ID: 1091009376

View in Genome Browser
Species Human (GRCh38)
Location 11:131984551-131984573
Sequence CACAATGACCACTTCAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091009376_1091009380 -4 Left 1091009376 11:131984551-131984573 CCACATCTGAAGTGGTCATTGTG 0: 1
1: 0
2: 4
3: 15
4: 121
Right 1091009380 11:131984570-131984592 TGTGGAGTACGCCCTACTTGGGG 0: 1
1: 0
2: 0
3: 2
4: 41
1091009376_1091009381 -3 Left 1091009376 11:131984551-131984573 CCACATCTGAAGTGGTCATTGTG 0: 1
1: 0
2: 4
3: 15
4: 121
Right 1091009381 11:131984571-131984593 GTGGAGTACGCCCTACTTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1091009376_1091009379 -5 Left 1091009376 11:131984551-131984573 CCACATCTGAAGTGGTCATTGTG 0: 1
1: 0
2: 4
3: 15
4: 121
Right 1091009379 11:131984569-131984591 TTGTGGAGTACGCCCTACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 30
1091009376_1091009378 -6 Left 1091009376 11:131984551-131984573 CCACATCTGAAGTGGTCATTGTG 0: 1
1: 0
2: 4
3: 15
4: 121
Right 1091009378 11:131984568-131984590 ATTGTGGAGTACGCCCTACTTGG 0: 1
1: 0
2: 0
3: 2
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091009376 Original CRISPR CACAATGACCACTTCAGATG TGG (reversed) Intronic
900871845 1:5309999-5310021 AGCAGTGACCCCTTCAGATGAGG + Intergenic
904759403 1:32791161-32791183 CAAAATGAGCTCTTCAGAAGAGG - Exonic
905528604 1:38658687-38658709 TACAAAACCCACTTCAGATGGGG - Intergenic
906553522 1:46687820-46687842 CTCAATGACCTCTTAAGTTGGGG + Intronic
908663577 1:66464658-66464680 CACAATGTCTATTTCAAATGTGG + Intergenic
910082976 1:83364019-83364041 CTGAATGTCCATTTCAGATGTGG + Intergenic
910279077 1:85478771-85478793 GTCAATGACCACTTCTGATGAGG - Intronic
916166867 1:161972742-161972764 CACAATGGCCACTTCTGTTATGG - Intergenic
917916721 1:179709584-179709606 CAAAAGGACCACTCCAGCTGAGG - Intergenic
1064307413 10:14180092-14180114 CACAATGATCCCATGAGATGTGG + Intronic
1065920228 10:30386785-30386807 TGCAATGACCACTTCTGATGGGG + Intergenic
1066124606 10:32328546-32328568 TCCAATGACTACTTCAGATGAGG + Intronic
1068829760 10:61480021-61480043 CATGATGACCACTGCAGATATGG - Intergenic
1069551936 10:69370223-69370245 CACAATGAACCCATCTGATGGGG + Intronic
1070235856 10:74625381-74625403 CACAATTACCATTTCAGAGATGG - Intronic
1074800908 10:117000240-117000262 CACAATGACCACGTCAGTCTGGG - Intronic
1076597693 10:131635973-131635995 CACAATCACCACTTCTGTTCAGG - Intergenic
1077868268 11:6240604-6240626 CAACATGAACACTGCAGATGCGG + Exonic
1078444707 11:11395471-11395493 CACAATGATCCCATGAGATGGGG + Intronic
1078759123 11:14237555-14237577 CACGCTGTCCACTGCAGATGAGG - Intronic
1078766382 11:14302560-14302582 TCCAATGCCCACTTCAGATGTGG + Intronic
1080120361 11:28669973-28669995 AACAATTACCACTTCAGCTTGGG - Intergenic
