ID: 1091009693

View in Genome Browser
Species Human (GRCh38)
Location 11:131988041-131988063
Sequence ATCGGATGGTGCCTTGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1050
Summary {0: 1, 1: 0, 2: 16, 3: 249, 4: 784}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091009693_1091009697 11 Left 1091009693 11:131988041-131988063 CCAATATCAAGGCACCATCCGAT 0: 1
1: 0
2: 16
3: 249
4: 784
Right 1091009697 11:131988075-131988097 TGAGAGTCCATTTCCTCAGATGG 0: 1
1: 0
2: 1
3: 12
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091009693 Original CRISPR ATCGGATGGTGCCTTGATAT TGG (reversed) Intronic
901184528 1:7364332-7364354 ATCTGCTGGTGTCTTGATCTTGG - Intronic
901219719 1:7576568-7576590 AATTGATGGTGCCTTGATCTTGG + Intronic
902189543 1:14752498-14752520 ATCTGCTGGTGTCTTGATCTTGG - Intronic
902907753 1:19571283-19571305 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
903588399 1:24435915-24435937 ATCTGCTGGGGCCTTGATCTTGG - Intronic
903738942 1:25547056-25547078 ATAGGATGGTGTCTTCATTTGGG + Intronic
903934845 1:26888376-26888398 ATCGGCTTGTGTCTTGATCTTGG + Intronic
905496808 1:38395775-38395797 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
905826830 1:41032103-41032125 ATCTGCTGGTGCCTTGATCTTGG + Intronic
905945408 1:41897523-41897545 ATCTGCTGGTGCCTTGACCTTGG + Intronic
905953380 1:41971997-41972019 ATCTGCTGGTGCCTTGATCTTGG + Intronic
906072526 1:43027425-43027447 ATCAGTTGGTACCTTGATCTTGG + Intergenic
906697861 1:47836867-47836889 ATATGCTGGTGCCTTGATCTTGG + Intronic
906785911 1:48615853-48615875 AACTGCTGGTGCCTTGATCTTGG - Intronic
907446574 1:54511936-54511958 ATCAGCTGGTCCCTTGATCTTGG - Intergenic
907534048 1:55132237-55132259 ATCTGCTGGTGCCTTGATCTTGG + Intronic
907706137 1:56834354-56834376 ATCTGCTGGGGCCTTGATCTTGG + Intergenic
907756302 1:57313958-57313980 ATCTGCTGGAGCCTTGATCTTGG + Intronic
907757660 1:57326633-57326655 ATCTGCTGGTGCCTTGCTCTTGG - Intronic
907821081 1:57970116-57970138 ATCAGATGGTGCCTTGATCTTGG + Intronic
908016578 1:59845099-59845121 ATCTGCTGGTACCTTGATTTTGG - Intronic
908113071 1:60916182-60916204 ATCTGCTGGTGCCTTGACCTTGG - Intronic
908176674 1:61562648-61562670 ACCTGTTGGTGCCTTGATCTTGG - Intergenic
908326621 1:63029658-63029680 ACCTGCTGGTGCCTTGATTTTGG + Intergenic
908341034 1:63179345-63179367 ATCTGCTGGTACCTTGATCTTGG + Intergenic
908347104 1:63245262-63245284 ATCTGCTGGAGCCTTGATCTTGG - Intergenic
908388519 1:63664778-63664800 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
908726801 1:67185035-67185057 ATCTGCTGATGCCTTGATCTTGG + Intronic
908900091 1:68946592-68946614 ATTGTCTGGTGCCTTGATCTTGG + Intergenic
909166852 1:72237415-72237437 ATCTGTTGGTGCCTTTATGTTGG - Intronic
909907116 1:81210815-81210837 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
910623299 1:89279496-89279518 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
911108297 1:94155605-94155627 ATCTGCTGGTGCCTTGATCTTGG + Intronic
911199161 1:95026980-95027002 ACTGGCTGGTGCCTTGATCTTGG - Intronic
911631203 1:100185532-100185554 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
911691276 1:100837527-100837549 ATCTGCAGGTGCCTTGATATTGG - Intergenic
911885429 1:103291683-103291705 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
912351031 1:109013186-109013208 ATCTGCTGGTACCTTGATCTTGG + Intronic
912364323 1:109120519-109120541 ATCTGCTGGTGCCTTGATCTTGG + Intronic
912547519 1:110461580-110461602 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
912748928 1:112269341-112269363 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
912941430 1:114048628-114048650 ATCTGCAGGTGCCTTGATCTTGG - Intergenic
914325502 1:146611531-146611553 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
914454609 1:147824229-147824251 CTCTGCTGGTGCCTTGATGTTGG - Intergenic
