ID: 1091003676

View in Genome Browser
Species Human (GRCh38)
Location 11:131932739-131932761
Sequence GCATCTGGAAAGTCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 275}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091003676_1091003684 13 Left 1091003676 11:131932739-131932761 CCCACAGGGGACTTTCCAGATGC 0: 1
1: 0
2: 2
3: 18
4: 275
Right 1091003684 11:131932775-131932797 CTGAGCTGCAGGAGGTACAGAGG 0: 1
1: 0
2: 2
3: 27
4: 355
1091003676_1091003686 21 Left 1091003676 11:131932739-131932761 CCCACAGGGGACTTTCCAGATGC 0: 1
1: 0
2: 2
3: 18
4: 275
Right 1091003686 11:131932783-131932805 CAGGAGGTACAGAGGCTGGTTGG 0: 1
1: 0
2: 0
3: 34
4: 358
1091003676_1091003681 2 Left 1091003676 11:131932739-131932761 CCCACAGGGGACTTTCCAGATGC 0: 1
1: 0
2: 2
3: 18
4: 275
Right 1091003681 11:131932764-131932786 CTGAGCTGGGCCTGAGCTGCAGG 0: 1
1: 1
2: 9
3: 66
4: 590
1091003676_1091003682 5 Left 1091003676 11:131932739-131932761 CCCACAGGGGACTTTCCAGATGC 0: 1
1: 0
2: 2
3: 18
4: 275
Right 1091003682 11:131932767-131932789 AGCTGGGCCTGAGCTGCAGGAGG 0: 1
1: 0
2: 6
3: 89
4: 498
1091003676_1091003685 17 Left 1091003676 11:131932739-131932761 CCCACAGGGGACTTTCCAGATGC 0: 1
1: 0
2: 2
3: 18
4: 275
Right 1091003685 11:131932779-131932801 GCTGCAGGAGGTACAGAGGCTGG 0: 1
1: 0
2: 2
3: 53
4: 512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091003676 Original CRISPR GCATCTGGAAAGTCCCCTGT GGG (reversed) Intronic
900708979 1:4099376-4099398 GCATCTGGCATTTCCCCTGCTGG + Intergenic
900911907 1:5602763-5602785 GCATCTGGCATTTCCCCTGCTGG - Intergenic
900999240 1:6139886-6139908 CCATCTACAAAGTCACCTGTGGG + Intronic
902122425 1:14178099-14178121 GCATCTGGCATTTCCCCTGCTGG + Intergenic
902800684 1:18827831-18827853 GCAACTGGACAGTCCCATCTGGG - Intergenic
903858293 1:26350217-26350239 GCATCTGGTAAGAACCTTGTTGG - Intronic
904165170 1:28549835-28549857 GCAACTAGACAGTCCCCTCTGGG + Intergenic
907161125 1:52370127-52370149 GCATCTGGCATTTCCCCTGCTGG + Intergenic
909756924 1:79239033-79239055 GCATCTGGCATTTCCCCTGCTGG - Intergenic
910916616 1:92296440-92296462 CCATCTGGCATTTCCCCTGTTGG - Intronic
911014775 1:93320581-93320603 GCAACTAGAAAGTCCCATCTGGG + Intergenic
912007021 1:104916926-104916948 GCATCTGGCAAGTCCCCCTCTGG - Intergenic
912708566 1:111933123-111933145 GCATCTGGCATTTCCCCTATTGG + Intronic
916333949 1:163648955-163648977 GCAACTGGACAGTCCCATCTAGG - Intergenic
917680872 1:177366078-177366100 ACCTCTAGAAAGGCCCCTGTTGG - Intergenic
918906716 1:190505761-190505783 GCATCTGGCAGGTTCCCTCTGGG - Intergenic
918946802 1:191076915-191076937 GCATCTGGCACTTCCCCTGCTGG + Intergenic
919932561 1:202230835-202230857 GCATCTAGAAAGACTCCTGCTGG + Intronic
920436863 1:205952591-205952613 GGATCAGGAAAGAACCCTGTGGG + Intergenic
921640669 1:217548766-217548788 GCATCTGGCATTTCCCCTGCTGG + Intronic
