829 17:3656108-3656130 CTGGCGAGGGGTGGAGGGGCAGG - Intronic
1143097222 17:4484750-4484772 CAGGGGATGGAAGGAGGGAGGGG - Intronic
1143178396 17:4969341-4969363 CAGGGGTGGGGAGGAGGGACAGG + Intronic
1143184096 17:5000220-5000242 CTGAGGAGGGCAGGAGTGTCTGG + Exonic
1143199267 17:5100783-5100805 CAGGGGATTGGAGGAGTGTCAGG - Intergenic
1143370435 17:6435827-6435849 CTGGGGAGGGGAGGGGGAACAGG - Intergenic
1143410411 17:6705061-6705083 CTGGGGGTAGGAGCAGGGGCAGG + Intronic
1143516852 17:7423743-7423765 CTGGGGAAGGTGGGAGGTTCTGG - Intergenic
1143587165 17:7856032-7856054 CTGGGGCTGGGGGGCGGGGCTGG + Exonic
1143594549 17:7906521-7906543 ATGGGAGTGGGAGGAGGGTTAGG - Intronic
1143863514 17:9908004-9908026 CTGGGGATGGAGGGAGAGTGAGG + Intergenic
1143900548 17:10171263-10171285 CTGGGTCTGGCAGGAGGGGCTGG - Intronic
1143949872 17:10623993-10624015 ATGAGGATGGGAGGAGGGGATGG - Intergenic
1144023115 17:11254564-11254586 CTGTGCATGAGAGGAGGGGCAGG - Intronic
1144722325 17:17480032-17480054 GAGGGGATGGGAGGTGGGACAGG - Intronic
1144750833 17:17647087-17647109 GTGGGGATTGGAGGTGGGTTCGG + Intergenic
1144795490 17:17888631-17888653 GTGGGGATGGGAGTGGGGACAGG - Intronic
1144852851 17:18252630-18252652 CTGGGGAGGGGAGGCAGGTAGGG + Intronic
1144953392 17:19005533-19005555 TGGGGGATGGGAGGAAGGGCTGG - Intronic
1145055997 17:19704346-19704368 CTGGGGCTGGGAGAAGGGTGGGG + Intronic
1145245774 17:21268477-21268499 CTAGGGATCGGAGGAAGGTGGGG - Intergenic
1145772958 17:27506677-27506699 TTGGGGGTGGGAGGAGGGGGTGG - Intronic
1145902112 17:28496061-28496083 CTGGGGTGGGGAGGTGGGTGAGG - Intronic
1145940620 17:28741616-28741638 CTGGGGATGGGAGTGTGGACAGG - Intronic
1146594159 17:34155275-34155297 CTTGGGCAGAGAGGAGGGTCTGG - Intronic
1146656643 17:34638594-34638616 CGGGGGACGGGAGGCGGGCCCGG - Exonic
1146820301 17:35979293-35979315 CTGGAGAGAGGAGGAGGGTCTGG + Intronic
1146970587 17:37068506-37068528 CTGGGGATGGAAGGAGGAGGAGG + Intergenic
1147141257 17:38461717-38461739 CTGGGGAAGGGAGGAGGTGGGGG + Intronic
1147143844 17:38474244-38474266 CTGGGGATGGCAGGAGACTGGGG + Intronic
1147144411 17:38476994-38477016 CTGGAGAGGGAAGGAGGGGCTGG + Intronic
1147330481 17:39696304-39696326 GTGGGGATGGGGGGAGGAGCTGG - Intronic
1147456432 17:40541070-40541092 CTGGGCAGGGGAGGCAGGTCAGG + Intergenic
1147649681 17:42054897-42054919 GTGGGCATGGGAGGGGTGTCAGG - Intronic
1147688381 17:42300476-42300498 CTGGGGGTGGGATGGGGCTCGGG + Intronic
1147793020 17:43025141-43025163 GCGGGGGTGGGAGGAGGGGCCGG + Intergenic
1147805381 17:43127089-43127111 CAGGGGTTGGGAGGGGGCTCGGG - Intergenic
1147806535 17:43135651-43135673 GTGGCGTTGGGAAGAGGGTCTGG - Intergenic
1147921167 17:43917938-43917960 GTGGCGTTGGGAAGAGGGTCTGG - Exonic
1147998707 17:44375517-44375539 GAGGGGATGGGAGGAGGGAGAGG - Intronic
1148331537 17:46816858-46816880 CCGGGAATGGGAAGAGGGTCAGG + Intronic
1148475442 17:47925587-47925609 GTGGGGGTGGGAGGAGAGGCAGG - Intronic
1148547523 17:48529385-48529407 CTGGGGGTGGGAGGGGGGATGGG - Exonic
1148872751 17:50668355-50668377 CTGGGGATGGGGCGAGGGTAGGG + Intronic
1148943598 17:51238078-51238100 CTGGGGATGGGGTGGGGGCCAGG + Intronic
1148973141 17:51502084-51502106 GGAGGGATGGGAGGAGGGTAAGG - Intergenic
1149424968 17:56546013-56546035 GGGGGGAGGGGAGGAGGGTGGGG + Intergenic
1149447159 17:56722425-56722447 CTTGGGCTGGCAGAAGGGTCTGG - Intergenic
1149466512 17:56884295-56884317 CTGGGATTGGGATGAGTGTCTGG - Intergenic
1149821532 17:59783671-59783693 CTGGGGATGGGAGGAAAGGAGGG - Intronic
1149985065 17:61340996-61341018 CGCTGGAAGGGAGGAGGGTCAGG + Intronic
1150692307 17:67377282-67377304 CTGGGGCCGGGAGGTGGGTGCGG - Intronic
1150905130 17:69328292-69328314 CTGGGGGAGGGAGGATGGTTTGG + Intergenic
1151093758 17:71472317-71472339 CTGGGGTGGGTGGGAGGGTCAGG - Intergenic
1151155660 17:72121896-72121918 CGGGCGATGGGAGGCGGGGCGGG - Intronic
1151365807 17:73615565-73615587 CTGGGGATGGAGGGAGGGACGGG - Intronic
1151404289 17:73876693-73876715 CTGGGGAGGTTAGGAGGGTCTGG + Intergenic
1151404663 17:73878563-73878585 CTGGGGTTGGGAGGTGGTTGTGG + Intergenic
1151619592 17:75237778-75237800 CTGGGGATGGCAGCAGGAGCTGG + Exonic
1151715801 17:75830483-75830505 CTGGGGTGGGGAGCAGGGGCAGG + Intronic
1151718607 17:75843757-75843779 CTGGGGAAGGGAGGGAGGTGGGG - Intronic
1151836235 17:76584866-76584888 CTGGGTTTGGGAGGAGGGAAGGG - Intronic
1152078994 17:78174964-78174986 CAGGGGATGGGTGAAGGGCCAGG + Intronic
1152183346 17:78839315-78839337 CTGGGGATGGGAAGTGACTCAGG - Intronic
1152279103 17:79374975-79374997 CAGGGGAAGGGAGGTGGGTAGGG - Intronic
1152371457 17:79891096-79891118 CTGGGGCGGGGAGGGAGGTCAGG + Intergenic
1152382518 17:79949411-79949433 CTGGGGCTGGGAGCAGGGCCTGG - Intronic
1152391438 17:80006148-80006170 CTGGGGTGGGGAGGGGTGTCAGG - Intronic
1152627742 17:81396098-81396120 CCGGGGAGGGGAGCAGGGTAGGG - Intronic
1152636555 17:81432756-81432778 CTGGGGATGGGAGGGAGGGTGGG - Intronic
1152636607 17:81432854-81432876 CTGGGGATGGGGGGAAGGGTGGG - Intronic
1152636634 17:81432903-81432925 CTGGGGATGGGGGGAAGGGTGGG - Intronic
1152718912 17:81912998-81913020 CTGGGAAGGGGGAGAGGGTCTGG - Intronic
1152726969 17:81952296-81952318 CTGGGGAGGGGAGGTGGGGGAGG + Intergenic
1152777843 17:82213383-82213405 CTGGGGGAAGGAGGGGGGTCGGG + Intergenic
1152797826 17:82316626-82316648 CTGGGGTTGGGAGGGGGGTCTGG + Intronic
1153193199 18:2565356-2565378 CAGAGGATGGGAGGAGGGAAAGG + Intronic
1153747888 18:8198988-8199010 CTGCGCATCTGAGGAGGGTCTGG - Intronic
1154006155 18:10528760-10528782 CTGGGGCAGGGAGGTGGGGCGGG + Intronic
1154168747 18:12035672-12035694 CTGGAGATGTGAGGGGGGTGGGG + Intergenic
1154238508 18:12629610-12629632 GAGGGGCTGGGAGGAGGGGCAGG + Intronic
1154349666 18:13572419-13572441 CTGGGAGTGGAAGGAGGCTCTGG + Intronic
1155308155 18:24498987-24499009 CTTGGGGAGGGCGGAGGGTCAGG - Intergenic
1155329464 18:24699880-24699902 ATGGGGATGGGGGTAGGGTAAGG + Intergenic
1155703750 18:28781861-28781883 TTGGGGATGGGAAGTGGGTTAGG + Intergenic
1155982244 18:32193751-32193773 CTGGGGGTGGGAGGACTGTGAGG - Intronic
1156003902 18:32417731-32417753 GTGGGGGTGGGAGGAAGGTGGGG + Intronic
1156311715 18:35928786-35928808 TTAGGGCTGGGAGGAGGGTAGGG + Intergenic
1156319826 18:36008985-36009007 CTGGGTATGGGAGTAGGGAGAGG + Intronic
1156468584 18:37363177-37363199 GTGGGGAGGGGACGAGGGTGGGG + Intronic
1156527169 18:37778077-37778099 CCTGGGGTGGGAGGAGGGTGGGG + Intergenic
1156790375 18:40965286-40965308 GTGGGGCTGGGAGGGGGGTAAGG + Intergenic
1157333765 18:46722274-46722296 CTGGGCTTGGGAAGAGGGCCTGG - Intronic
1157461728 18:47903103-47903125 TGGGGGATGGGGGGAGGGACAGG + Intronic
1157473724 18:48008404-48008426 CGGGGCATGGGAGGAGGAGCGGG - Intergenic
1157480335 18:48049958-48049980 CTGGGCATGGGAGGAGGTGGAGG - Intronic
1157501091 18:48191228-48191250 CTGTGGCTGGGAGGATGGCCAGG + Intronic
1157680508 18:49601895-49601917 CTGGGGGTGGGGGAAGGGGCAGG + Intergenic
1157741490 18:50097170-50097192 ATGGGGATGGGAGGAAAGTCAGG - Intronic
1157994928 18:52543735-52543757 CCTGGTATGGGAGAAGGGTCAGG - Intronic
1158499041 18:57983481-57983503 CTGGGGAAAGGAGGTGGATCTGG - Intergenic
1158642778 18:59217913-59217935 ATGGGGATGGGAGGAGGTGGAGG + Intergenic
1158892822 18:61889037-61889059 CTGGGGTTGGGCTGAGGGCCAGG - Intronic
1159301596 18:66578975-66578997 ATGGGGGTGGGAGGAAGATCAGG + Intronic
1159389272 18:67767539-67767561 TAGGGGATGAGAGGAGGGACAGG + Intergenic
1160250928 18:77202971-77202993 CTGGGAATGGAAGGAGGCTCCGG - Intergenic
1160278573 18:77463965-77463987 TTGGGGATGCGTGGAGGGACGGG + Intergenic
1160338295 18:78062671-78062693 CTGGGGAAAGGAGGAAGGTGGGG + Intergenic
1160352862 18:78199923-78199945 CAGAGGATGGAAGGAGGGTAGGG + Intergenic
1160466040 18:79077405-79077427 CTGGGAAGGGGAGGAGTGCCTGG + Intronic
1160725845 19:617481-617503 CTGGGGTTGGAAGCAGGGTGGGG + Intronic
1160756279 19:758521-758543 CTGGGGCTGGGAGGTGGCTGGGG + Exonic
1160762321 19:791816-791838 TGGGGGTAGGGAGGAGGGTCAGG + Intergenic
1160874679 19:1291490-1291512 CTGGGGGTGGCAGGAGGGGACGG + Intronic