1080347180 11:31338041-31338063 TCCATTGACCACATCAGATGTGG + Intronic
1080729760 11:34937367-34937389 CCCATTCACCACTCCAGATGTGG - Intronic
1083356460 11:62069978-62070000 CATAAAGACCACCTCTGATGGGG + Intergenic
1084848937 11:71922834-71922856 CAGAATCACCACATCAGATCAGG + Intronic
1086959881 11:92970742-92970764 CATGATGACCACTTCAGCTTAGG + Intronic
1087288753 11:96297090-96297112 CTCAATGACCACTTCAGCTTGGG + Intronic
1088313416 11:108484003-108484025 CACAGTGAGCACTTCCAATGTGG - Intronic
1089935726 11:122362202-122362224 CCCATTGACAATTTCAGATGTGG + Intergenic
1090581905 11:128169746-128169768 CACAATGAGTACTTCAGATTTGG - Intergenic
1091009376 11:131984551-131984573 CACAATGACCACTTCAGATGTGG - Intronic
1093127754 12:15350901-15350923 CACTATGACAACTTCAGAACTGG + Intronic
1093801873 12:23383387-23383409 CTCAATGATCACTTCAGAGAGGG + Intergenic
1094237413 12:28184538-28184560 CCCAATGACCATCTCAGATAGGG - Intronic
1096188910 12:49601878-49601900 AACAATGCTAACTTCAGATGAGG + Intronic
1096588302 12:52639320-52639342 CCCAATGGCCACTTAAAATGGGG + Intergenic
1097471099 12:59992838-59992860 GATAATAGCCACTTCAGATGGGG - Intergenic
1106739207 13:32620977-32620999 CACAATTAGCACTTGAAATGTGG - Intronic
1109460862 13:62656099-62656121 CACAATGATAACTTCATTTGTGG - Intergenic
1109918452 13:69023119-69023141 CATAATGTCCAGTTCAGAAGAGG + Intergenic
1113846191 13:113393221-113393243 CACAATGAGCCTTTCAGGTGTGG + Intergenic
1117472703 14:56062525-56062547 CACAAAGACCCCGCCAGATGTGG - Intergenic
1117879893 14:60302931-60302953 CACAAGGACCACATAAGATACGG - Intergenic
1118918342 14:70127281-70127303 CACAATAACCACTTCATCTATGG - Intronic
1127217608 15:56840564-56840586 CAACATGACCACTTAAGAGGAGG + Intronic
1129479085 15:75808699-75808721 TGCAATGACCACTTCTGATGGGG - Intergenic
1130510006 15:84581667-84581689 TGCAATAACCACTTCTGATGGGG + Intergenic
1132013223 15:98293844-98293866 CACGGTGACCAGGTCAGATGAGG + Intergenic
1137745620 16:50818140-50818162 CTCAATGACCACTTGGCATGTGG - Intergenic
1138208369 16:55142066-55142088 TACAATGACCCTTTCAGATGAGG - Intergenic
1139340942 16:66267484-66267506 CACCCTGACCACCCCAGATGGGG - Intergenic
1139396269 16:66641714-66641736 CACAGTGACCATTTGAGATTTGG - Intronic
1140138238 16:72227859-72227881 CACAATGAGCACTTCATAAATGG + Intergenic
1140444148 16:75011065-75011087 CAAAATGACCACGTCAGATGAGG - Intronic
1140869727 16:79095506-79095528 CAGAATGTCCTCTTCAGATGAGG + Intronic
1142762207 17:2049485-2049507 CCCAATGCCCACTTCAGCTAGGG + Intergenic
1145848037 17:28061028-28061050 ATCAGTGACCACTTAAGATGGGG + Intronic
1149806824 17:59625787-59625809 CATAATGAGCACTTGAAATGTGG - Intronic
1149890310 17:60383573-60383595 GACAAATACCACTTCATATGAGG + Intronic
1150346523 17:64408874-64408896 CAGCATCACCACTTCAGCTGTGG - Intronic
1150672512 17:67214030-67214052 AACAATAACTTCTTCAGATGGGG + Intronic