921718877 1:218448681-218448703 GCATCTGGCATTTCCCCTGCTGG + Intergenic
923055119 1:230420595-230420617 GCATCTGGCATTTCCCCTGCTGG + Intronic
924122942 1:240821150-240821172 GAATCAGAAAAGTCCCCTCTTGG + Intronic
924579703 1:245313275-245313297 GTTTATGCAAAGTCCCCTGTGGG + Intronic
924828938 1:247572584-247572606 GCATCTGGCAGGTGCCCTGCTGG - Intronic
1064119891 10:12609489-12609511 GCAACTGGACAGTCCCATCTGGG + Intronic
1065795053 10:29298998-29299020 GCAACTGGACAGTCCCATCTGGG + Intronic
1067570551 10:47368267-47368289 GCATCTGCAGATTCCCCTGCAGG + Exonic
1070512882 10:77177121-77177143 GCCTCTGGAGAGACCCATGTTGG + Intronic
1070654404 10:78261608-78261630 GCAGCTGGAAAGTGCTCTGATGG - Intergenic
1072015358 10:91341419-91341441 GCATCTGGAATTTCCCTTGAAGG - Intergenic
1072688009 10:97550201-97550223 GCATCTGGGAAGGACACTGTTGG + Intronic
1074440505 10:113473608-113473630 GCATCTGAGAGGTCTCCTGTTGG - Intergenic
1074734785 10:116418644-116418666 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1075516376 10:123111977-123111999 GCCTCTGGAAAGTCTGCTATAGG - Intergenic
1075989225 10:126819643-126819665 GCATCTGGCATGTACCCTGCTGG + Intergenic
1076475986 10:130751741-130751763 GCAGATGGAGACTCCCCTGTAGG - Intergenic
1079804451 11:24911520-24911542 GCATCTGGCATTTCCCCTGCTGG + Intronic
1079948379 11:26770806-26770828 GCATGTGAAAAGTCCCCTAGGGG + Intergenic
1081275362 11:41141654-41141676 GCATCTGGCATTTCCCCTGCTGG + Intronic
1081393684 11:42559970-42559992 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1081445002 11:43122678-43122700 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1082932901 11:58627586-58627608 CCTTCTGAAAAGTCCTCTGTGGG + Intergenic
1083372381 11:62192565-62192587 GCCTCAGGAAAGTCCCCAGGTGG - Intronic
1084482760 11:69431398-69431420 CCATGTGGAAATTCCTCTGTTGG + Intergenic
1085018412 11:73190210-73190232 TCATCTGGAGAGTCCGCTCTGGG - Intergenic
1085759897 11:79232932-79232954 GAATCTGGAATTTCACCTGTTGG - Intronic
1086509830 11:87544273-87544295 GCATCTGGCATTTCCCCTGTTGG - Intergenic
1087634606 11:100687864-100687886 GCATCTGGAGAGTCCCCGCGGGG + Intronic
1091003676 11:131932739-131932761 GCATCTGGAAAGTCCCCTGTGGG - Intronic
1091276886 11:134358789-134358811 GGATCTGGAAGGTGCCCGGTGGG - Intronic
1091691665 12:2601491-2601513 GCATCAGGAAAGGACCCTGCAGG + Intronic
1094043641 12:26143968-26143990 GCAACTGGATGGTCCCATGTGGG - Intronic
1094707920 12:32932814-32932836 GCATCTGGCATTTCCCCTGCAGG + Intergenic
1098195086 12:67991343-67991365 GCATCTGGGAAAGCCCCCGTGGG + Intergenic
1101339606 12:103831239-103831261 GCATCTGGCATTTCCCCTGCTGG + Intronic
1101581275 12:106043313-106043335 GCATCTGGCATTTCCCCTGCTGG - Intergenic
1102877495 12:116459252-116459274 GCAACTGGAAAGCCCGATGTGGG + Intergenic
1104100947 12:125609047-125609069 GCATCTGGCATTTCCCCTGCTGG - Intronic