1160910701 19:1472581-1472603 GTGGGGGTGGGAGGCGGGGCTGG - Exonic
1161205159 19:3036900-3036922 CTGGGGGTGGGAGTGGGGGCAGG + Intronic
1161314375 19:3611089-3611111 CTGGGGGTTGGAGAAGGGTGAGG - Exonic
1161349372 19:3783699-3783721 CTGGGGAAGGGATGGAGGTCAGG + Intronic
1161398923 19:4059140-4059162 CTGGGGTGGGTAGGAGGGCCCGG - Intronic
1161635880 19:5388664-5388686 ATGGGGAGGGGAGGGGAGTCGGG + Intergenic
1161747319 19:6068913-6068935 CTGGGCAAGGGAGGGGGGCCTGG + Intronic
1161872386 19:6880159-6880181 CAGGGGATGGGAGGTGGGAGGGG + Intergenic
1162070563 19:8149701-8149723 CTGCGGCTCGGGGGAGGGTCCGG + Exonic
1162071479 19:8154899-8154921 AAGGAGATGGGAGGAGGGACGGG + Intronic
1162182943 19:8883034-8883056 CTGGGAATGTGAGTAGAGTCAGG + Intronic
1162324212 19:9989278-9989300 CTGGGTTGGGGACGAGGGTCGGG - Intronic
1162765031 19:12914051-12914073 CTCGGGGTGGGGTGAGGGTCTGG - Intronic
1163172268 19:15540551-15540573 CGGCGGATGGGCGGAGGTTCCGG + Exonic
1163188118 19:15653856-15653878 CTGGAGATGGTAGCAGGGGCTGG + Intronic
1163229111 19:15987951-15987973 CTGGAGATGGCAGCAGGGGCTGG - Intergenic
1163270843 19:16252554-16252576 CTGGGGCTGTGAGGAGGGCACGG + Intergenic
1163344142 19:16729262-16729284 TTGGGGAGGTGAGCAGGGTCCGG - Intronic
1163464694 19:17460529-17460551 CTGAGGAGGTGAGGAGGGGCAGG - Exonic
1163585381 19:18160986-18161008 ATGGGGTTGGGAGGAGGCTGGGG + Intronic
1163587785 19:18173391-18173413 CTGGGGATGGGATGGAGGCCGGG - Intronic
1163687142 19:18718148-18718170 CTGGGGAGGAGAGGAGGGGAGGG - Intronic
1163841816 19:19616033-19616055 CTGGGTATGGGACTAGGGTCTGG - Intronic
1164531483 19:29051650-29051672 GTGTGGAGGGGAGGAGGGTGAGG - Intergenic
1164634658 19:29783518-29783540 CTGGGGGCGAGAGGTGGGTCTGG + Intergenic
1164891963 19:31831476-31831498 CTGGGGGTGGGTTGAGGGTTTGG - Intergenic
1164990182 19:32677022-32677044 CTCGGGATGGGTGTGGGGTCTGG + Exonic
1165007726 19:32820110-32820132 CTGGGGAGGGGCGGTGGCTCAGG + Intronic
1165259145 19:34597893-34597915 CTGGGGCTGGTGGGTGGGTCAGG + Intronic
1165273770 19:34731997-34732019 CTGGGGTTGGTGGGTGGGTCAGG - Intergenic
1165310680 19:35027811-35027833 CAGGGGACTGGAGGAGGGTTTGG + Intergenic
1165384226 19:35501109-35501131 CTGGGGCTGGGGGGGGTGTCCGG - Intronic
1165403599 19:35617203-35617225 CTGGTCATGGGAGAAGGGGCAGG + Intronic
1165433221 19:35783992-35784014 ATGGGGAAGGCAGGAGGGGCGGG + Intronic
1165449479 19:35873885-35873907 CTGGGGAGGAGAGCAGTGTCAGG - Intronic
1165483916 19:36083770-36083792 CTGGGGAATGGAGGAGAGTTGGG + Intronic
1165743434 19:38217046-38217068 TGGGGGAGGGGAGGAGGGTTTGG - Intronic
1165749371 19:38250987-38251009 CTGGGGATGGGGGTGGGGTGGGG + Intronic
1165811459 19:38614346-38614368 CTGGGGATGGGAGGGGAGGGTGG - Intronic
1165817047 19:38648594-38648616 CTGGGGGTCTGAGGAGGGTGGGG + Intronic
1165923587 19:39313887-39313909 CTGGGCTTGGGAGGAGGCCCTGG + Intronic
1165948280 19:39458330-39458352 CAGGATATGGGAGGAAGGTCAGG - Intronic
1166113883 19:40640869-40640891 CTGTGGGTGGGAGGAAGGGCAGG + Intergenic
1166196262 19:41207672-41207694 GTGGAGCTGGGAGGAGGGGCAGG + Intergenic
1166197998 19:41219305-41219327 CTGGAGCTGGGGGGAGGGCCGGG + Exonic
1166258467 19:41621614-41621636 CTAGGGGTGGGAGGAGGCTGGGG + Intronic
1166411098 19:42555768-42555790 CTGGGGGTGGGAGGGAGGCCAGG + Intronic
1166677297 19:44747927-44747949 CTGGGGGTGGGGTGAGGGTGGGG - Intronic
1166831958 19:45644614-45644636 CTGAGGATGGGGGGATGGTCAGG - Intronic
1166853858 19:45772753-45772775 CTGGGGAGAGGAGGAGGGAGTGG + Intronic
1166859642 19:45802265-45802287 CTGGGGGTGGGGGGAAGCTCAGG + Intronic
1166874939 19:45891253-45891275 CTGGGGAGTGCAGGAGGGCCGGG + Exonic
1166986202 19:46661115-46661137 CTGGGGCGGGGAGGTGGGACCGG - Exonic
1167068666 19:47206292-47206314 CTGGGGATGAGAGCAGGGCATGG - Intronic
1167120320 19:47512904-47512926 CTGGGGATGGGAAGAGACTGTGG - Intronic
1167284148 19:48589303-48589325 CTGGGAAGGGGAGGAGGGAGGGG + Intronic
1167666215 19:50823908-50823930 CTGGGGATCGGAGGGGGGGGGGG - Intergenic
1167674766 19:50877405-50877427 CTGGGGCAGGGAGGAGGGGTGGG + Intronic
1167684979 19:50950438-50950460 CTGGGGATGGGAGGGAGACCAGG + Intronic
1167702737 19:51060156-51060178 TTGGGGATGGGAAGAGGTTGGGG - Intronic
1167751354 19:51382282-51382304 GTGGGGATGGGATTAGGGTGGGG + Intronic
1167782150 19:51605792-51605814 CTGGGGAACAGAGGAGGGTATGG - Intergenic
1168106980 19:54171808-54171830 CAGGGTATGGGAGAAGGGCCCGG + Intronic
1168287061 19:55340332-55340354 CCGGGGGTGAGAGAAGGGTCAGG - Intronic
1168314180 19:55476825-55476847 GTGGGGGTGGGGGGAGGGACCGG + Intronic
1168315643 19:55483653-55483675 CTGGGGCTGGTCGGAGGGGCTGG - Exonic
925253319 2:2461116-2461138 CTGGTGAAGGAAGGAGGGTGGGG - Intergenic
925294944 2:2770064-2770086 CCAGGGATGGGAGGAGGGCTTGG - Intergenic
925734912 2:6955499-6955521 CTGTGGATGGCAGGAGGGCCTGG - Intronic
926106274 2:10153877-10153899 CTGGGGAGGGGAGAAGGGAGAGG + Intronic
926205859 2:10834012-10834034 CTGGGGATGGGGGAAGGGAGAGG - Intronic
926332075 2:11833904-11833926 CTGGTGAGAGGAGCAGGGTCTGG - Intergenic
926862229 2:17321509-17321531 CTGGGGATGGGAAAAGGGGATGG - Intergenic
927120373 2:19954933-19954955 GTGGGGATGGGAGGAAGGACTGG - Intronic
927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG + Intergenic
927554082 2:24020439-24020461 CTGGGGAGGGGAGGAGAGGGAGG - Intronic
928011877 2:27616744-27616766 CTCGGGATGGGAGGTGGGATAGG + Intronic
928093522 2:28390832-28390854 CTGGGGGTGGGGGTAGGGACGGG - Intergenic
928398954 2:30964386-30964408 GTGGTGAGGGGAGGAGCGTCTGG - Intronic
928611659 2:32997598-32997620 CTTGGGATGGTGGGATGGTCGGG + Intronic
928904454 2:36355676-36355698 GTGGGGGTGGGGGGAAGGTCTGG + Intergenic
928934770 2:36664049-36664071 CTAGGGAACAGAGGAGGGTCGGG - Intergenic
929207838 2:39318243-39318265 TTGAGGTTGGGAGGAGGGTGAGG + Intronic
929426734 2:41851670-41851692 CTGGGGATGGGAGGTGGAGCTGG - Intergenic
929442265 2:41973425-41973447 CTGGGGAAGGGAGGAGGTTATGG + Intergenic
929668461 2:43851788-43851810 CTGGGCCTGGGAGAAGGTTCTGG - Exonic
929795718 2:45056906-45056928 CTGGGACTGGGAGGTGGGACAGG + Intergenic
931517424 2:63058204-63058226 AGGGGGAGGGGAAGAGGGTCGGG + Intergenic
931580533 2:63767001-63767023 CTGGGGATGGGGTGAGGGTGGGG - Intronic
931709434 2:64975464-64975486 CTGGGCATGGGAGGAGGGTGTGG + Intergenic
931858831 2:66332564-66332586 CTGGGTCTGGGAGGAAGGGCGGG - Intergenic
931925791 2:67071155-67071177 CTGGGGATGGCAGGTAGGTGGGG - Intergenic
932028204 2:68157038-68157060 CTGGGGGTGGCAGGACGGTTGGG + Intronic
932456424 2:71852537-71852559 CTGGGGACGGGAGGCGGGGAGGG + Intergenic
932574749 2:72956412-72956434 CTGTGGAGGGGAGGAGGGCTGGG + Intronic
932655769 2:73610154-73610176 CTGGGGCTGAAAGGAGGCTCTGG - Intronic
933698022 2:85234889-85234911 CTGGGGATGGGCCGAGGTTTGGG + Intronic
933901393 2:86852915-86852937 CTGGGGAAGGAAGGAGGGGAGGG + Intronic
934045515 2:88170264-88170286 CTGGGGATGGGGCGGGGGGCGGG - Intergenic
934458116 2:94192377-94192399 CTGAGGATGGAAGAAGGGTGCGG - Intergenic
934552720 2:95271948-95271970 CTGGGGATGGGTGGAGGCAGGGG + Intergenic
935112298 2:100104753-100104775 CGAGGGAGGGGAGGAGGGGCGGG - Intronic
935198539 2:100835857-100835879 CTGTGGAGGGGAAGAGGGGCAGG - Intronic
935363733 2:102268613-102268635 GTGAGGATGGGAGGAGGTGCTGG - Intergenic
935450115 2:103199699-103199721 CTGGGGTTGGGGGGTGGGGCAGG + Intergenic
935568642 2:104635920-104635942 CTGGGGATGGTAGGTGGGGCAGG - Intergenic
935710281 2:105892600-105892622 CTGAGGCTGGGAGGGGGGTGGGG + Intronic
935779157 2:106496322-106496344 CTGGGGAAGGAAGGAGGGGAGGG - Intergenic
935883498 2:107590862-107590884 CTGGGCAGGGGGTGAGGGTCAGG + Intergenic
935955300 2:108370581-108370603 ATTGGGATGGGAGGAGGAACAGG - Intergenic
936003005 2:108852748-108852770 CAGAGGGTGGGAGGAGGGACAGG + Intronic
936061096 2:109296175-109296197 CAGGAGATGGGAGGAGGCTCTGG - Intronic
937124381 2:119464071-119464093 CTGGGGAAGGCAGGCGGGCCTGG + Intronic
937216098 2:120314594-120314616 CTGGGGAGGGAAGGAGGGCCGGG - Intergenic
