ID: 1091006837

View in Genome Browser
Species Human (GRCh38)
Location 11:131961237-131961259
Sequence TTGATTATGCAGGAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091006830_1091006837 9 Left 1091006830 11:131961205-131961227 CCTTCATTGTTCCCTCCATTTAT 0: 1
1: 0
2: 1
3: 41
4: 439
Right 1091006837 11:131961237-131961259 TTGATTATGCAGGAAATGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 162
1091006832_1091006837 -3 Left 1091006832 11:131961217-131961239 CCTCCATTTATTTTGTCCTGTTG 0: 1
1: 0
2: 0
3: 32
4: 310
Right 1091006837 11:131961237-131961259 TTGATTATGCAGGAAATGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 162
1091006833_1091006837 -6 Left 1091006833 11:131961220-131961242 CCATTTATTTTGTCCTGTTGATT 0: 1
1: 0
2: 7
3: 74
4: 793
Right 1091006837 11:131961237-131961259 TTGATTATGCAGGAAATGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 162
1091006831_1091006837 -2 Left 1091006831 11:131961216-131961238 CCCTCCATTTATTTTGTCCTGTT 0: 1
1: 0
2: 4
3: 44
4: 584
Right 1091006837 11:131961237-131961259 TTGATTATGCAGGAAATGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 162
1091006829_1091006837 25 Left 1091006829 11:131961189-131961211 CCTGAATTTGAAAAAACCTTCAT 0: 1
1: 0
2: 1
3: 21
4: 378
Right 1091006837 11:131961237-131961259 TTGATTATGCAGGAAATGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091006837 Original CRISPR TTGATTATGCAGGAAATGGC AGG Intronic
900760964 1:4470016-4470038 TTGAGAATGCAGACAATGGCAGG - Intergenic
905012901 1:34759235-34759257 TGGATTGTGTAGGAAATGGGAGG - Intronic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905171875 1:36114501-36114523 AGGATCATGCAGGAAAAGGCAGG - Intronic
909274209 1:73664607-73664629 TTAATTATACAGCAAATAGCAGG - Intergenic
909506401 1:76395657-76395679 TTCATGATGCTGCAAATGGCAGG - Intronic
914890884 1:151622331-151622353 TTGAATATATAGGAAATGGGTGG + Intronic
915069216 1:153252281-153252303 CTGAGTATGCAGGAAAAGGGAGG - Intergenic
919616946 1:199819746-199819768 TTAATTATGCAGGAAATGCTTGG - Intergenic
923720771 1:236464882-236464904 GTGATTATGAAAGAAATGACTGG - Intronic
923998930 1:239529038-239529060 TGGATTATGAAGGAAATGGGAGG - Intronic
924800490 1:247326563-247326585 TGGGTTATGCAGGAAGTGGGGGG - Intronic
1063063667 10:2586795-2586817 TTGTTTCTGAAGGAAATTGCTGG - Intergenic
1063933787 10:11056292-11056314 TTGTTTCTGCAGGAAATGAGTGG + Intronic
1066242246 10:33549593-33549615 GAGATTATGCAGGAAGTGGTGGG - Intergenic
1071863466 10:89700274-89700296 TTGATTGTGCAGGACCTGGGAGG + Intergenic
1073733534 10:106320115-106320137 TTGATAATGATGGGAATGGCAGG + Intergenic
1074598251 10:114887397-114887419 TTGAATATACATGAAATGGTTGG - Intronic
1074801158 10:117003072-117003094 TTGATTATACAAGAAATGAAAGG + Intronic