1104885426 12:132104483-132104505 GCATCCACGAAGTCCCCTGTAGG - Exonic
1111107597 13:83667848-83667870 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1111628036 13:90813958-90813980 GCATCTGGAGAGTGCCCCCTTGG + Intergenic
1113285082 13:108837204-108837226 GCATCTGGCTTTTCCCCTGTTGG + Intronic
1113556382 13:111239033-111239055 GCATCTGGCATTTCCCCTGTTGG - Intronic
1113752417 13:112785444-112785466 GCAGGTGGAAAGCCTCCTGTGGG - Intronic
1114756930 14:25269848-25269870 GCATCAGGAAAGTGCCTTGCAGG - Intergenic
1115698588 14:35925907-35925929 GCACCTGGCAAGTCCATTGTTGG + Intronic
1115959867 14:38823491-38823513 GCATCTGGTATTTCCCCTGCTGG + Intergenic
1116200334 14:41785730-41785752 GCAACTGGACAGTCCGCTCTGGG + Intronic
1116228710 14:42187174-42187196 ATATCTGCAAAGTCCCCTTTTGG + Intergenic
1117504157 14:56385017-56385039 GCATCTGGTGATTCCCCTGCTGG + Intergenic
1119444258 14:74650150-74650172 GCATCTTGGATGTGCCCTGTTGG - Intergenic
1119586363 14:75839571-75839593 GCATCTGGCATTTCCCCTGCTGG - Intronic
1120279686 14:82423077-82423099 GCATCTGGCATTTCCCCTGCTGG - Intergenic
1122732756 14:103813527-103813549 GCATCTGGAATTTCCCCTGCTGG + Intronic
1202854754 14_GL000225v1_random:43407-43429 GCCTCACGAAAGCCCCCTGTGGG - Intergenic
1123720806 15:23060595-23060617 GCATCTGGTGAGTCTCCTGGGGG + Intergenic
1125609527 15:40961084-40961106 GCCTGTGGAGAGTCCCCTGCAGG + Intergenic
1125874923 15:43135505-43135527 GCATCTGTCAGGTCTCCTGTAGG - Exonic
1126197425 15:45947979-45948001 GCATCTGAAAAGTCTACTGAAGG + Intergenic
1127063571 15:55213758-55213780 GCAACTGGACAGTCCCATCTGGG - Intronic
1127933413 15:63612834-63612856 GCATCAGGGAAGGCCCCAGTGGG - Intronic
1128579759 15:68801063-68801085 GCATGTGGAATGTCCCCTGTGGG - Intronic
1130210498 15:81917630-81917652 GCATCTGGCATTTCCCCTGTTGG + Intergenic
1131558425 15:93418873-93418895 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1131590953 15:93747413-93747435 GTGTCTGGAAACACCCCTGTTGG - Intergenic
1132578364 16:674263-674285 GCCTCTGGAAGGTCCACTCTGGG + Intronic
1134600605 16:15530764-15530786 GCATCTGGCATTTCCCCTGCTGG + Intronic
1137309010 16:47234925-47234947 GCATCTGGCATTTCCCCTGCTGG + Intronic
1137675518 16:50302003-50302025 GCATCTGGGAAAACCCCTGCCGG + Intronic
1138184248 16:54964084-54964106 GCCTCAGCAAAGTTCCCTGTTGG - Intergenic
1140908767 16:79432187-79432209 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1141245492 16:82303005-82303027 GCATGTGCAAAGTCCCATGAAGG - Intergenic
1142737777 17:1912511-1912533 ACGTCTGCAAAGCCCCCTGTAGG + Intergenic
1143632466 17:8146987-8147009 TCTGCTGGAAAGTCACCTGTGGG + Exonic
1147650941 17:42061744-42061766 GCAGCAGGAAAGTCTCCTGAAGG - Intronic
1148196367 17:45716182-45716204 GCATCTGGCAAGATTCCTGTTGG - Intergenic
1148324087 17:46773274-46773296 CCATCTAGAAAGTCCTCAGTAGG - Intronic