937266119 2:120615618-120615640 CTTGGCACGGGAAGAGGGTCCGG - Intergenic
937274592 2:120675597-120675619 CTGGGTATGGCAGCAGGGACAGG - Intergenic
937302695 2:120852869-120852891 CTGGGTGTGTGAAGAGGGTCAGG + Intronic
937437243 2:121890578-121890600 CTGGGGGTGGGGAGAGGGTGGGG - Intergenic
937831068 2:126424209-126424231 TAGAGGATGGGAGGAGGGTGAGG + Intergenic
938380801 2:130835595-130835617 ATGGTGGTGGGAGGAGGGTGTGG - Intergenic
938631558 2:133173180-133173202 TTGGGGATGGCAGGAGGTTGGGG + Intronic
938797970 2:134734699-134734721 CTGGGCATGGGGAGAGTGTCAGG - Intergenic
938812440 2:134866126-134866148 ATGAGGGTGGGAGGAGGGTGAGG + Intronic
938889096 2:135684598-135684620 CTGGGGATGGGGGGTGGAGCAGG - Intronic
939250052 2:139671445-139671467 CTGAGGATGGGACCATGGTCTGG + Intergenic
940678549 2:156754635-156754657 CTGTGTGTGGGAGGAGGGGCAGG + Intergenic
941712302 2:168727022-168727044 CTGGCCATGGGAAGAGGTTCTGG - Intronic
941751612 2:169140623-169140645 TTAGGGGTGGGAGGAGGGGCAGG + Intronic
941911703 2:170770849-170770871 GCGGGGCTGGGAGGCGGGTCCGG - Intergenic
942408082 2:175676719-175676741 CTGGGGCTGGGAGCAGGGTCAGG - Intergenic
942458479 2:176153124-176153146 ATGGGGATGGGAGGGGGGGCGGG + Exonic
942583575 2:177448938-177448960 GTATGTATGGGAGGAGGGTCTGG + Intronic
942653941 2:178195040-178195062 CTGGGGATTGAAGCAGGGGCAGG + Intronic
943196133 2:184752481-184752503 TGGGGGATAGGAGGAGGGTGAGG + Intronic
943682881 2:190786389-190786411 CGGGGGTGGGGAGGAGGGGCGGG - Intergenic
945701538 2:213176836-213176858 CTGGGGATAGGAGGAAAGGCTGG + Intergenic
945747098 2:213731622-213731644 CAGGGGGTGGGAAGAGGGGCAGG - Intronic
945768023 2:214004214-214004236 CTGCAGAAGGGAAGAGGGTCTGG + Intronic
945830455 2:214778195-214778217 TTGGGGGTGGGGGGAGGGGCGGG - Intronic
945933680 2:215881614-215881636 CTGGGAATTGGAGGAGGGGTAGG + Intergenic
946188299 2:217994136-217994158 CTGGGGCTGGGGTGAGGGTGGGG + Intronic
946192687 2:218015819-218015841 CTGGGGATGGGGAGTGGGACAGG + Intergenic
946248077 2:218398503-218398525 CTGAGGCTGGGAGTAGGGGCGGG - Intronic
946276511 2:218635723-218635745 CTGGGGTTGGGAGTAGGGTCGGG + Intronic
946295797 2:218782461-218782483 CTGGGGATGGGAGTGGGCACCGG + Intronic
946310010 2:218878113-218878135 CTGGGGCTGGGCTGAGGGCCAGG + Intergenic
946335224 2:219031306-219031328 CTGGGGGTGGGGGGCAGGTCAGG + Intronic
946364161 2:219238201-219238223 CTGGGGAAGGGAGGAGTTTGGGG + Intronic
946390693 2:219415075-219415097 CAGGGGCTGGGAGGAGGGGAAGG + Intergenic
946584553 2:221170240-221170262 CTGGGGAAGGGAGCATGGTGTGG - Intergenic
946660284 2:221992246-221992268 CTGGAGATGAGAGGAGGGAAAGG - Intergenic
946734860 2:222744115-222744137 ATGAGGGTGGGAGGAGGGACAGG + Intergenic
946756925 2:222956751-222956773 GTGGGGGTGGGAGCAGGGTGAGG - Intergenic
946783590 2:223219120-223219142 CTGGGGAAGGGAGGAATGTTTGG - Intergenic
947740249 2:232481666-232481688 GTGGGGAGGGGAGGGGGCTCAGG - Intronic
947774035 2:232693670-232693692 TTGAGGATGGGAGGAGGGTAAGG - Intergenic
947828657 2:233123964-233123986 GAGGGGGTGGGAGGAGGGACAGG + Intronic
948070142 2:235114231-235114253 GTGGGGCTGGGTGGAGGTTCGGG - Intergenic
948133753 2:235620592-235620614 CTGTGGCTGGGAGGAAGGCCAGG - Intronic
948157709 2:235797568-235797590 GGGGGGACGGGAGGAGGCTCTGG + Intronic
948467365 2:238158845-238158867 ATGGGGATGGGGGGAGTGTCCGG - Intergenic
948802676 2:240440008-240440030 CCGGGGATGGGATGGGGGTGGGG - Intronic
948809132 2:240466035-240466057 CTGGGAAGGAGAGGAGGCTCCGG - Intronic
948824474 2:240567706-240567728 CTGGGGTACGAAGGAGGGTCTGG - Intronic
948854779 2:240725004-240725026 CAGCGGATGGGAGGAGGGGCAGG - Intronic
948893360 2:240917398-240917420 CTGGGGTTGGGAGGAGGGTGGGG + Intergenic
1168945686 20:1755017-1755039 CTGGGAAGGGTAGGAGGGTAGGG + Intergenic
1168956607 20:1838669-1838691 AGGGGGATGGGAGGAGGATCAGG - Intergenic
1169207397 20:3748194-3748216 CTGGGGATGGGTGGTGGGCAGGG - Intronic
1169235153 20:3924762-3924784 CTGGGTACTGGAGGAGGGTGAGG - Intronic
1169366292 20:4995482-4995504 CTGAGGATGTGATGGGGGTCAGG - Intronic
1170314426 20:15027998-15028020 CTTGGGAAGAGAGGAGGGCCAGG - Intronic
1170774922 20:19366843-19366865 CTGGGGGTGGGAGGTGGGAATGG - Intronic
1170851532 20:20009217-20009239 ATGGGATTGGGAGGAGGCTCAGG - Intergenic
1171282493 20:23912394-23912416 CAGGGGGTGAGAGGAGGGTGGGG + Intergenic
1171320671 20:24241594-24241616 TTGGGGGTGGGAGGAGGGACAGG - Intergenic
1171542932 20:25978335-25978357 CTGGGGATGGGAATAAAGTCTGG - Intergenic
1171845971 20:30274980-30275002 CTGGGGATGGGAATAAAGTCTGG - Intergenic
1172125117 20:32621114-32621136 CTGGGGTGGGGAGGAGGCTGGGG + Intergenic
1172170727 20:32930375-32930397 CTGAGGAAGAGAGGAGGGCCCGG - Intronic
1172525836 20:35600349-35600371 CTGGGGCCGGGAGGAGGGAGAGG - Intergenic
1172620761 20:36316806-36316828 CTGGGGAGGAGAGGAGTGACGGG - Intronic
1172846266 20:37931514-37931536 CGGGGGATGGGTGGAGGGGGTGG - Intronic
1172896315 20:38302857-38302879 ATGGTGATGAGAGGAGGGGCGGG - Intronic
1173162846 20:40664920-40664942 CGGGGGAGGGGAGCAGAGTCTGG + Intergenic
1173485428 20:43437562-43437584 ATGGGGGAGGGAGCAGGGTCAGG + Intergenic
1173697561 20:45032409-45032431 CAGAGGGTGGGAGGAGGGTGAGG - Intronic
1173857078 20:46257350-46257372 CTGGGGTTGGGAGGAGCCTATGG + Intronic
1174080388 20:47967229-47967251 CTGGGGCTGGGGGCAGGGACAGG + Intergenic
1174137205 20:48388044-48388066 CTGGGGCTGGGGGCAGGGTCAGG - Intergenic
1174321054 20:49741950-49741972 CAGGGGCTGGGAGGCGTGTCAGG - Intergenic
1174749438 20:53097154-53097176 AGGGGGATGGGATGAGGGACAGG + Intronic
1175112740 20:56660152-56660174 GCAGGGATGGGAGGAGGCTCTGG - Intergenic
1175175906 20:57112004-57112026 CAGGGGATGCGGGGAGGGGCAGG + Intergenic
1175229027 20:57461832-57461854 CTAGGGAGGGGAGGAGGATGTGG - Intergenic
1175465019 20:59185007-59185029 CTGGGGATGGCAACAGGGTGAGG + Intergenic
1175515620 20:59568150-59568172 CAGGGGAGGGGAGGAGGGATAGG + Intergenic
1175627286 20:60500237-60500259 ATGGGGATGGGACGAGGTTATGG + Intergenic
1175627295 20:60500262-60500284 ATGGGGATGGGATGAGGTTATGG + Intergenic
1175627303 20:60500287-60500309 ATGGGGATGGGATGAGGTTATGG + Intergenic
1175627336 20:60500399-60500421 ATGGGGATGGGATGAGGTTATGG + Intergenic
1175627386 20:60500661-60500683 TTGGGGATGGGATGAGGTTATGG + Intergenic
1175627410 20:60500755-60500777 ATGGGGATGGGATGAGGTTATGG + Intergenic
1175789480 20:61732466-61732488 CTGAGGATGGGAGGAGACTGGGG - Intronic
1175806042 20:61829919-61829941 CTGGGGCTGGGAGGCAGGTGTGG + Intronic
1175945091 20:62554980-62555002 CTGGGGACGCGGGCAGGGTCAGG + Intronic
1175989175 20:62779027-62779049 CTGGGGCTGGGATGCGGGACGGG - Intergenic
1176363907 21:6021097-6021119 CTGGAGCTGGCAGGAGAGTCTGG - Intergenic
1176409129 21:6438264-6438286 CTGGGGAGGTGTGGAGGGTGAGG - Intergenic
1176714510 21:10338696-10338718 CTGGGGAGGTGGAGAGGGTCGGG + Intergenic
1176850032 21:13906289-13906311 CTGGGGGTGGGCTCAGGGTCAGG + Intergenic
1177904377 21:26957967-26957989 TTGGGGATGGGATGGGGGACAGG + Intronic
1178212098 21:30547424-30547446 TGGGTGATGGGAGGAGGGTAAGG - Intronic
1178358829 21:31931603-31931625 CTGGGGAAGGGAGTAAGGACAGG - Intronic
1178587944 21:33885554-33885576 TTGGGGTTGGGAGTAGGGTCCGG + Intronic
1178773591 21:35528190-35528212 GTGGGGAGGGAAGGAGGGTCTGG + Intronic
1178824641 21:36004984-36005006 CAGGGGAAGGGAGGAGGGGGAGG + Intergenic
1179684622 21:43046586-43046608 CTGGGGAGGTGTGGAGGGTGAGG - Intergenic
1179713120 21:43274384-43274406 CTGGGGAGGGGAGGGGAGCCCGG - Intergenic
1179759611 21:43517448-43517470 CTGGAGCTGGCAGGAGAGTCTGG + Intergenic
1179784322 21:43720858-43720880 AGGTGGATGGGAGGAGGGACGGG - Intronic
1180042302 21:45287139-45287161 CGGGGGCTGGGGGCAGGGTCGGG - Intronic
1180059128 21:45375617-45375639 TTGGGGAATGGAGGAGGGGCAGG + Intergenic
1180068378 21:45424089-45424111 CTGGTGCTGGGGGGAGGGTAGGG + Intronic
1180126268 21:45792295-45792317 CTTGGGATGCCAGGAGGGGCGGG + Intronic
1180152865 21:45960851-45960873 GTGAGGATGTGAGCAGGGTCAGG - Intergenic
1180163115 21:46006819-46006841 CAGGGGCTGGGAGGAGGCTGGGG + Intergenic