1078288067 11:9978178-9978200 TAGGTTATGCAGGAAATTGGGGG - Intronic
1078915580 11:15775360-15775382 TTCATTCTGCAGCAAATGGCTGG - Intergenic
1086466274 11:87056952-87056974 TTAAGTATGCAGAAGATGGCAGG + Intronic
1086798790 11:91144577-91144599 TTGGTTATGGTGGAAAAGGCAGG - Intergenic
1087841887 11:102928874-102928896 TGCATTAAGCAGGAAAAGGCAGG + Intergenic
1089551096 11:119278684-119278706 TTCATGATGAAGGAATTGGCTGG + Exonic
1090437275 11:126697225-126697247 TTGTTTATGCGGGAGATGACAGG + Intronic
1091006837 11:131961237-131961259 TTGATTATGCAGGAAATGGCAGG + Intronic
1093643237 12:21552578-21552600 TTGAGTATGTAGCAAATGTCAGG + Intronic
1099534388 12:83827058-83827080 CTGATGTTTCAGGAAATGGCTGG + Intergenic
1100866498 12:98863148-98863170 TTAATTATGCAGGACAAGACTGG - Intronic
1103175793 12:118862110-118862132 TTGAATTTGCGGGAAATGCCAGG - Intergenic
1103238045 12:119390464-119390486 TTGATTATCCACTAAATGTCAGG - Intronic
1108426925 13:50312052-50312074 TTGATTTTGCAGGAAAATGGGGG + Intronic
1115223315 14:31078772-31078794 GTGATTATGCAGGACTTGGACGG + Intronic
1115476101 14:33814334-33814356 TAGAAAATGCAGGAAATGTCCGG + Intergenic
1116272803 14:42794338-42794360 TTTAGAATGCAGGAAATAGCAGG - Intergenic
1116942409 14:50803684-50803706 TTGCTCATGGATGAAATGGCAGG + Intronic
1117617448 14:57548159-57548181 TTGCTTATAAAGGCAATGGCAGG + Intergenic
1118863527 14:69684209-69684231 CTGATTAGGCATGAAATGACTGG - Intronic
1123684594 15:22787629-22787651 TTGCCAATGCAGGATATGGCAGG + Intronic
1124671600 15:31646000-31646022 TTGATTAGGCAGGAAAGAGGAGG - Intronic
1125361316 15:38867434-38867456 TGGATTCTGAAGGAAATAGCTGG + Intergenic
1125511371 15:40294126-40294148 TTGCTACTGCAGGAACTGGCTGG + Intronic
1125952095 15:43760909-43760931 CTGTTTATGCAGAAAATGTCTGG + Intronic
1126427628 15:48546587-48546609 TGGATTATGCAGGACATCTCGGG + Intronic
1126757234 15:51936520-51936542 TTGATTAGCCAGGAAATAGCTGG + Intronic
1126785206 15:52172858-52172880 TTGTATATGCAGTAAATGTCTGG - Intronic
1127816009 15:62609397-62609419 TTCATTATAAAGGACATGGCTGG - Intronic
1128610351 15:69067948-69067970 TGGATTTTGAAGGAAAGGGCAGG - Intergenic
1131313855 15:91315202-91315224 TTGATTATGTATGACATGTCAGG - Intergenic
1132532155 16:457464-457486 TGGATTTTGCAGGGAAGGGCAGG + Intronic
1132644154 16:991106-991128 TTAATTAGACAGAAAATGGCAGG + Intergenic
1132733563 16:1374871-1374893 CTGATTATGCTGAAAATGTCTGG - Intronic
1136669978 16:31847514-31847536 TTTATTAGGAAGGAAATGGAGGG + Intergenic
1140531303 16:75669016-75669038 TTAATTTTCTAGGAAATGGCTGG + Intronic
1144135570 17:12291760-12291782 TTGATTCAGCAGGAAATGGCAGG + Intergenic
1144908941 17:18662723-18662745 TTGAATATGCACTGAATGGCAGG + Exonic
1150328460 17:64275416-64275438 TTGATTATGCAGGAGAAAGGGGG - Intergenic
1150897269 17:69226865-69226887 TTAATTATGTGGAAAATGGCTGG + Intronic