1148998853 17:51736352-51736374 GTTTCTGTAAAGTCCTCTGTGGG - Intronic
1149071655 17:52550649-52550671 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1149145095 17:53480832-53480854 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1150361585 17:64539796-64539818 GCATTTGGAAAGTCCTGTGGGGG + Intronic
1150623980 17:66829707-66829729 GCATCTGGACAGCTCCCTGCAGG - Intergenic
1151114052 17:71713656-71713678 GCATCTGGAAATTCCTCACTTGG + Intergenic
1151518928 17:74614781-74614803 CCATGTGGAAAGGCCACTGTAGG + Intronic
1154155611 18:11941954-11941976 ACATCAGGAAATTACCCTGTAGG + Intergenic
1154360029 18:13653066-13653088 GCATCTAGAAAGTCCTCCCTGGG - Intergenic
1155336095 18:24766894-24766916 GGATGGGGAAAATCCCCTGTTGG + Intergenic
1159067901 18:63590098-63590120 GCCTCTGTAAAGTCCGCAGTAGG + Intronic
1159569565 18:70096677-70096699 GCATCTGGCAATGCCCCTCTGGG - Intronic
1159573361 18:70145201-70145223 GCAACTAGACAGTCCCATGTGGG - Intronic
1161153861 19:2722353-2722375 GACTCTGGAGAGACCCCTGTGGG - Intronic
1161729391 19:5949944-5949966 GCAGCTGGAGAGTCCTATGTGGG + Intronic
1163432333 19:17275819-17275841 GCCTCATGTAAGTCCCCTGTGGG + Exonic
1163533155 19:17862418-17862440 ACATCTGGAAACTCCCTTTTTGG + Intronic
1166081784 19:40448168-40448190 GCATATGGAAAGTCCATTCTTGG - Intronic
1167199510 19:48054633-48054655 GCATCTGGCAATTGCCCTGCTGG + Intronic
1167573761 19:50307360-50307382 GCATCTAGAAAGGGCCCTGTAGG + Intronic
1168024924 19:53637162-53637184 GTCTCTGGAAAGACCCCAGTAGG + Intergenic
924976187 2:177872-177894 ACAGCTGGAAAGCCACCTGTGGG + Intergenic
926626708 2:15096555-15096577 GCATTTGGGAAGTGCCCTGAGGG - Intergenic
926915033 2:17883207-17883229 GCATCTGGTAAGTCCTCGGATGG - Intronic
930333507 2:50016599-50016621 GCATCTGGCATTTCCCCTGCGGG - Intronic
930860269 2:56064932-56064954 GCATCTGGTAGGTGCCCTTTGGG - Intergenic
932311839 2:70749162-70749184 GCATCTGGCATTTCCCCTGCTGG - Intronic
933127774 2:78632450-78632472 GAATGTGGAAGTTCCCCTGTAGG - Intergenic
933317265 2:80730306-80730328 GTATCTGGATGGTCCACTGTTGG - Intergenic
934529742 2:95077331-95077353 GCAGCTGCACAGGCCCCTGTAGG - Intergenic
936448251 2:112614341-112614363 GCATCTGGCAGGTTCCCTGCTGG - Intergenic
936831955 2:116657088-116657110 GCATCTGGCATTTCCCCTGCTGG - Intergenic
941227089 2:162864204-162864226 GCATCTGGCATTTCCCCTGATGG - Intergenic
942380378 2:175385050-175385072 GCATCTGGCATTTCCCCTGCTGG + Intergenic
943938980 2:193965481-193965503 GCATCTGGCATTTCCCCTGCTGG + Intergenic
945329649 2:208524908-208524930 GCATCTGGCAGGTGCCCTCTGGG - Intronic
947011359 2:225570538-225570560 GCATCTGGCATTTCCCCTGTTGG - Intronic
947409854 2:229825584-229825606 GCATTTGGCATTTCCCCTGTTGG - Intronic
947988268 2:234466977-234466999 CAATCTGGAAAGACCCCTGCAGG + Intergenic
948902624 2:240964098-240964120 GGCTCTAGAAAGGCCCCTGTGGG + Intronic