1151136535 17:71951330-71951352 CACAATTACCATTTTAGATGAGG - Intergenic
1151279452 17:73062157-73062179 GACAATCAAAACTTCAGATGAGG + Intronic
1153029156 18:697521-697543 CAGGAGGACCACTTGAGATGAGG + Intronic
1155429214 18:25738076-25738098 CACAATGACTCCTTCATATGTGG + Intergenic
1155806544 18:30177129-30177151 CACAATGAGTCCTTGAGATGAGG - Intergenic
1156860559 18:41831231-41831253 CACAATGAGCCCTTAATATGAGG - Intergenic
1157372204 18:47124935-47124957 CACAATGATCACTTGACATCAGG + Intronic
1157733567 18:50025821-50025843 CACAAAGATCACTGCATATGTGG + Intronic
1161629997 19:5349130-5349152 CGCAATGACAAATTCAGATCAGG + Intergenic
1161732877 19:5972816-5972838 CACTCTGACCACCTCAGAGGAGG + Intronic
1165287461 19:34853698-34853720 CACAATGTCCCCTTCCCATGTGG + Intergenic
1167081663 19:47280296-47280318 CACAATGTGCACTTTGGATGAGG + Intergenic
1167133724 19:47604320-47604342 TACAGTGACGGCTTCAGATGAGG + Intergenic
925125615 2:1453689-1453711 CACAGAGACCACCCCAGATGGGG + Exonic
927378236 2:22444160-22444182 CACAATGAGAAAATCAGATGTGG + Intergenic
930987521 2:57608824-57608846 TATAATAAACACTTCAGATGGGG + Intergenic
933863035 2:86488968-86488990 CCCAAGGACCACTCGAGATGGGG - Intronic
939514523 2:143149999-143150021 CACAATGTCCACTTGATTTGTGG + Intronic
940261040 2:151780037-151780059 CACAACATCCACTTCATATGAGG - Intergenic
945932416 2:215868178-215868200 TACTATGACTACTTCATATGTGG - Intergenic
1168744909 20:230666-230688 GACTATGAGCACTTGAGATGTGG - Intergenic
1170429726 20:16264988-16265010 GGCAATAACCACTGCAGATGAGG - Intergenic
1170947234 20:20902097-20902119 CACAATGAACAGGACAGATGAGG - Intergenic
1172032943 20:31994483-31994505 CAGGATGATCACTTGAGATGAGG + Intronic
1172434224 20:34917260-34917282 CCAAATGATCACTTGAGATGGGG - Intronic
1174788465 20:53455255-53455277 CATCAAGACCACGTCAGATGAGG - Intronic
1175044343 20:56090330-56090352 CACAATGCCCACTTCACTTAAGG + Intergenic
1176053131 20:63131091-63131113 CACAATGCCCACCTGAGAGGAGG + Intergenic
1176086236 20:63296801-63296823 CACAATGACCCATTCAGAGCAGG - Intronic
1176239240 20:64068294-64068316 TGCACTGACCACTTGAGATGTGG + Intronic
1177916103 21:27089770-27089792 CCTAATGTCTACTTCAGATGTGG + Intergenic
1182794435 22:32980545-32980567 CATTATGACCACATAAGATGGGG + Intronic
1183982476 22:41549694-41549716 CACACTGACCGCTTCAGCTCTGG - Intergenic
949334084 3:2954408-2954430 CACAATGACAATTTAATATGTGG - Intronic
952919434 3:38274858-38274880 CAGTGCGACCACTTCAGATGTGG - Intronic
953624160 3:44557044-44557066 CACAATGACCACTGCAGGCAGGG + Exonic
956856782 3:73282951-73282973 CATAAGGCCCACTCCAGATGTGG - Intergenic
957273633 3:78062721-78062743 CACAATTTCCACTTCAGTTGAGG - Intergenic
961668702 3:128510683-128510705 CCCAATGCCCACTTCAGATGTGG - Intergenic