1152838343 17:82549904-82549926 TTGAGAAAGCAGGAAAAGGCCGG + Intronic
1153086823 18:1297657-1297679 TTCATTATGCAAGAAATGTTTGG - Intergenic
1153545618 18:6202329-6202351 TTGATTATGCAGGATCTAGTAGG + Intronic
1155809345 18:30211956-30211978 ATGAGTTTGCAGGGAATGGCTGG - Intergenic
1155845672 18:30703160-30703182 CTGATTAAGCTGGAAATGCCAGG - Intergenic
1155929065 18:31686167-31686189 CTAATCATGCAGGAAGTGGCGGG + Intergenic
1156273065 18:35555005-35555027 TTGAATATTAATGAAATGGCTGG - Intergenic
1158070926 18:53469635-53469657 CTGATGATGCAGGAAAGGGAAGG - Intronic
1159557423 18:69959948-69959970 TAGAAAATGCAGGCAATGGCTGG + Intronic
1162828761 19:13270910-13270932 TAGATCATGCAGGAACTGGGAGG - Intronic
1163790180 19:19301854-19301876 TTTATGATGAGGGAAATGGCAGG - Intronic
1168003916 19:53470443-53470465 TTGATTATTCATGAAAAAGCAGG + Intronic
1168585215 19:57586264-57586286 TTTATAATGCAGGAAAGGGCTGG + Intronic
926639020 2:15215336-15215358 TTAATTTTGCAGGAGCTGGCTGG + Intronic
932279687 2:70479951-70479973 ATGATGATGCAAGAAATCGCTGG - Intronic
932418861 2:71589662-71589684 TCGAATATGCAGGAAATCGTGGG - Exonic
933442815 2:82334771-82334793 TTGATTATGGAGGAACTGCTTGG - Intergenic
933632147 2:84671106-84671128 TGGAGTATGCAGGGAATGGGAGG + Intronic
935257293 2:101322146-101322168 TTGATTATTCACCAAATGTCAGG - Intergenic
940811206 2:158244777-158244799 TTGATTATACAGGCCACGGCTGG + Intronic
941345061 2:164358222-164358244 TTCATTATTCAGGAAGTAGCTGG + Intergenic
1169413964 20:5399842-5399864 TTGGTTATGCTGGAAAGGGAGGG - Intergenic
1173867402 20:46321362-46321384 GTGATAAAGCAGGAAAGGGCTGG - Intergenic
1174416899 20:50373417-50373439 TTGAAAATGGAGGAAAGGGCTGG + Intergenic
1175481620 20:59315223-59315245 TTGTTTCTCCAGGGAATGGCAGG + Intronic
1175972591 20:62694250-62694272 TTTATTATGAAGGACATTGCAGG + Intergenic
1178984359 21:37290290-37290312 TGGATTTTGCAGGACGTGGCAGG - Intergenic
1179066266 21:38027544-38027566 TTGCTTATGCAGAAAATCACTGG + Intronic
1181885573 22:26019537-26019559 TGCATTATGCAGGGAATGGGAGG - Intronic
1182902291 22:33908524-33908546 TTGATGATGCATGAAATGGGGGG + Intronic
1182908407 22:33958387-33958409 TTGATGATGCAAGAAATAGATGG - Intergenic
1183209896 22:36444440-36444462 TAGATTATGCTGGAAAAGACAGG + Intergenic
1183395030 22:37566677-37566699 TTGATGATGGGGGAGATGGCCGG - Exonic
1184302928 22:43573121-43573143 CTGATCATTTAGGAAATGGCAGG + Intronic
1184546541 22:45173471-45173493 TTAATTAAGGAGGAAATGGTTGG + Intronic
949978468 3:9482287-9482309 TTGATTAGGCCTGAAAGGGCTGG + Intergenic
950637157 3:14323398-14323420 AAGATTATGCAGGCAAGGGCAGG - Intergenic
950877002 3:16284956-16284978 TTGAACATGAAGGAAAGGGCTGG + Intronic
953245457 3:41187088-41187110 TTCATTCTGCAGAAAAGGGCAGG - Intergenic