1168768366 20:397428-397450 CCACCTGGAAAGTCCCAGGTGGG + Exonic
1169592657 20:7162718-7162740 GCATCTGGCATTTCCCCTGTTGG + Intergenic
1170231685 20:14054329-14054351 TCAGCTGGAAACTCCCCTCTTGG - Intronic
1170261790 20:14416787-14416809 GCATCTTGAAAGTACTCAGTTGG + Intronic
1170544762 20:17426240-17426262 GCATCTGGCATTTCCCCTGCTGG + Intronic
1171374064 20:24680127-24680149 GTACCTGGAAAGTCCCTTGAAGG - Intergenic
1171513314 20:25706083-25706105 GCATCTGGTAGGTGCCCTCTGGG - Intergenic
1172053767 20:32139823-32139845 GCATGTGCAAAGGCCCCTTTGGG - Intronic
1174891965 20:54404931-54404953 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1174893103 20:54419265-54419287 GCTTCTGGAAGTTTCCCTGTAGG + Intergenic
1175234357 20:57499668-57499690 GCATCTAGACAGTCCCATCTGGG + Intronic
1175296020 20:57909283-57909305 GGATCTGAAAAGGCTCCTGTCGG + Intergenic
1176883625 21:14228662-14228684 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1176905968 21:14502029-14502051 GAATCTGTAAAGTCCTCTCTGGG - Intronic
1177359429 21:20049158-20049180 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1177561371 21:22758726-22758748 GCATCTGGCAATTCCCCTTCTGG + Intergenic
1177993846 21:28071760-28071782 GCAACTAGAAGGTCCCATGTGGG + Intergenic
1178758224 21:35373610-35373632 GGAGCTAGAAAGTCCCCTGGAGG - Intronic
1180857962 22:19060012-19060034 GCATCTGGACAGCCCCTGGTGGG - Intronic
1181480139 22:23193671-23193693 CCATCTGCAAATTCCCCTTTTGG + Intronic
1184894606 22:47399838-47399860 GCATCTGGCATTTCCCCTGCTGG - Intergenic
951551411 3:23878747-23878769 GCAACTAGACAGTCCCATGTGGG - Intronic
956051728 3:65255416-65255438 GCATCTGGCATTTCCCCTGCTGG + Intergenic
957741779 3:84279918-84279940 GCATCTGGCATTTCCCCTGCTGG - Intergenic
957956714 3:87196912-87196934 GCATCTGGCATTTCCCCTGCTGG + Intergenic
959304990 3:104651323-104651345 GCATCTGGAATTTCGCCTGCTGG + Intergenic
959484401 3:106910216-106910238 GCATCTGGCATTTCTCCTGTTGG - Intergenic
959743754 3:109752326-109752348 GCATCTGGCATTTCCCCTGCTGG - Intergenic
959987005 3:112585212-112585234 GCATCTGCCATTTCCCCTGTTGG - Exonic
963536760 3:146539147-146539169 GCAACTAGACAGTCCCATGTGGG + Intronic
964539185 3:157759837-157759859 GCTTCTGGCAAGGCCCCTGCAGG + Intergenic
964843063 3:161015396-161015418 GCTGCTGGAAAATCCCCTTTAGG - Intronic
964945322 3:162216518-162216540 GCATCTGGCATTTCCCCTGCTGG - Intergenic
965964777 3:174473983-174474005 GCATCTGGCATTTCCCCTGCTGG - Intronic
966564591 3:181362315-181362337 GCATCTGGTAATTCCCCAGATGG + Intergenic
967718013 3:192785579-192785601 GCATCAGGCATGTCCCCTGATGG + Intergenic
968478508 4:824001-824023 GCATCTGGCGAGGACCCTGTGGG - Intronic
968864705 4:3200701-3200723 TCAGCTGGAAAGTCCACTGTTGG + Intronic
968975211 4:3818649-3818671 GCATCTGGCATTTCCCCTGCTGG + Intergenic
971495770 4:27263642-27263664 GCATCCGGTATTTCCCCTGTTGG + Intergenic