1180642598 22:17311130-17311152 CTGGGATTAGAAGGAGGGTCAGG + Intergenic
1180655798 22:17419382-17419404 CTGGGGATTGGAGGAGGTTGTGG + Intronic
1180914785 22:19478724-19478746 CTGGGGATGGGAACAGAATCAGG - Intronic
1180975707 22:19846947-19846969 CTGAGGATGGGAGGATGGGAGGG - Exonic
1181015489 22:20066235-20066257 CAGGGGATGGTAGGAGGGGCAGG + Intergenic
1181164876 22:20977818-20977840 CTGGGAGTGGCAGGAGGTTCAGG + Intronic
1181312477 22:21952734-21952756 ACGGGGCTGGGACGAGGGTCAGG - Intronic
1181358094 22:22314050-22314072 CTGAGGATGGAAGAAGGGTGCGG + Intergenic
1181436810 22:22915936-22915958 CTGTGGGTGGGGTGAGGGTCGGG - Intergenic
1181437651 22:22919862-22919884 CTGTGGGTGGGGTGAGGGTCGGG - Intergenic
1181438299 22:22922917-22922939 CTGTGGGTGGGGTGAGGGTCGGG - Intergenic
1181519581 22:23437380-23437402 CTGGGGCGGGGAGGAGGCTGGGG - Intergenic
1181570654 22:23766351-23766373 CTGGGGATGTGGGGAGGGGCAGG - Intronic
1181636683 22:24177890-24177912 GTGGGGGTGGCAGGAGGGCCTGG + Intronic
1181727247 22:24820119-24820141 CTGGGGATAGAAGGAGGCTGGGG + Intronic
1181999098 22:26905521-26905543 TTGAGGATGGGAGGAGGGAGTGG + Intergenic
1182325827 22:29511987-29512009 CTGGGGATGACAGGAGGAGCAGG - Intronic
1182654503 22:31879304-31879326 CTGGGGGTGGGAGGAGGAGTTGG - Intronic
1182705828 22:32279830-32279852 GTGGTGCTGGGAGGAGGGTCTGG - Intergenic
1182718562 22:32378846-32378868 CTAGGGATGTGGGAAGGGTCTGG + Intronic
1183314500 22:37129461-37129483 CTGGGGATGGGAGGCGGAGGGGG - Intronic
1183384045 22:37504746-37504768 CAGGGAATGGGAGGAGGCACAGG + Exonic
1183405349 22:37627802-37627824 CTGGGGAATGGAGGAGGCCCTGG + Intronic
1183539136 22:38419468-38419490 CTGGTGACAGGCGGAGGGTCAGG + Intergenic
1183639335 22:39083621-39083643 CGGGGGAAGGAAGGAGGGTGGGG + Intronic
1184073289 22:42160425-42160447 GTGGGGATGGGAGGAGGTCCAGG - Exonic
1184130197 22:42512996-42513018 CTGGGGGTGAGAGGAGGCGCGGG + Intronic
1184140373 22:42574819-42574841 CTGGGGGTGAGAGGAGGCGCGGG + Intergenic
1184240333 22:43208461-43208483 GAGGGGATGGGGGGAGAGTCAGG - Intronic
1184245256 22:43232548-43232570 CTGGGAAAGGGGGGAGCGTCAGG - Intronic
1184393008 22:44216232-44216254 CTGAGGATGGGAGGAAAGCCAGG - Intronic
1184394160 22:44222900-44222922 GTGGTGCTGGGAGGAGGGTCTGG - Intergenic
1184403651 22:44287821-44287843 CTGGGGAAAGCAGGAGGGCCTGG - Intronic
1184469871 22:44690350-44690372 CAGGGGGAGGGAGGAGGGCCAGG + Intronic
1184580391 22:45413126-45413148 CAGGGTGTCGGAGGAGGGTCGGG + Intronic
1184659680 22:45960129-45960151 CTGGGGCTGGGAGGTGGCTCAGG - Intronic
1184685949 22:46096420-46096442 TGTGGGATGGGAAGAGGGTCGGG + Intronic
1184767294 22:46578290-46578312 CTGGGCCTGGGAGGGAGGTCAGG + Intronic
1184822126 22:46917379-46917401 CTGGGCCTGAGAGGAGGGCCTGG + Intronic
1184858326 22:47158586-47158608 CTGTGTGTGGGAGGAGGGCCGGG + Intronic
1184880153 22:47299536-47299558 CTTGGGGTGGGAGAAGGGTGGGG - Intergenic
1185041978 22:48508958-48508980 CTGGAGAGGGGAGGAGGCTAGGG - Intronic
1185071617 22:48659690-48659712 CTGGGGGTGGCAGCAGGGGCCGG + Intronic
1185147191 22:49144863-49144885 CTGGGAAGGGGAGCAGGCTCAGG + Intergenic
1185253801 22:49820488-49820510 CTGAGGCTGGGAGGAGGCTGAGG + Intronic
1185296352 22:50057161-50057183 CTGGGGATGGGAGTCAGGTCTGG + Intergenic
1185296626 22:50058042-50058064 CCGGGTGTGGGAGGCGGGTCTGG + Intergenic
1185334044 22:50263635-50263657 CTGGGCGTGGGGGGAGTGTCTGG - Intergenic
949378593 3:3418707-3418729 CTGGGAATGGTAGGAGGGAGAGG - Intergenic
949605751 3:5651569-5651591 CTGGGGAATGGCGGAGGGTAAGG + Intergenic
950074844 3:10180190-10180212 TTGGGGATGTGAGGAGGGGTGGG - Intronic
950362379 3:12458886-12458908 CTGGGGAGGGCAGAAGGGTGGGG + Intergenic
950453206 3:13077348-13077370 ATGGGGATGGGAGGAGGGCAGGG - Intergenic
950652134 3:14413709-14413731 GTGGGGCTGGGGGAAGGGTCAGG + Intronic
950653531 3:14422641-14422663 CTCTGGCTGGGAGGAGGGTGGGG - Intronic
950740261 3:15045306-15045328 CTGGGAATGAGAGGAGGGGCTGG - Exonic
950962842 3:17123493-17123515 GTGGGGAAGGGAGTAGGGTCTGG + Intergenic
950965077 3:17140304-17140326 CTGGGGTTGGGATGTGGGGCTGG + Intergenic
950968842 3:17166487-17166509 ATGGGCATGGCAGGAGGCTCAGG + Intronic
951819768 3:26795077-26795099 CTGTGGTTGGGAGGAGGGAGAGG + Intergenic
952088398 3:29854148-29854170 CTGGAGCTGGGAGGAGGCTGGGG - Intronic
952138545 3:30452421-30452443 TTGGGTATAGGAGGAGGGTAAGG - Intergenic
952439859 3:33315987-33316009 CTGGGGATGAGAAGAAAGTCAGG - Intronic
952816341 3:37451267-37451289 GTGGGGATGGGGGTAGGGTTAGG + Intergenic
952959466 3:38580459-38580481 CTGGGTGTGGGAGGAGGGGAAGG + Intronic
952960565 3:38586727-38586749 CAGTGGATGGGAGTGGGGTCGGG - Intronic
953032854 3:39189361-39189383 CTGGGGGTGGAGGGAGGGGCAGG + Exonic
953634640 3:44652403-44652425 CTGGGGGTTGGAGGAGACTCTGG + Intronic
953785379 3:45907231-45907253 CTGGGCAGGGGAGGAGGCTTAGG - Intronic
953863409 3:46564263-46564285 CTGGGTTGGGGAGGAGGGTGTGG - Intronic
954276870 3:49547908-49547930 CTGGAGATGGAAGGTGGGCCTGG + Intergenic
954395552 3:50291601-50291623 AGGGGGAAGGGAGGAGGGCCGGG - Intronic
954464511 3:50646674-50646696 GTGGGGAAGGGTGGAGGGGCTGG + Intronic
954553177 3:51499311-51499333 ATGGGGATGGGAGGAGCGCCCGG + Intronic
954656289 3:52196240-52196262 TTGTGGCTGGCAGGAGGGTCAGG - Intergenic
954665243 3:52248063-52248085 CTGGTGGTTGGAGGAGGGACTGG + Intronic
954668918 3:52277721-52277743 CAGGGGATGGGCGGAGTGCCAGG + Intronic
954701069 3:52451198-52451220 CTGGGGTTGGGGAGGGGGTCGGG - Exonic
954854086 3:53627603-53627625 CTGTGGATGGGTGGGGGGTGGGG + Intronic
955929524 3:64042511-64042533 TTAGGTATGGGAGGAGGGTGAGG - Intergenic
956991506 3:74771725-74771747 ATGGGGAAGGGAGGAGAGTGGGG + Intergenic
957593211 3:82226163-82226185 CTGTGGGTGGGGGGTGGGTCAGG + Intergenic
958064664 3:88528349-88528371 CTGGGTAGGGGAGGAGGTACTGG + Intergenic
959570365 3:107876578-107876600 CTGGGGCTGGGAGCTGGGTGGGG + Intergenic
960147438 3:114218238-114218260 CTGGGGAAGGGATCAGGGTTGGG + Intergenic
960378528 3:116932382-116932404 CTGAGGGTGGGAGGTGGGGCTGG - Intronic
960501994 3:118449132-118449154 CAGGGGTTGGGAGGAGGGAGAGG - Intergenic
960637175 3:119795297-119795319 AGGGGGATGGGAAGAGGGTGGGG + Intronic
960743022 3:120855783-120855805 CTGTGGAGGGGAGCAGGGCCAGG + Intergenic
960882787 3:122362797-122362819 TTGGGGTTGGGGGGAGGGTAGGG - Intronic
961172699 3:124809461-124809483 ATGGGGATGAGAGGTGGCTCTGG - Intronic
961281056 3:125766289-125766311 CTGGGGCGGGGAGGAGGTGCAGG + Intergenic
961432102 3:126890539-126890561 TTGGGGATGAGAGTAGGGACTGG + Intronic
961469772 3:127104298-127104320 CAGGGGCTGGGAGGAGGGCATGG - Intergenic
961663375 3:128482003-128482025 CTGGGGGTGGAGCGAGGGTCAGG - Intronic
962632010 3:137286823-137286845 CTGGAGATGGGGGCAGGGTGAGG - Intergenic
962736272 3:138328344-138328366 CTGGGGGTGGGAGGGGTGTGGGG - Intronic
962832773 3:139158848-139158870 CAGAGGCAGGGAGGAGGGTCTGG + Intronic
962920213 3:139943678-139943700 CTGGGGATGGGAGCTGGAACAGG + Intronic
963051463 3:141147314-141147336 CTGTGAATGACAGGAGGGTCGGG - Exonic
963066954 3:141271685-141271707 ATGGGGATGGCAGGAGGGAGGGG + Intronic
964720372 3:159763812-159763834 CGGCGGGTGGGAGGAGGGGCCGG + Intronic
964912023 3:161794637-161794659 CTGGGGAGGGGAGGAGTGGAGGG - Intergenic
965540409 3:169865915-169865937 CTGGGGATGGGAGAAGAATGTGG + Intronic
965597252 3:170421145-170421167 CTGGGGGTGGGGGGGGGGTGGGG + Intronic
965686557 3:171309406-171309428 TGGAGGATGGGAGGAGGGTGAGG + Intronic
966744473 3:183262769-183262791 CTGGGAAAGGGAGAAGGTTCGGG + Intronic
966907505 3:184538583-184538605 CTGGGCCTGGGAAGAGGCTCTGG - Intronic
966919633 3:184603146-184603168 TTGGGGATGGGTGGAGTGGCAGG - Intronic
966961527 3:184944410-184944432 CAGGGGATGGGGGTAGAGTCGGG - Intronic
967318048 3:188168965-188168987 CTTGGGATGGGAGGTGGGGGAGG - Intronic
967575303 3:191082912-191082934 CAGGGGGTGGGAGGAGGGAGAGG + Intergenic
967943928 3:194787223-194787245 GTGGGGATGGGGTGAGGGTGGGG + Intergenic
967995039 3:195160130-195160152 CTGGGGATAGGAGAAGGGAAAGG - Intronic