955438393 3:58929628-58929650 TTGATTATGGAATAAATGGATGG - Intronic
956892047 3:73623049-73623071 TTGATTAAAAAGGAAATGACTGG + Intronic
958513356 3:95078420-95078442 TTGAGTAGGGAGGACATGGCTGG + Intergenic
960472871 3:118089203-118089225 TTGATTATTGAAGAAATGCCAGG - Intergenic
964769511 3:160209787-160209809 TTGATGATGCAGGAGATGAAAGG + Intergenic
964811718 3:160671982-160672004 TTGAGTATACACTAAATGGCAGG - Intergenic
971891125 4:32523765-32523787 GTGATTATAAAGGAAATGACTGG - Intergenic
972046138 4:34666735-34666757 TTGATTATGGAGGCCATGGAGGG + Intergenic
972053185 4:34765774-34765796 TTAATTATAAAGGAAATGGAAGG - Intergenic
972739526 4:41877410-41877432 CTAAGTAGGCAGGAAATGGCAGG + Intergenic
976937283 4:90651981-90652003 TTTATTATTCAGGATATAGCAGG - Intronic
978191176 4:105914317-105914339 TGGATCATGCAGGTAATAGCTGG + Intronic
978191179 4:105914508-105914530 TGGATCATGCAGGTAATAGCTGG - Intronic
981681949 4:147409465-147409487 TGGATTATTCTGGAAATAGCTGG - Intergenic
981992143 4:150934573-150934595 TTGCTTATTTAGAAAATGGCTGG + Intronic
988046666 5:25964139-25964161 ATGATTATGCAAGAAATGATAGG - Intergenic
990831599 5:59965180-59965202 TTGATGTTGCAGGAAATTGCTGG - Intronic
990874498 5:60468926-60468948 TTGAAGATGCAGGAAATGGTGGG - Intronic
993822705 5:92639547-92639569 CTGTTTATGCAGGTAATGGCTGG + Intergenic
994501531 5:100584803-100584825 TTCATTATTCTGGAAATGGCAGG + Intronic
996998054 5:129723353-129723375 GTAATAATGTAGGAAATGGCAGG + Intronic
999855833 5:155592842-155592864 TTGGTTATGTAGGACCTGGCAGG - Intergenic
999994625 5:157080480-157080502 TTGCTTATGCAGCAAAAGACAGG + Intergenic
1000540030 5:162528140-162528162 CTGTTTCTGCAGGAAATGCCAGG + Intergenic
1002819369 6:710807-710829 TGCAGAATGCAGGAAATGGCAGG + Intergenic
1003103393 6:3194794-3194816 TTGTTGATGCAGGAAATGAGAGG - Intergenic
1003527741 6:6911934-6911956 TAGATGATGCAGGAAAAGGAGGG - Intergenic
1004135583 6:12962850-12962872 TTGATTCTGCAGAACATGGCAGG - Intronic
1004918021 6:20350305-20350327 TTAATTACGAAGGAAATGACAGG - Intergenic
1005047332 6:21654573-21654595 TTGCTGATGTAGGCAATGGCCGG + Intergenic
1005525138 6:26640021-26640043 TTGATAATGCAGGAGAGGGAGGG - Intronic
1006145573 6:31957336-31957358 TTCAATATGCAGGAAATAGATGG - Intronic
1006520418 6:34568147-34568169 TTCATAATGCCGGATATGGCTGG - Intergenic
1009671125 6:66752327-66752349 TTGACTATTCAGGAAATGAAAGG + Intergenic
1012817978 6:104048594-104048616 TTGATTATGAAGGAGTTGGAGGG - Intergenic
1016241697 6:141938882-141938904 TAGATCATGCAGGCAAAGGCTGG - Intergenic
1017248531 6:152254544-152254566 AAGAATATGCAGAAAATGGCCGG - Intronic
1017382077 6:153842920-153842942 TTGAGGATGAAAGAAATGGCTGG - Intergenic
1018143790 6:160864384-160864406 TAGATTAGGGAGGACATGGCGGG - Intergenic
1022342831 7:29485238-29485260 TTGATTATGCAGGACTGGGCAGG + Intronic