973134921 4:46695461-46695483 GCAACTGGACAGTCCCATCTGGG + Intergenic
973957490 4:56077251-56077273 GCATCTGGCACTTCCCCTGCTGG - Intergenic
978769695 4:112442087-112442109 GCATCTGGCATTTCCCCTGCTGG - Exonic
979776331 4:124592858-124592880 GCATCTGGCATTTCCCCTGCTGG + Intergenic
980100236 4:128535250-128535272 GCATCTGGCAGGTGCCCTGCTGG - Intergenic
980869898 4:138598968-138598990 GCATGTGGAGAGGCCTCTGTGGG - Intergenic
981152531 4:141395916-141395938 GCAACTGGACAGTCCCATCTGGG + Intergenic
981573593 4:146179037-146179059 ACATCTGCAAAGTGCCCTGCAGG - Intronic
982325053 4:154121360-154121382 GAATCTGAGAAGGCCCCTGTTGG - Intergenic
982713708 4:158784571-158784593 GCAACTGGAAGGTCCCATCTGGG + Intronic
983519492 4:168692172-168692194 GGAACTGGAAAGTCCTCTGTGGG + Intronic
984189507 4:176588559-176588581 GCATCTGGCATTTCCCCTGCTGG - Intergenic
984275377 4:177603367-177603389 GCATCTGGCATTTCCCCTGCTGG - Intergenic
987479891 5:18440453-18440475 GCATCTGGCATTTCCCCTGATGG - Intergenic
987681441 5:21140944-21140966 GCATCTGGCATTTCCCCTGCTGG + Intergenic
987916290 5:24218874-24218896 GCATCTGGCAGTTCCCCTGCTGG + Intergenic
988914462 5:35878466-35878488 CCATATTGAAAGTGCCCTGTTGG + Exonic
990599871 5:57347483-57347505 GCATCTGGAGGGTCTCCTGCTGG + Intergenic
990786340 5:59424584-59424606 GCATCTGGCATTTCCCCTGTTGG - Intronic
990903763 5:60780708-60780730 GCATCTGGCATTTCCCCTGCTGG - Intronic
991150364 5:63360742-63360764 GCATCTGGCAAGTGCCCCATGGG - Intergenic
992885696 5:81157739-81157761 GCATCTGGCATTTCCCCTGCTGG - Intronic
993855243 5:93066215-93066237 GCAACTGGATGGTCCCATGTGGG - Intergenic
994247069 5:97489663-97489685 ACATCTGGAGAGGCCACTGTGGG - Intergenic
994590970 5:101771158-101771180 GCATCTGGCATTTCCCCTGCTGG + Intergenic
995457992 5:112372259-112372281 GCATCTGGCATTTCCCCTGCTGG - Intronic
995709033 5:115016031-115016053 GCATCTGGCAGTTCCCCTGCTGG + Intergenic
997021905 5:130012591-130012613 GCATCTGGAATTTCCCCAGCTGG - Intronic
999271930 5:150301950-150301972 GGATCTGGGAAATCTCCTGTTGG - Intronic
1000580867 5:163034248-163034270 GCGTCTGGAATTTCCCCTGCTGG + Intergenic
1001172273 5:169430862-169430884 GCCTCTGCAAAGTCCACTCTTGG - Intergenic
1002290609 5:178198243-178198265 GCATCTGGCATTTCCCCTGCTGG - Intergenic
1002546060 5:179946065-179946087 GCATTTGAAAAGTCCCTTGGAGG - Intronic
1004454225 6:15776710-15776732 GGGGCTGGAAAGTCCCTTGTTGG + Intergenic
1004770092 6:18771614-18771636 GCAACTGGAAGGTCCCTTCTGGG - Intergenic
1007288124 6:40762737-40762759 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1008681635 6:53878428-53878450 GCAACTGGACAGTCCCATCTGGG + Intronic
1009971517 6:70629766-70629788 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1010900422 6:81421757-81421779 GCATATGGAATTTCCCCTGATGG + Intergenic
1011032799 6:82941761-82941783 GCATCTGGCATTTCCCCTGTTGG + Intronic