968470919 4:781976-781998 CTGGGGAAGGGAGCGGGGACCGG - Intergenic
968489197 4:881104-881126 CTGTGGACGGGGCGAGGGTCAGG - Intronic
968518983 4:1027275-1027297 CTGGGGATGGGGCCAGGCTCAGG + Intergenic
968646926 4:1745880-1745902 CTGGAGATGGGGTTAGGGTCGGG - Intergenic
968771732 4:2511807-2511829 CTGTGGGTGGGAGGAGGGTGGGG + Intronic
968956477 4:3722259-3722281 TGGGGGCTGGGTGGAGGGTCAGG + Intergenic
968956497 4:3722304-3722326 GTGGGGCCGGGTGGAGGGTCAGG + Intergenic
968958241 4:3730047-3730069 CTCTGGATAGGGGGAGGGTCTGG - Intergenic
968997774 4:3956093-3956115 AAGGGACTGGGAGGAGGGTCGGG + Intergenic
969016632 4:4107785-4107807 CTGGGGCAGGGAGGAGGTGCAGG - Intergenic
969271476 4:6106127-6106149 GTGGGGCTGGCAGGAGGGTCAGG - Intronic
969340304 4:6536100-6536122 CTGAGGAAGGGATGAGGGTTAGG + Intronic
969537820 4:7767570-7767592 CTGGGGAAGGGAGGAATGGCTGG - Intronic
969619781 4:8273218-8273240 CTGAGGCTGGGAGTCGGGTCAGG + Intronic
969622002 4:8283369-8283391 CTGGGGATGGTGGCAGGGACCGG - Intronic
969796528 4:9532118-9532140 CTGGGGCGGGGAGGAGGTGCAGG + Intergenic
969816552 4:9691727-9691749 CAGGGACTGGGAGGTGGGTCGGG - Intergenic
969837698 4:9856963-9856985 TGAGGGATGGGAGGAGGGTGAGG + Intronic
970553667 4:17209756-17209778 TTGGGGGTGGGAGGAGGGAGAGG + Intergenic
970636862 4:18020715-18020737 ATGGGGATGGGAGGTGGGGAGGG + Intronic
971763704 4:30802724-30802746 GTGGGGATCTGAGGAGGGTGTGG + Intronic
972169749 4:36331594-36331616 GTGGGAATGGGAGGAGTGTGAGG + Intronic
972225980 4:37012510-37012532 CTGGGAAGGGGAGTAGGGTGAGG + Intergenic
972344670 4:38182836-38182858 CGGGGGATGGGGGGAGGCTCAGG - Intergenic
973566041 4:52188641-52188663 CAGAGGGTGGGAGGAGGGTGAGG - Intergenic
974015998 4:56649816-56649838 CTGGGGATAGGGCCAGGGTCTGG + Intronic
974961007 4:68700227-68700249 CAGGGGATGCGAGGAGGGAGAGG + Intergenic
976299441 4:83504170-83504192 CTGGGGCTGGGGGCAGGGGCAGG + Intronic
976450285 4:85181685-85181707 CGGGGGATGGGAGGGGGGTGAGG - Intergenic
976662552 4:87554808-87554830 CAGGGACTGGGAGGAGGGTGGGG - Intergenic
977372898 4:96162709-96162731 CCTGGGGTGGGAGGAGGGTAAGG + Intergenic
977903627 4:102451193-102451215 TGGAGGATGGGAGGAGGGTAAGG + Intergenic
977959091 4:103064488-103064510 CTGGGGAGGGGAGGAGCTTGGGG + Intronic
978115440 4:105014838-105014860 CTGGTGATGGTAGGAGAGGCAGG - Intergenic
978160951 4:105547359-105547381 TTTTGGATGGGAGGAGGGTGAGG + Intergenic
978314697 4:107422692-107422714 GGGGTGATGGGAGGAGGGTAAGG + Intergenic
978358854 4:107906937-107906959 TTGGGGGTGGGAGGCGGGTAGGG + Intronic
978620691 4:110632545-110632567 CCGGGGACGGGAGGAGGGGGAGG + Intronic
979238092 4:118424195-118424217 CTGGGGAAGGGAGCTGGGGCTGG - Intergenic
979523179 4:121691533-121691555 CTGGAGGTGGGGGGAGGGTGCGG - Intronic
980333643 4:131440966-131440988 GTGGGCATGGCCGGAGGGTCTGG + Intergenic
980689335 4:136273920-136273942 TGGGGGATGGGAGAAGGGTGAGG + Intergenic
981868262 4:149454469-149454491 TTGGGAGTGGGAGGAGGGTGAGG + Intergenic
983585731 4:169352694-169352716 CTTGGGATGGGAGGAGGGAATGG + Intergenic
983631881 4:169857422-169857444 CAGGGGCTGGGAGGAGGGGGAGG + Intergenic
983677282 4:170310207-170310229 CTGGGAATGGGAGGGGGGCAAGG + Intergenic
984129732 4:175859056-175859078 CTGGGGATGGAAGGAGGAGATGG + Intronic
984518138 4:180767547-180767569 CTGGGGAAGCAAGCAGGGTCAGG - Intergenic
984905490 4:184622105-184622127 CTGGGGGTTGGTGGAGGGTGAGG - Intergenic
985013456 4:185607312-185607334 TTGTGGGTGGGAGGAGGGGCTGG + Intronic
985285527 4:188332966-188332988 TTGGGGATTGGACGTGGGTCTGG + Intergenic
985542168 5:492259-492281 CAGGGGAGGGGAGGGAGGTCGGG + Intronic
985542225 5:492387-492409 CAGGGGAGGGGAGGGAGGTCGGG + Intronic
985542240 5:492420-492442 CGGGGGAGGGGAGGGAGGTCAGG + Intronic
985668387 5:1193535-1193557 CTGGGTGTGGGTGGAGGGGCAGG + Intergenic
985921540 5:2981211-2981233 CTGGGCATGGGAGGTTGGCCTGG - Intergenic
986149231 5:5111661-5111683 CTGGGGATCGTTTGAGGGTCAGG + Intergenic
986435767 5:7728821-7728843 CTGGGGATGGGGAGAGTGACTGG + Intronic
987710816 5:21499127-21499149 CTGGGGAGGGGACAAGGGGCTGG - Intergenic
987730152 5:21759822-21759844 GTGAGGATGGGAGGAGGGAAAGG - Intronic
988428100 5:31087567-31087589 GTGGGGAGGGGAGGAGGGCAGGG - Intergenic
988497603 5:31758333-31758355 CTGGAGATGGAATGAGGGTTGGG + Intronic
988646019 5:33096058-33096080 CTGGGGATGGTAGTGGGGTAAGG - Intergenic
988837594 5:35048286-35048308 CTGGGTGTGGGAGAAGGATCAGG + Intergenic
988856084 5:35229560-35229582 CTGGAGAAGGGAGGAGGGAAGGG - Intronic
988976284 5:36519458-36519480 TGGAGGATGGGAGGAGGGTGAGG + Intergenic
989328187 5:40224663-40224685 CTCGGGATGGGAGGAAGTTTTGG - Intergenic
989421389 5:41242990-41243012 CTGGGGATGGGAGGAGGAATGGG + Intronic
989550215 5:42726336-42726358 CTGGGGATGGGAAGTGGGGAAGG - Intergenic
989822057 5:45804964-45804986 CGGGGGGTGGGAGGAGGGAGAGG - Intergenic
990191527 5:53265228-53265250 CTGAGAATAGGAGGAGGGTCAGG - Intergenic
990260995 5:54022320-54022342 CAGGGGACTGGAGGAGGGTGAGG - Intronic
990448722 5:55916516-55916538 CTGGGCCTGGGAGGAAGGTGGGG + Intronic
990486370 5:56262965-56262987 CTGGGGATGGGATGAGAGGGTGG + Intergenic
990508774 5:56471006-56471028 GGTGGGATGGGATGAGGGTCGGG + Intronic
991095934 5:62739661-62739683 CTGGGGATGGGATGAAGGTAAGG + Intergenic
991459007 5:66836791-66836813 TTGAGGTTGGGAGGAGGGTGAGG + Intronic
991743810 5:69710630-69710652 CGGGGGCGGGGAGGAGGGTGAGG + Intergenic
991753903 5:69844612-69844634 CGGGGGCGGGGAGGAGGGTGAGG - Intergenic
991761156 5:69918185-69918207 CTGGGGAGGGGACAAGGGGCTGG - Intergenic
991786173 5:70199915-70199937 CTGGGGAGGGGACAAGGGGCTGG + Intergenic
991795382 5:70290362-70290384 CGGGGGCGGGGAGGAGGGTGAGG + Intergenic
991803528 5:70401367-70401389 CGGGGGCGGGGAGGAGGGTGAGG - Intergenic
991823177 5:70585898-70585920 CGGGGGCGGGGAGGAGGGTGAGG + Intergenic
991833215 5:70719725-70719747 CGGGGGCGGGGAGGAGGGTGAGG - Intergenic
991840384 5:70793235-70793257 CTGGGGAGGGGACAAGGGGCTGG - Intergenic
991878617 5:71200301-71200323 CTGGGGAGGGGACAAGGGGCTGG + Intergenic
991887749 5:71289881-71289903 CGGGGGCGGGGAGGAGGGTGAGG + Intergenic
992017589 5:72591712-72591734 CTGGAGAGGTAAGGAGGGTCTGG + Intergenic
992466028 5:77005731-77005753 CTTGGGATGGGAAGAGTCTCTGG + Intergenic
992530069 5:77645028-77645050 GCGGGGAGGGGACGAGGGTCTGG - Intergenic
992626962 5:78645083-78645105 CTGGGGGTGGTAGCAGGGTATGG - Intronic
992655947 5:78909757-78909779 CTCGGGCTGGGGGGATGGTCAGG - Intronic
993881202 5:93363431-93363453 GTGGGGATGGGAGAAGGGAGGGG + Intergenic
994257644 5:97618352-97618374 AGGGGGATGGGAAGAGGGTAAGG - Intergenic
995342341 5:111073413-111073435 AAGGGGAGGGGAGGAAGGTCAGG - Intronic
995659147 5:114461708-114461730 CTTGGCATGGGATGAGGGACAGG + Intronic
995859900 5:116629977-116629999 CTGGGGAGGGGAGTGTGGTCTGG - Intergenic
996039276 5:118792529-118792551 CTGGGGATGTGAGGAGAGCTGGG - Intergenic
996276140 5:121668233-121668255 CTGGGGATGGTGGTGGGGTCGGG + Intergenic
996581323 5:125035201-125035223 AGTGGGATGGGAGGAGGGTGAGG - Intergenic
996747500 5:126857883-126857905 CTGGGGAAGGGATGAGAGCCAGG + Intergenic
997286690 5:132684642-132684664 CTGTGGGTGGGAGGCGGGTGTGG + Intergenic
997356559 5:133266478-133266500 CTGGGGAAGGGTGGAGAGGCAGG - Intronic
997457038 5:134025264-134025286 ATGGGGTTGGGAGGAGGTTGTGG + Intergenic
997583098 5:135029328-135029350 GAGGGGACGGGAGAAGGGTCAGG + Intronic
997618946 5:135272449-135272471 CTGGGGATGGGAGCATGGTGGGG + Intronic
997767430 5:136519085-136519107 CTGGGTACTGAAGGAGGGTCTGG + Intergenic
997817466 5:137033025-137033047 CTGGGGATGGGCAGAGAGGCAGG + Intronic
997887523 5:137643879-137643901 CTGGGGAAGGGAGGAGGGAGGGG - Intronic
998136714 5:139677925-139677947 CTGGAGCTGGGAGGAGGGAGGGG + Intronic
998385983 5:141757498-141757520 CTGGGGGTGGGAGGTGGGGAGGG - Intergenic
998467329 5:142356713-142356735 CTGGGGTTGGGGGGAGGGACGGG + Intergenic
998578218 5:143340965-143340987 CTGAGGGTGGGAGGAGGGAGAGG - Intronic
998583821 5:143405079-143405101 CTGGGGAAGGGAGCTGGGGCGGG - Intronic