962665888 3:137653275-137653297 TTCAATGCGCACTTCAGATGTGG + Intergenic
967713249 3:192733778-192733800 CATAATGCCCACTTAAAATGTGG + Intronic
969098636 4:4752623-4752645 CACCATGACCATTCCAGGTGGGG - Intergenic
970304281 4:14715699-14715721 CTCAATGACCTCCTGAGATGAGG + Intergenic
974231584 4:59122646-59122668 CACAAGGATCACTTTAGCTGGGG - Intergenic
977853597 4:101860341-101860363 CACACTGACCACCCCAAATGAGG - Intronic
978722217 4:111923849-111923871 CACATTGACCACTCCAGATTAGG - Intergenic
978743976 4:112170904-112170926 CACATTGAGCACTTCAAAAGTGG - Intronic
985165301 4:187087932-187087954 CACCATAACCACTTCAAAAGAGG + Intergenic
989432415 5:41371372-41371394 CACAATACCGACTTCAGATAAGG + Intronic
991000144 5:61774564-61774586 AATAATGTCCACTTCATATGTGG + Intergenic
995669803 5:114589674-114589696 GACAATAAACACTTCAAATGGGG + Intergenic
996776486 5:127137891-127137913 ACCAATGTCCACTTCAAATGAGG - Intergenic
997508230 5:134435209-134435231 CACAATGACCTCTGCACCTGTGG - Intergenic
999998405 5:157114192-157114214 CACAATGACCACTTAAGGTGGGG + Intronic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1005791490 6:29307006-29307028 GAGAATGGCCACTTCTGATGAGG - Exonic
1006489918 6:34378592-34378614 CACTATGAGCACTCCAGAGGTGG + Intronic
1006607315 6:35267396-35267418 CAAAATGACCACTTTAGACTAGG + Intronic
1007393664 6:41564966-41564988 CACAAAGTCCATTTCAGGTGGGG + Intronic
1011991779 6:93529538-93529560 AAAAATTACCACTTCAGATTTGG + Intergenic
1018809881 6:167291224-167291246 CACAATGTCCACTTTGTATGGGG - Intronic
1020133921 7:5575380-5575402 CACAAGGATCACTTGAGCTGGGG - Intergenic
1027299809 7:76820219-76820241 CTGAATGTCCATTTCAGATGTGG + Intergenic
1030133055 7:106219432-106219454 GGCTATGACCACTTTAGATGTGG + Intergenic
1030218151 7:107067816-107067838 CACAATGACAACATCAAATTTGG - Intronic
1031640617 7:124159616-124159638 CGCCATGACCACTTTATATGTGG + Intergenic
1032887053 7:136151812-136151834 CACAATGACCAATTCAGATTGGG + Intergenic
1037299534 8:17436219-17436241 GATAATGAGCACTTCAGATGTGG - Intergenic
1045706633 8:104930953-104930975 CACACTGATTACTCCAGATGTGG - Intronic
1047257610 8:123227508-123227530 CACAGTAACCTCTTCAGATGCGG + Intronic
1048857432 8:138696737-138696759 CACAGTGACCAATACAGAGGAGG + Intronic
1051503270 9:17801247-17801269 CCCAAAGAACACTTCAGTTGAGG - Intergenic
1052460619 9:28757957-28757979 CAGAATGACCACAACAGGTGGGG + Intergenic
1058559748 9:106213593-106213615 CACAATCACCAAAACAGATGGGG - Intergenic
1187491047 X:19751683-19751705 CACAAGGACCACTTGAGAAAAGG + Intronic
1188889672 X:35594968-35594990 CATCATGACCACTCCAGCTGTGG + Intergenic
1195038999 X:100996614-100996636 CACAATTACCATTTCAGGTTTGG + Intergenic
1195637087 X:107130279-107130301 CACAATGAAAAGTTCACATGAGG + Intronic
1198455589 X:136814541-136814563 TACAATGACCAATCCAGAAGGGG - Intergenic