1011637616 6:89388820-89388842 GCAACTAGACAGTCCCATGTGGG + Intronic
1013948225 6:115748166-115748188 GCATCTGGCATTTCCCCTGTTGG - Intergenic
1015173372 6:130279362-130279384 GCATCTGGCATTTCCCCTGCTGG + Intronic
1016456930 6:144240483-144240505 GCATCTGGCATTTCCCCTGGTGG + Intergenic
1018664518 6:166122821-166122843 GCAACTAGACAGTCCCGTGTGGG + Intergenic
1019049812 6:169174190-169174212 GCACCTGGCAAGTGCCCTCTGGG + Intergenic
1019770329 7:2880438-2880460 GCATATAGAAAGACCCCTCTGGG + Intergenic
1019814810 7:3191726-3191748 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1020407813 7:7856390-7856412 GCATCTGGCATTTCCCCTGCTGG - Intronic
1020429516 7:8104864-8104886 GCATCTGGCATTTCCCCTGCTGG - Intergenic
1021885231 7:25131230-25131252 GCATCTAGATGGTCCCATGTGGG - Intergenic
1022038653 7:26558412-26558434 CCATCTGGAAGGTCCTCTGCAGG + Intergenic
1022776468 7:33532524-33532546 GCATCTGGCATCTCCCCTGCTGG - Intronic
1023784892 7:43696239-43696261 GCATCTGGCATTTCCCCTGCTGG - Intronic
1024153827 7:46600127-46600149 GCCTCTGGCATGTACCCTGTTGG + Intergenic
1024726025 7:52196142-52196164 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1024937812 7:54729416-54729438 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1026120911 7:67536469-67536491 GCACCTGAACTGTCCCCTGTTGG - Intergenic
1029232081 7:99078771-99078793 GCAACTAGACAGTCCCATGTGGG - Intronic
1029491008 7:100870025-100870047 GCAACTGGACAGTCCCATCTGGG + Intronic
1030487016 7:110182376-110182398 GCATCTGCATTGACCCCTGTAGG + Intergenic
1031613684 7:123856572-123856594 GCATCTGGCAGGTGCCCTTTGGG - Intronic
1031899748 7:127395468-127395490 GCATCTGGCATTTCCCCTGCTGG + Intronic
1032698045 7:134354842-134354864 GCATTTGGATAGTCCCATTTTGG - Intergenic
1033279476 7:139995586-139995608 GCATCTGAAAAGGTCGCTGTGGG - Intronic
1033491083 7:141844662-141844684 GCACCTGGAAAGTCCATTGTTGG - Intergenic
1033577514 7:142700540-142700562 GCATCTGGCATTTCCCCTGCTGG - Intergenic
1035598046 8:876955-876977 CCATATGGAAATTCCGCTGTTGG - Intergenic
1035790646 8:2301337-2301359 GCATCTGGCATTTCCCCTGCTGG - Intergenic
1035802159 8:2420368-2420390 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1036629996 8:10505694-10505716 GCATCTGGCATTTCCCCTGGTGG + Intergenic
1036771077 8:11578767-11578789 GCAGCTGGAAAGGCGCCAGTGGG + Intergenic
1036990786 8:13591407-13591429 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1037007025 8:13794760-13794782 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1037036870 8:14179428-14179450 GCTCCTGAAAAGTCCACTGTAGG - Intronic
1038364248 8:26914947-26914969 GCATCTGGCATTTCCCCTGCTGG - Intergenic
1039046164 8:33451857-33451879 GCATCTGGCATTTCCCCTGCTGG - Intronic
1043365423 8:79527198-79527220 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1043492629 8:80764384-80764406 GCATCTGGGATTTCCCCTGCTGG - Intronic