998913659 5:146991415-146991437 CTAGGGATGGGAGGCGGGAGAGG + Intronic
999103064 5:149043322-149043344 CTGGGCATTGGAGGAGGGGCAGG - Intronic
999124631 5:149238199-149238221 CTGGAGATGGCAGCAGGGTTGGG + Intronic
999196661 5:149786028-149786050 CTGGGGATGGGGGCAGAGGCAGG - Intronic
999258096 5:150220963-150220985 CCAGGGATTGGAGGAGGCTCCGG - Intronic
999369401 5:151044763-151044785 CTGGGGGTGTGAGGAGGGGGAGG + Intronic
999768454 5:154757066-154757088 CTGGGGGTGGCAGGAGGGTGCGG + Intronic
1000125282 5:158237648-158237670 CTGGGAATGGGATGAAGGTAGGG + Intergenic
1000222495 5:159227445-159227467 GTGGAGAGGGGAAGAGGGTCTGG - Intergenic
1000510138 5:162170723-162170745 GTGGGGTTGGGAGGAGGGAGAGG + Intergenic
1001269741 5:170302311-170302333 GTGGGGCTGGGGGAAGGGTCTGG + Intergenic
1001430741 5:171660034-171660056 CTGGGGATGGGGGGTGGGGAAGG - Intergenic
1001503477 5:172257126-172257148 CAGAGGATGGGAGGAGGGTGAGG - Intronic
1001640456 5:173240262-173240284 CTGGGGAGGGGTGGGGGGTGAGG - Intergenic
1001670432 5:173468857-173468879 ATGGGGATGTGATGAAGGTCAGG + Intergenic
1002091757 5:176810400-176810422 CGGGGGAAGGAAGGAGGGGCCGG - Intergenic
1002565890 5:180112943-180112965 CCGGGGATGGACGGAGGGACCGG + Intronic
1002565898 5:180112962-180112984 CCGGGGATGGACGGAGGGACCGG + Intronic
1002565921 5:180113019-180113041 CCGGGGATGGACGGAGGGACCGG + Intronic
1002565950 5:180113095-180113117 CTGGGGATGGACGGAGGGACCGG + Intronic
1002565990 5:180113209-180113231 CCGGGGATGGACGGAGGGACAGG + Intronic
1002566023 5:180113304-180113326 CCGGGGATGGACGGAGGGACCGG + Intronic
1002566031 5:180113323-180113345 CCGGGGATGGACGGAGGGACCGG + Intronic
1002566053 5:180113380-180113402 CCGGGGATGGACGGAGGGACCGG + Intronic
1002566089 5:180113475-180113497 CCGGGGATGGACGGAGGGACCGG + Intronic
1002566155 5:180113647-180113669 CCGGGGATGGACGGAGGGACCGG + Intronic
1002566192 5:180113742-180113764 CCGGGGATGGACGGAGGGACCGG + Intronic
1002583943 5:180229506-180229528 CTGGGGATGGGGAGCAGGTCAGG + Intergenic
1002704597 5:181151718-181151740 CTGGGGCTGGGAGGGGCGTCTGG + Intergenic
1002738519 5:181416171-181416193 CTGGGGAAGGGAGCTGGGGCTGG - Intergenic
1002758435 6:183283-183305 CTCCGGGTGGGAGGAGGGCCCGG - Intergenic
1003569708 6:7247874-7247896 CTGCGGCTGAGAGGAGGGACAGG - Intronic
1003915015 6:10778666-10778688 CTGGAGAGGGGAGGAGGGGCAGG + Intronic
1003982206 6:11400617-11400639 CTGGGAAGGGTAGGAGGGTGAGG + Intergenic
1004250338 6:14018263-14018285 CGGGGGGTGGGGGGAGGCTCAGG - Intergenic
1004721885 6:18274978-18275000 CAGGGCAGGGTAGGAGGGTCAGG - Intergenic
1005546871 6:26881376-26881398 CTGGGGAGGGGACAAGGGGCTGG + Intergenic
1005871148 6:29975157-29975179 CTGGGGATGGGAGCAGTCGCAGG + Intergenic
1005897627 6:30191553-30191575 AGGGGGATGGGAGCAGGGGCCGG + Intronic
1005932133 6:30491654-30491676 GTGGGGAAGGGAGAAGGGTGGGG + Intronic
1006081761 6:31572071-31572093 CTGGGAAAGGGAGTCGGGTCAGG - Exonic
1006129339 6:31859946-31859968 CTGGGGAGAGCAGGAGAGTCAGG + Intronic
1006173050 6:32106402-32106424 CTGGGGAAAGGAGGAGGGCAGGG + Intronic
1006392952 6:33769573-33769595 CTGGGGATGGGTGGAGAGGCTGG + Intergenic
1006734183 6:36260828-36260850 CTGGGGCAGGGAGGAGGGTGCGG + Intronic
1006906550 6:37537039-37537061 CTGGGTCTGAGAGGAGGGGCAGG + Intergenic
1007055763 6:38882565-38882587 TTGGGGGTGGGAGAAGGGTGAGG + Intronic
1007089527 6:39173476-39173498 CTGGAGGTGGGAGGATGGTCAGG + Intergenic
1007100055 6:39239843-39239865 GTGGGGAAGGGAGGAGGATGAGG + Intergenic
1007228233 6:40329506-40329528 CTGGGGAGGAGCGGAGTGTCCGG + Intergenic
1007228374 6:40330458-40330480 CTGGGGGTGGGAGGTGGGGGCGG + Intergenic
1007246772 6:40468892-40468914 CAGGGGACAGGAGGAGGGACAGG + Intronic
1007323126 6:41041341-41041363 GTGGGGCTGGGAGGAGGGTGGGG - Intronic
1007341572 6:41194194-41194216 CGGGGGTGGGGAGGAGGGGCAGG - Intronic
1007424449 6:41737672-41737694 TTGGGGTTGGGAGGAAGGGCTGG - Intronic
1007466719 6:42057445-42057467 CTGGGGATGTGCGGCGGGTGGGG - Exonic
1007825083 6:44594410-44594432 CTGAGGAAGGGAGGAGGAGCTGG + Intergenic
1007944924 6:45817623-45817645 TGGGGGGTGGTAGGAGGGTCAGG - Intergenic
1007997650 6:46325588-46325610 CTGGGGACGGCTGGAGGCTCGGG + Intronic
1008022869 6:46600546-46600568 CTGGGGAAGGGAGGTGGGCTGGG + Intronic
1008033662 6:46723982-46724004 GTGGGGATGGAAGGTGGGTGTGG - Intronic
1008540039 6:52538396-52538418 CGGGGGATGGGAGGATGGAGGGG + Intronic
1008923130 6:56863574-56863596 CTGTGAAGGGGAGGAAGGTCAGG - Intronic
1009017626 6:57922458-57922480 CTGGGGAGGGGACAAGGGGCTGG + Intergenic
1009871300 6:69454996-69455018 TTGTGGGTGGGAGGAGGGTGAGG + Intergenic
1010168196 6:72941625-72941647 GTGGGGAAGGGAGGAGGGAGGGG - Intronic
1012294727 6:97507159-97507181 CTGGGGATGGTGGTGGGGTCTGG - Intergenic
1012546361 6:100424057-100424079 CGGGGGGTGGGAGGGGGGTGGGG - Intronic
1012631274 6:101470617-101470639 CTGGGGATGGGGGAAGAGTAGGG + Intronic
1012698695 6:102423405-102423427 CAGAGGATGGGAGGAGAGTGAGG + Intergenic
1012960041 6:105612620-105612642 GTGGGGATGGGAGAAGGTGCTGG + Intergenic
1013209583 6:107974543-107974565 CTGGGGATGGGAGTTGGGGTGGG + Intergenic
1013446689 6:110236022-110236044 TGGGGGATGGGAGGAGGGAGAGG - Intronic
1014769938 6:125449273-125449295 CGGGGGAGGGGAGGATGGTTTGG + Intergenic
1015374372 6:132492917-132492939 CTGGGCATGGGAGGAGAGTGGGG - Intronic
1016125821 6:140401878-140401900 CTAGTAATGGGAGGAGGGTTAGG - Intergenic
1016445591 6:144128600-144128622 TAGGGGATGAGAGGAGGGACAGG - Intergenic
1016702333 6:147067614-147067636 CTGGTGATGGGGAGTGGGTCAGG + Intergenic
1017133829 6:151130732-151130754 CTGGGGATAGCAGGAGGTTTTGG + Intergenic
1017646521 6:156544272-156544294 CGGGGGCTGGGAGGAGGGGATGG - Intergenic
1017882919 6:158573903-158573925 ATGGGGAGGGGAGGAGAGTGGGG + Intronic
1018739162 6:166714172-166714194 GTGGGGATGGGAAGAGGTGCAGG + Intronic
1018902383 6:168058122-168058144 CTGGGCACGGGAGGAGGGAGGGG - Intronic
1018903524 6:168062827-168062849 GTGGGGAAGGGAGGAGGGGGTGG + Intronic
1018919486 6:168161459-168161481 CGGGGGATGGCAGGACGGCCAGG - Intergenic
1019127130 6:169848217-169848239 CAGGTGATGGGCAGAGGGTCAGG - Intergenic
1019243622 6:170691723-170691745 CTGGGGAAGGGAGCTGGGGCTGG - Intergenic
1019335697 7:481571-481593 GTGGGGAGGGGAGGAGTGTGGGG - Intergenic
1019335720 7:481625-481647 TTGGGGAGGGGAGGAGGGTGGGG - Intergenic
1019335729 7:481642-481664 GTGGGGAGGGGAGGAGGTTGGGG - Intergenic
1019391170 7:787448-787470 TTGGGGATGGCTGGAGTGTCCGG + Intergenic
1019493723 7:1326626-1326648 CTGTGGTTGGAAGGAGGGGCAGG - Intergenic
1019528009 7:1489473-1489495 CTGGGGATGAGAGGAGGAGCTGG - Intronic
1019591680 7:1838898-1838920 CTGGGGCGGGGAGGAGGCTGGGG + Intronic
1020770344 7:12384334-12384356 CTGGGGTTGAGAGGAGGGAGGGG + Intronic
1021277854 7:18677135-18677157 CTGGGGCTGGGAGGAGAGTGAGG - Intronic
1021496089 7:21276238-21276260 CTGGGGAGGGGAGGAGGCTGGGG - Intergenic
1022043141 7:26599794-26599816 CTGGGGAGGGGAGGTGTGTGAGG + Intergenic
1022423800 7:30248440-30248462 ATGGAGGTGGGAGGAGGGCCAGG - Intergenic
1022680619 7:32542112-32542134 CTGGAGATGGGAGCAGGGACTGG + Intronic
1023085818 7:36568972-36568994 AAGGGGATGGGAGGAGGGGCAGG + Intronic
1023630276 7:42156814-42156836 CTGGTGATGGGAGGAGGGTGTGG - Intronic
1023781514 7:43660323-43660345 GTGTGGAGTGGAGGAGGGTCAGG - Intronic
1023878706 7:44306790-44306812 GTGGGCAGGGGAGGAGGGTAAGG + Intronic
1024135430 7:46402513-46402535 GTGGAGATGGGAGGAGGGAGAGG + Intergenic
1024891543 7:54210162-54210184 CTGTGGCTGGGAGGTGGGTGAGG - Intergenic
1025030773 7:55554928-55554950 CTGAGGCTGAGATGAGGGTCTGG + Intronic
1025294314 7:57763443-57763465 CTGGGGATGGGAATAAAGTCTGG - Intergenic
1025732433 7:64118501-64118523 CTGGGGAGGGGACGAGGGGCTGG - Intronic
1025828753 7:65032399-65032421 GGGAGGATGGGAGGAGGGTGAGG + Intergenic
1025874024 7:65463077-65463099 CTGTGGCTGGGAGGAGAGTCTGG - Intergenic
1025916275 7:65868808-65868830 GGGAGGATGGGAGGAGGGTGAGG + Intergenic
1026576225 7:71573814-71573836 CAGAGGGTGGGAGGAGGGTGAGG - Intronic