1022418815 7:30201287-30201309 TTGCTTATGTAAAAAATGGCAGG + Intergenic
1022693497 7:32681677-32681699 TGTATTATTCAGGAAATGACTGG + Intergenic
1023488844 7:40715634-40715656 TTGAATATGCAGGTAAAGACAGG - Intronic
1023742087 7:43289834-43289856 CTGGTTAGGCAGGAAAAGGCAGG + Intronic
1025253804 7:57369671-57369693 TTGAAAATGAAGGAAAGGGCTGG - Intergenic
1026615648 7:71900947-71900969 ATGATTATTCATGAAAGGGCTGG - Intronic
1026873942 7:73869329-73869351 TTAATAGGGCAGGAAATGGCTGG + Intergenic
1028364010 7:90005992-90006014 TTGATTATGCCTGATTTGGCTGG - Intergenic
1030714007 7:112788026-112788048 AAGAATATGCAGGATATGGCCGG - Intronic
1031354847 7:120778126-120778148 TTGATTGTGTAGGAAAGGGAGGG + Intergenic
1031493412 7:122417728-122417750 TTGGTGATGCAGGAAATGTGAGG + Intronic
1032013822 7:128363487-128363509 TTGATTTTACATGAATTGGCGGG - Intergenic
1032554268 7:132815403-132815425 TTAATTACAAAGGAAATGGCAGG + Intronic
1035239399 7:157520091-157520113 TCGAATCTGCAGGAACTGGCTGG + Intergenic
1037564070 8:20102420-20102442 TGGATTATTCAGTAAATGGTTGG - Intergenic
1038434211 8:27523317-27523339 ATGATTATGAATGAAATGGTGGG - Intronic
1040890509 8:52312084-52312106 TTTATTATTCAGGAAATGAGTGG + Intronic
1043066274 8:75575185-75575207 TTGATTATATAAGAAATGCCTGG + Intergenic
1043817630 8:84822263-84822285 TTGATTATCCAGCCCATGGCAGG + Intronic
1046629573 8:116610039-116610061 TTGTGTGTGCAGGAAATGACAGG - Intergenic
1048010636 8:130452599-130452621 TTGCTAATTCAGGAAATGACAGG - Intergenic
1048679714 8:136827050-136827072 TAGATTTTGCAAGAAATAGCAGG + Intergenic
1051405389 9:16732143-16732165 TTTTTTTTGCAGGAAATGGAGGG - Intronic
1055090396 9:72359359-72359381 TTGATAGTGCAAGAAATGGCTGG - Intronic
1057077247 9:92144466-92144488 TTGGATATGCAGGAAGTAGCAGG + Intergenic
1057711727 9:97451586-97451608 TTTACTATGAAGGATATGGCTGG - Intronic
1059348113 9:113646065-113646087 TTTATTCTGAAGGCAATGGCAGG + Intergenic
1186059913 X:5693575-5693597 TTCATTATGCAAGTAATTGCTGG + Intergenic
1186977713 X:14925619-14925641 TTCATTAGGCACCAAATGGCGGG + Intergenic
1187010408 X:15272809-15272831 TTGATTATGGAGAAATTGGTTGG + Intergenic
1188640169 X:32491239-32491261 TTGATTATGCTCCAAATGGAAGG + Intronic
1189980204 X:46502475-46502497 TAGACTATGAAGGAAATAGCAGG + Intronic
1190509058 X:51158327-51158349 TTTATTATGCATTACATGGCAGG + Intergenic
1193385582 X:80867698-80867720 TTGATTATGCAATAAATTTCAGG - Intergenic
1195245966 X:102995604-102995626 TTGACTAAGCAGGATAAGGCAGG - Intergenic
1195970207 X:110464609-110464631 TAGACTATCCAGGCAATGGCTGG + Intergenic
1196190595 X:112790436-112790458 CTGATTATGCAGGGAATGAACGG - Intronic
1198267164 X:135020799-135020821 TTGATTATGTAGGTAGTGGGGGG - Exonic
1200111151 X:153741570-153741592 TGGCTCCTGCAGGAAATGGCCGG + Intronic