1043498451 8:80828830-80828852 GACTCTGGAAAGTCTCATGTTGG - Intronic
1045859853 8:106803741-106803763 TCATCTGGAAAGTTCTCTTTGGG - Intergenic
1047570885 8:126097640-126097662 GCATCTGGAGAGTCCACTGTTGG - Intergenic
1047869818 8:129070495-129070517 GCATCTGGTATTTCCCCTGCTGG + Intergenic
1048069667 8:131008423-131008445 GCGTCTGGCATGTCCCCTGCTGG + Intronic
1048069805 8:131009462-131009484 GCATCTGGCATTTCCCCTGCTGG + Intronic
1048284642 8:133132338-133132360 GCATGTCGAATGTCCCCTGGAGG + Intronic
1052502403 9:29308340-29308362 GCATCTGGCATTTCCCCTGCTGG - Intergenic
1052613804 9:30812177-30812199 GCAACTGGACAGTCCCATCTGGG - Intergenic
1052891009 9:33700363-33700385 GCATCTGGCATTTCCCCTGCTGG - Intergenic
1053010330 9:34629118-34629140 GCATGGGGAGAGGCCCCTGTGGG + Intergenic
1056485807 9:87056421-87056443 GCATCTGGCATTTCCCCTGCTGG - Intergenic
1057771884 9:97975398-97975420 ACATCTGCAAAGTCCCTTGGGGG + Intergenic
1059037724 9:110775853-110775875 GGATCTGTAGAGTCCTCTGTGGG - Exonic
1059245953 9:112849801-112849823 GCTGCTGGAAGGTCCCCTGTGGG + Intronic
1059401769 9:114075103-114075125 GCATTTGGAAAGAGCCCTGCAGG - Intronic
1059822237 9:117986036-117986058 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1060366034 9:123014879-123014901 GCATCTGGCATTTCCCCTGCTGG - Intronic
1062226308 9:135453961-135453983 CCATAAGGAAAGGCCCCTGTGGG + Intergenic
1062595929 9:137299217-137299239 GCAGGTAGAAAGTCCCCTGGAGG - Intergenic
1185521955 X:747097-747119 GCAACTAGATTGTCCCCTGTGGG + Intergenic
1185851259 X:3490826-3490848 GCAACTGGAAGGTCCCATCTGGG - Intergenic
1186126504 X:6420076-6420098 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1187941113 X:24382589-24382611 GCATCTGGCATTTCCCCTGCTGG + Intergenic
1188510307 X:30928607-30928629 GCATCTGGCATTTCCCCTGCTGG + Intronic
1189220482 X:39367712-39367734 GCCTCTAGAAAGTCTCATGTCGG + Intergenic
1190528071 X:51347915-51347937 GCATCTGGCATATCCCCTGCTGG - Intergenic
1191080945 X:56508714-56508736 GCATCTGGCAGGTGCCCTGCTGG + Intergenic
1191152457 X:57234557-57234579 GCAACTGGACAGTCCCATCTTGG + Intergenic
1195141513 X:101965116-101965138 GCATCTGGCATTTCCCCTGTGGG - Intergenic
1195871479 X:109491072-109491094 GCATCTGGTATTTCCCCTGCTGG + Intergenic
1196098914 X:111828378-111828400 GCATCTGGTATTTCCCCTGTTGG + Intronic
1196741399 X:119029056-119029078 CTATTTGGAAAGTCCCCTTTAGG + Intergenic
1198247629 X:134846146-134846168 GCATCTGGAATTTCCCCTGCTGG - Intronic
1198586253 X:138125306-138125328 GCACCTGGAAAGTCCATTGTTGG + Intergenic
1198629118 X:138615871-138615893 GCATCTGGCATTTCCCCTGCTGG - Intergenic
1199274019 X:145921477-145921499 GCACCTGGAAAGTCGATTGTTGG - Intergenic
1200118031 X:153777682-153777704 GCAGCAGGAAAGGCACCTGTTGG - Exonic
1201493165 Y:14564796-14564818 GCATCTGGCAGGTTCCCTGCTGG + Intronic