1026671063 7:72391144-72391166 CTGCGGTTGGGAGGTGGGTAGGG - Intronic
1026833595 7:73624138-73624160 GTGGGGATGGGGGGGGGGTCCGG - Intronic
1027218979 7:76202107-76202129 CTGGGGCTGGGTGGAAGCTCGGG + Intronic
1027269773 7:76513061-76513083 CTGGGGATGGGAGGTGGTGGGGG - Intronic
1027320484 7:77006956-77006978 CTGGGGATGGGAGGTGGTGGGGG - Intergenic
1027389799 7:77693479-77693501 TTGGGGATGGGAGGAGAATGGGG + Intergenic
1027400176 7:77798758-77798780 GGGAGGATGGGAGGAGGGGCGGG - Intergenic
1028159962 7:87474886-87474908 CTGGCGATGAGAGGAGGGGGAGG + Intronic
1028162285 7:87499141-87499163 CTAGCGATGGGAGGAGGGGGAGG - Intergenic
1028163714 7:87514417-87514439 CTGGGGATGAGGGAAGTGTCTGG - Intronic
1028758378 7:94464711-94464733 TGGAGGATGGGAGGAGGGTGAGG - Intergenic
1029116165 7:98238325-98238347 GGGGGGGTGGGAGGAGGGTGTGG + Intronic
1029164208 7:98575152-98575174 CAGGGGGTGGGAGGAGGGAGAGG - Intergenic
1029363272 7:100101792-100101814 CTGGGAAGGGGCGGAGGGGCCGG + Exonic
1029485221 7:100836159-100836181 CTGGGAATGGGAGCAGGGGCAGG + Intronic
1029557387 7:101279777-101279799 TTGGGGGTCAGAGGAGGGTCAGG + Intergenic
1029578300 7:101418784-101418806 ATGGGGATGGGAGGAGGAGGTGG + Intronic
1029614905 7:101650168-101650190 CCGGGGATGGGGGCAGGTTCAGG + Intergenic
1029687387 7:102158104-102158126 CTGGGGGTGAGAGGAGGAGCTGG - Intronic
1029873040 7:103715887-103715909 CTGGGGAAAGGAGGACGGCCTGG - Intronic
1030234342 7:107242470-107242492 CTGGGGATGGCTGGAGGCCCAGG - Intronic
1030679177 7:112416159-112416181 ATGAGGATGGGAGAAGGGTGAGG + Intergenic
1031448931 7:121890231-121890253 GTTGGGATGGGAGGAAGATCAGG - Intronic
1031578352 7:123442588-123442610 CCGGGGCTGGGAGCAGGGTAGGG - Intergenic
1032023181 7:128421442-128421464 CTGGGGATGGAGGGAGGCTTGGG - Intergenic
1032147880 7:129400427-129400449 ATGGGGATGGGTGGAGGTTATGG + Intronic
1032331689 7:130986513-130986535 CTGGCGATCAGAGGAGGGGCAGG - Intergenic
1032448420 7:132004387-132004409 CTGGGGTTAGGAGGAGGGAGGGG + Intergenic
1032787014 7:135208890-135208912 CCGGGGATGGCAGGAAGGGCAGG + Exonic
1033137676 7:138798346-138798368 CAGGGGGTGGGAGGTGGGGCTGG + Intronic
1033649250 7:143328313-143328335 CTGGGGTTGGGCAGAGGGACAGG + Intronic
1034965136 7:155386184-155386206 CTGGAGCTGGGAGGAGGCTGGGG - Intronic
1034997466 7:155587212-155587234 ATGGAGATGGGAGGAAGGACGGG - Intergenic
1035230558 7:157463544-157463566 AGGGGGATGGGATGAGGGTGAGG - Intergenic
1035371080 7:158379255-158379277 CTGGGGTTGGCAGGAGGACCGGG + Intronic
1035472198 7:159117635-159117657 CTGAAGATGGAAGGAGGGTGTGG - Intronic
1035504500 8:116437-116459 CTGGGGAAGGGAGCTGGGGCTGG + Intergenic
1035564884 8:634951-634973 CTGGGGAAGGAAGGAGGGAAAGG + Intronic
1035650681 8:1261553-1261575 GTGGGGGTGGGAGGGGGGGCTGG + Intergenic
1035724791 8:1817701-1817723 CTGGGGACGGCAGGAGGGAGGGG + Intergenic
1036242424 8:7091793-7091815 CTGGGGCGGGGAGGAGGTGCAGG + Intergenic
1036359115 8:8065290-8065312 CTGGGGTGGGGAGGAGGTGCAGG + Intergenic
1036830313 8:12015338-12015360 CTGGGGCGGGGAGGAGGTGCAGG - Intronic
1036891843 8:12601662-12601684 CTGGGGTGGGGAGGAGGTGCAGG - Intergenic
1036899393 8:12659637-12659659 CTGGGGCGGGGAGGAGGTGCAGG - Intergenic
1036899986 8:12663233-12663255 GTGGGGAGGGGTGGAGGGTGGGG - Intergenic
1036900460 8:12665784-12665806 CTGGGGCGGGGAGGAGGTGCAGG - Intergenic
1037296115 8:17402402-17402424 CTGGGGAAGGTAGTGGGGTCTGG - Intronic
1037447500 8:18981043-18981065 CGGGGGAGGGGAGCAGGGACAGG - Intronic
1037835172 8:22211409-22211431 CTGGGGAGGGGAGGAGGCGTGGG - Intronic
1038019235 8:23539056-23539078 CTGGGGTTACGAGGAGGGTGGGG - Intronic
1038182270 8:25240460-25240482 CTGGGGCTGTGAGGAGGGAATGG - Intronic
1038266296 8:26041916-26041938 GTCGGGGTGGGAGGAGGTTCGGG + Intronic
1038317504 8:26500222-26500244 TTGAGGGTGGGAGGAGGGACAGG + Intronic
1038804535 8:30778273-30778295 CTTGGTAGGAGAGGAGGGTCTGG - Intronic
1039068763 8:33631948-33631970 GTGGGTATGGGGGGAGGCTCAGG - Intergenic
1039137128 8:34337862-34337884 TGGAGGATGGGAGGAGGGTCAGG + Intergenic
1039225167 8:35380080-35380102 TTGGGGGTGGGGGGGGGGTCGGG + Intronic
1039389196 8:37163367-37163389 CAGGGAAGGGGAGGAGGGTGGGG + Intergenic
1039418877 8:37419338-37419360 TTGGGGATGGGTGGAGAGCCTGG - Intergenic
1039465705 8:37783888-37783910 CTGGGGAAGGGGGGCGGGCCAGG - Intergenic
1039516993 8:38142470-38142492 ATTGGGATGGGAGGGGGGTAGGG - Intronic
1039781721 8:40792715-40792737 GTGGGGAGGGGAGGAGGGGAAGG + Intronic
1040530192 8:48260627-48260649 CTGGGGAAGGAAGGTGGGTGCGG - Intergenic
1040536443 8:48315230-48315252 TTGGGGCAGGGAGGAGGGACTGG + Intergenic
1040883927 8:52238859-52238881 TGGGGGGTGGGAGGAGGGTGAGG + Intronic
1041140957 8:54818978-54819000 CTGGGGATGGGAAGAGGAGGGGG + Intergenic
1041544664 8:59029219-59029241 ATGGGGATGGGGGGTGGGTGGGG - Intronic
1042803435 8:72745733-72745755 CTGGGGAGGGCAGCAGGGGCTGG - Intronic
1042962898 8:74321611-74321633 CCGGGGAGGGGACGAGGGGCGGG - Intronic
1043954235 8:86342711-86342733 GTGGGGGTGGGGGGAGGGTCGGG + Intergenic
1045014314 8:97986438-97986460 CTTGGGGTGGGAGGATGGTGAGG - Intronic
1045178156 8:99749364-99749386 CAGGGGAAGGGAGGTGGGTATGG - Intronic
1045345676 8:101291438-101291460 CTGGGGATGGGGAGAGGGGTAGG + Intergenic
1045554988 8:103207089-103207111 CTGGGGATGGGTGCAGGGTCAGG + Intronic
1045684788 8:104701271-104701293 CTAGGGAAGGGAGGATGGGCAGG + Intronic
1046127147 8:109923984-109924006 TTGAGGATGGCAGGAGGGGCAGG - Intergenic
1046140163 8:110081239-110081261 GTGGGGGTGGGAAGAGGGTAAGG - Intergenic
1046419318 8:113959174-113959196 CTGGGGAAGGGAGGTAGGGCTGG - Intergenic
1046654193 8:116874647-116874669 CCGGGGAGGGGAAAAGGGTCGGG + Exonic
1046661172 8:116949843-116949865 CGGGGGTTGGGAGGAGGCTCGGG + Intergenic
1048236146 8:132692707-132692729 CTGGGAATTGGGAGAGGGTCAGG - Intronic
1048241917 8:132751175-132751197 CTGAGCATGGGAGCAGGGGCTGG - Intronic
1048469002 8:134690687-134690709 CTGGGGATGGGTTGAGGGGATGG - Intronic
1048816868 8:138342344-138342366 CTGGGGAGATGAGGAGGTTCTGG - Intronic
1049204992 8:141359510-141359532 GTGGGGGTGGCAGGAGGGGCTGG - Intronic
1049404326 8:142444953-142444975 CTGGGGGTGGGAGGGGGGCCAGG + Intergenic
1049427966 8:142545681-142545703 CCTGGGGTGGGAGGAGGGTGTGG - Intergenic
1049519481 8:143080689-143080711 CGGGGGCTGGGATGAGGGTCGGG + Intronic
1049578124 8:143398819-143398841 CTGGGCCTGTGGGGAGGGTCTGG + Intergenic
1049580655 8:143409090-143409112 CCAGGGGTGGGAGGAGGGGCAGG + Intergenic
1049773708 8:144395232-144395254 CTGAGGATGGGAGTATGGTGTGG + Intronic
1050010124 9:1177441-1177463 CTGGGGAAGGGAGGAGGGTGTGG + Intergenic
1050427318 9:5524687-5524709 CTGGGGAGGGGAGGAGGTCTGGG + Intronic
1050523765 9:6527959-6527981 TTGGGGAAGAGTGGAGGGTCAGG + Intergenic
1050647038 9:7731483-7731505 CTGGGGAAAGGAGGCGGCTCTGG - Intergenic
1051129995 9:13850038-13850060 TGGAGGATGGGAGGAGGGTGAGG + Intergenic
1051571871 9:18567540-18567562 ATGGGGATAGCAGGAGGATCAGG + Intronic
1052742023 9:32402622-32402644 TTAGGGATGGGATGAGTGTCTGG + Intronic
1053098672 9:35351156-35351178 CTGGGGTTGGGAGGCAGGTCAGG + Intronic
1053141688 9:35686449-35686471 AAGGGGATGGGAGGAGAATCAGG + Intronic
1053441709 9:38121488-38121510 GTGTGGATGGCAGGAGGGACAGG - Intergenic
1053522339 9:38792691-38792713 GTGGGGACAGGAGGAGGGACTGG + Intergenic
1053688627 9:40568182-40568204 CTGAGGATGGAAGAAGGGTGCGG - Intergenic
1054162107 9:61680862-61680884 CTGGGGATGGGAATAAAGTCTGG + Intergenic
1054194566 9:62017111-62017133 GTGGGGACAGGAGGAGGGACTGG + Intergenic
1054275406 9:63062875-63062897 CTGAGGATGGAAGAAGGGTGCGG + Intergenic
1054299867 9:63369093-63369115 CTGAGGATGGAAGAAGGGTGCGG - Intergenic
1054399427 9:64702056-64702078 CTGAGGATGGAAGAAGGGTGCGG - Intergenic
1054433005 9:65186321-65186343 CTGAGGATGGAAGAAGGGTGCGG - Intergenic
1054497378 9:65835354-65835376 CTGAGGATGGAAGAAGGGTGCGG + Intergenic
1054643842 9:67571579-67571601 GTGGGGACAGGAGGAGGGACTGG - Intergenic
1055054669 9:72012753-72012775 CTGGGGATGGGCTGGGGGTAAGG - Intergenic
1055709955 9:79049884-79049906 CTAGGGATGGGAGAAGGGGCAGG + Intergenic
1055936697 9:81610739-81610761 CTGGGGGTGGGAGGGGGGGCAGG - Intronic
1056578406 9:87872806-87872828 CTGGGGCTGGGAGGAAGGTGGGG - Intergenic
1056764234 9:89435085-89435107 CTGGGCATGGGGGAAGGGGCCGG + Intronic
1056817427 9:89811816-89811838 GTGGGGTGGGGAGGAGGGCCGGG + Intergenic
1056832720 9:89929809-89929831 CTGGGGAAGGGAGCAGGGGCTGG + Intergenic
1056832728 9:89929828-89929850 CTGGGGAAGGGAGCAGGGGCTGG + Intergenic
1056849330 9:90068971-90068993 CTGGGGTGGGGAGGAGGGTTGGG - Intergenic
1057040090 9:91841777-91841799 GTGGGGATGGCAGGGAGGTCTGG - Intronic
1057231843 9:93325859-93325881 CTGGGGGTGGGAGGACAGGCTGG + Intronic
1057274965 9:93671296-93671318 GTGGGTGTGGGAGTAGGGTCAGG + Intronic
1057274972 9:93671332-93671354 GTGGGTGTGGGAGTAGGGTCAGG + Intronic
1057275008 9:93671546-93671568 GTGGGTGTGGGAGTAGGGTCAGG + Intronic
1057275015 9:93671582-93671604 GTGGGTGTGGGAGTAGGGTCAGG + Intronic
1057275068 9:93671906-93671928 GTGGGTGTGGGAGTAGGGTCAGG + Intronic
1057275075 9:93671942-93671964 GTGGGTGTGGGAGTAGGGTCAGG + Intronic
1057275082 9:93671978-93672000 GTGGGTGTGGGAGTAGGGTCAGG + Intronic
1057275144 9:93672338-93672360 GTGGGTGTGGGAGTAGGGTCAGG + Intronic
1057548288 9:96034177-96034199 GTAGGGATAGGAGGGGGGTCCGG + Intergenic
1057953157 9:99385987-99386009 CTGGGGGTTGGAGGAGGGCAGGG - Intergenic
1057974468 9:99590014-99590036 CTGGGGATGGGGGTGGGGTAGGG + Intergenic
1058050561 9:100402044-100402066 GTGGGGATGGGAGGTGGGGAAGG - Intergenic
1058633752 9:107016683-107016705 CTGGGGATGGCAGGTGGTACTGG + Intergenic
1058879989 9:109277741-109277763 CTGGGGCTGGGAGGAAGGCCAGG + Intronic
1059340659 9:113595784-113595806 CTGGGGATTGGAGGAGCGGAGGG - Intronic
1059450878 9:114370850-114370872 GTGGGGATGGGGGGAGGGGGAGG - Intronic
1059505881 9:114799595-114799617 CTGGGGATGTGAAGTGGGTGGGG - Intronic
1059822004 9:117983789-117983811 CTCAGGATGGGAGGAAGCTCAGG + Intergenic
1060034995 9:120247589-120247611 CTGGAGTTGGGAGGAGGCTGAGG + Intergenic
1060139936 9:121201393-121201415 TTGGGGAGGGCAGGAGGCTCAGG + Intronic
1060206020 9:121683314-121683336 CTGGGGAAGGGAGCAGGCTAAGG - Intronic
1060269676 9:122131814-122131836 CAGGAGATGGCAGGAGGGCCCGG - Intergenic
1060802045 9:126551031-126551053 CTGGGAATGGGAGGCAAGTCAGG + Intergenic
1061039100 9:128129298-128129320 CTGGGCTTAGTAGGAGGGTCTGG + Intergenic
1061181540 9:129027794-129027816 CTGAGGAGGGGAGGAGGCACCGG - Intronic
1061732789 9:132629442-132629464 CTGCGGATGGGAGACGGGGCAGG + Intronic
1061790516 9:133056743-133056765 CTGGGGGTGGGGAGAGGGTTGGG - Intronic
1061812350 9:133169645-133169667 CTGGCAGTGGGAGAAGGGTCTGG + Intergenic
1062028900 9:134353090-134353112 CTGGAGGGGGGAGGAGGGGCTGG + Intronic
1062103808 9:134741856-134741878 TTGGGGAAGGGAGGAAGGGCTGG - Intronic
1062167384 9:135114684-135114706 CTGGGGAGGGAGGGAGGGGCTGG + Intronic
1062210488 9:135360991-135361013 CTGGGGGTGGGAAGAGTGCCTGG - Intergenic
1062264805 9:135682074-135682096 TTGGGGCTGGAGGGAGGGTCCGG - Intergenic
1062459214 9:136655887-136655909 CTGGGGCTGGGGGGAGGGCAAGG - Intergenic
1062478224 9:136740109-136740131 CTGGGGTAGGGATGGGGGTCAGG - Intronic
1062518027 9:136945801-136945823 CGGGGGCTGAGAGGAGGGTTGGG - Intronic
1062609884 9:137369021-137369043 GTGGGGAGGGGCGCAGGGTCAGG + Intronic
1062669022 9:137695395-137695417 CTGGCGAGGGGAAGAAGGTCAGG + Intronic
1062682157 9:137787853-137787875 TTGGGGATAGGAGGTGGGTGGGG + Intronic
1203761630 EBV:15197-15219 CTGGGGACCGGGGGAGGATCAGG - Intergenic
1203762559 EBV:18269-18291 CTGGGGACCGGGGGAGGATCAGG - Intergenic
1203763488 EBV:21341-21363 CTGGGGACCGGGGGAGGATCAGG - Intergenic
1203764417 EBV:24413-24435 CTGGGGACCGGGGGAGGATCAGG - Intergenic
1203765346 EBV:27485-27507 CTGGGGACCGGGGGAGGATCAGG - Intergenic
1203766275 EBV:30557-30579 CTGGGGACCGGGGGAGGATCAGG - Intergenic
1203767204 EBV:33629-33651 CTGGGGACCGGGGGAGGATCAGG - Intergenic
1203603811 Un_KI270748v1:40946-40968 CTGGGGAAGGGAGCTGGGGCTGG - Intergenic
1185575459 X:1168906-1168928 ATGGGGAGGGGAGGAGGGAGAGG + Intergenic
1186126967 X:6425182-6425204 CTGGTGATGGGAAGAAGATCAGG + Intergenic
1186295625 X:8145063-8145085 CTGAGGGTGGGGGGAGGATCAGG + Intergenic
1186537146 X:10361790-10361812 CTGGGGAAAGGAGGAGGGCTTGG + Intergenic
1186616002 X:11188722-11188744 CTCGGGCTAGGAGGAGGGTGAGG - Exonic
1186662542 X:11683600-11683622 TTGAGGGTGGGAGGAGGGTGAGG + Intergenic
1186788604 X:12975519-12975541 CCGAGGCTGGGAGGAGGCTCGGG - Exonic
1186900967 X:14055653-14055675 CTGGGGAAGGGAGGGGGGAATGG - Intergenic
1187273731 X:17801262-17801284 ATGGGGATGGGAATAGGGACTGG + Exonic
1187293387 X:17976505-17976527 CTGGAGATGGGAGGGGTGCCAGG - Intergenic
1187456286 X:19443981-19444003 CTGGGGGTGTGAGGATGGCCCGG - Intronic
1188806426 X:34596276-34596298 TAGGGGATGGGAGGAGGGAGAGG - Intergenic
1188816673 X:34723525-34723547 TTGAGGATGGGAGGAGGATGAGG - Intergenic
1188844526 X:35057477-35057499 CCTGGGACTGGAGGAGGGTCAGG - Intergenic
1189204723 X:39227883-39227905 CTGGGGAAGGCAGGAGGATCTGG - Intergenic
1189304365 X:39975538-39975560 CTGGGAAAGGCAGCAGGGTCTGG + Intergenic
1189907754 X:45779318-45779340 ATGGGGGTGGGAGCAGGGTTAGG + Intergenic
1190070391 X:47274440-47274462 CTGAGGATGGCAGGAAGGGCTGG - Intergenic
1190182193 X:48202371-48202393 TTGCAGATGGGAGGAGGGACAGG + Intronic
1190222583 X:48521923-48521945 CTGGGGGAGGGAGCAGGGGCCGG - Intronic
1190265478 X:48825312-48825334 CTGGGGATGGTGGGAGGTCCAGG + Intergenic
1190586026 X:51943221-51943243 TCGGGGATGGGAGGAGGGAGAGG + Intergenic
1190629228 X:52368808-52368830 CCATAGATGGGAGGAGGGTCAGG + Intergenic
1190766655 X:53480893-53480915 CTGGGGGTTGGAGGAGAGTCTGG + Intergenic
1190782417 X:53610652-53610674 TTTGGGATGGGGGGATGGTCAGG + Intronic
1190982845 X:55471986-55472008 TTTGGGGTGGGAGGAGGGACAGG + Intergenic
1190985854 X:55501197-55501219 TTTGGGGTGGGAGGAGGGACAGG - Intergenic
1192265010 X:69531847-69531869 CTGGGGAGGGGAAGAGGTGCTGG + Exonic
1192902952 X:75519831-75519853 CTGATGATGGCAGGAGGGACTGG + Intronic
1194976699 X:100403409-100403431 CTAGGGCAGGGAGGAGGGTGTGG - Intronic
1195645530 X:107226879-107226901 CTGAGAATGGGATGAGAGTCAGG + Intronic
1195778535 X:108435161-108435183 TTTGGGTTGGGAGGAGGGTAAGG - Intronic
1196016373 X:110944528-110944550 CAGGGGATGGGAGGAGGAGCAGG - Intronic
1196239872 X:113330909-113330931 GTGGAGAGGGGAGGAGGGACAGG - Intergenic
1196486007 X:116207849-116207871 GGGAGGATGGGAGGAGGGTGAGG + Intergenic
1196579936 X:117367058-117367080 TGGAGGATGGGAGGAGGGTGAGG - Intergenic
1196704538 X:118705676-118705698 GTGGGGAAGGGAGGAGAGTGAGG - Intergenic
1198018966 X:132639781-132639803 CAGTGGATGGGAGGAGGTTGGGG + Intronic
1198159124 X:133989585-133989607 CTGTAGCTGGGAGGAGAGTCTGG + Intergenic
1198812133 X:140546733-140546755 CTAGGGATGGGGGTAGGGACAGG + Intergenic
1198987792 X:142476225-142476247 CTGGGGATGAGAGGATGTTAAGG - Intergenic
1199257754 X:145735994-145736016 CAGAGGGTGGGAGGAGGGTGAGG + Intergenic
1199904687 X:152212966-152212988 CTGGGGTAGGGTGGAGGGACTGG + Intronic
1199982593 X:152929073-152929095 GTGGGGGTGGGAGGAGGATTGGG + Intronic
1200054163 X:153450055-153450077 CAGGGGCTGGGAAGAGGATCTGG + Intronic
1200068825 X:153517945-153517967 GTGGGGATGGGAGGATGACCCGG + Intronic
1200073205 X:153538960-153538982 CTGGGCATGTGAGGAGGGGCAGG + Intronic
1200181136 X:154151368-154151390 ATGGGGATGGGGAGAGGATCTGG - Intronic
1200186781 X:154188482-154188504 ATGGGGATGGGGAGAGGATCTGG - Intergenic
1200192432 X:154225620-154225642 ATGGGGATGGGGAGAGGATCTGG - Intronic
1200198187 X:154263424-154263446 ATGGGGATGGGGAGAGGATCTGG - Intronic
1200804824 Y:7422490-7422512 CTGGGGAAGGGAGAGGGGGCAGG - Intergenic
1200988848 Y:9329766-9329788 TTGGGGATGAAAGGAAGGTCTGG - Intergenic
1201479010 Y:14417109-14417131 GTGAGGATGGGAGGAGGGAGAGG + Intergenic
1202385872 Y:24325991-24326013 CTGGGGAAGGGAGCTGGGGCTGG - Intergenic
1202484914 Y:25344137-25344159 CTGGGGAAGGGAGCTGGGGCTGG + Intergenic