915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG + Intronic
915647476 1:157284026-157284048 ATCCACTGGTGCCTTGATATTGG - Intergenic
915766575 1:158368512-158368534 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
916334048 1:163650169-163650191 ATCTGCTGGTGCCTTGATCTGGG - Intergenic
916953752 1:169809986-169810008 ATCTACTGGTGCCTTGATATTGG - Intronic
917403672 1:174680427-174680449 ATTGGTTGGTGCCTTGATCTTGG + Intronic
917798225 1:178547421-178547443 ACCAGCTGGTGCCTTGATCTTGG - Intronic
918327359 1:183422674-183422696 ATCTGCTGGTGCCTTAATCTTGG + Intergenic
918329247 1:183441609-183441631 ATCTGCTGGTGCCTTCATCTTGG - Intergenic
918491597 1:185087250-185087272 ATCTGCTGGTGCCATGATCTTGG - Intronic
918740606 1:188126638-188126660 ACCTGATGATGCCTTGATCTTGG - Intergenic
919001566 1:191838353-191838375 ATCTGATGGTGCCTTGATTTTGG + Intergenic
919440745 1:197630296-197630318 ATCTGCTGGTACCTTGATGTTGG - Intronic
919461843 1:197885924-197885946 ATCTGCTGGTGCCTTGATTTTGG - Intergenic
920724975 1:208426595-208426617 ATCTGTTGGTGCCTGGATCTTGG - Intergenic
921336487 1:214092171-214092193 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
921727609 1:218540627-218540649 ATCTGCTGGTGCCTTAATGTTGG + Intergenic
921974867 1:221191386-221191408 CTCTGTTGGTGCCTTGATCTTGG + Intergenic
921990333 1:221359316-221359338 ATCTGCTGGTACCTTGATCTTGG + Intergenic
922070744 1:222190716-222190738 ATCTGCTGGTACCTTGATCTTGG + Intergenic
922254269 1:223878967-223878989 ATCTGCTGGTGTCTTGATTTTGG - Intergenic
922514170 1:226194614-226194636 ATCTGCTGGAGCCTTGATCTGGG - Intergenic
922842881 1:228658514-228658536 ATGGGCTGATGCCTTGATCTTGG + Intergenic
922860335 1:228810912-228810934 ATCTGCTGATGCCTTGATCTTGG - Intergenic
922929396 1:229377041-229377063 ATCTGCTGGTACCTTGATCTTGG + Intergenic
922930785 1:229387668-229387690 ATCTGTTCGTGCCTTGATCTTGG - Intergenic
922975489 1:229780213-229780235 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
923127325 1:231043360-231043382 GTCAGCTGGTGCCTTGATCTTGG - Intergenic
923476893 1:234342391-234342413 ATCTGCTGTTGCCTTGATCTTGG + Intergenic
924122913 1:240820731-240820753 ATCTGCTGGTGCCTTGATCTTGG + Intronic
924200068 1:241649340-241649362 ATCTGCTGGAGCCTTGATTTTGG + Intronic
924415602 1:243853081-243853103 ATCTGCTGGTGCCATGATCTTGG - Intergenic
1063266316 10:4454846-4454868 ATCTGCTGCTGCCTTGATCTTGG + Intergenic
1063561693 10:7134136-7134158 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
1063762262 10:9093171-9093193 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1063802937 10:9602266-9602288 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1064697830 10:17986421-17986443 ATCTGCTGATGCCTTGATCTTGG - Intronic
1064710184 10:18115098-18115120 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1064937719 10:20697186-20697208 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1065338447 10:24679252-24679274 ATCTGCCGGTGCCTTGATCTTGG - Intronic
1065404158 10:25344849-25344871 ATCTGCTGGCACCTTGATATTGG - Intronic
1065731411 10:28712886-28712908 ATCTGATGGTGCCTTGATTTTGG + Intergenic
1065792301 10:29272005-29272027 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1065966823 10:30777479-30777501 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1066020093 10:31289795-31289817 ATATGCTGGTGCCTTGATCTTGG + Intergenic
1066298537 10:34076715-34076737 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1066475149 10:35739487-35739509 ATCTGCTGGTGCCTTGGTCTTGG - Intergenic
1066479455 10:35781451-35781473 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1066533689 10:36367058-36367080 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
1066539397 10:36428948-36428970 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1066645999 10:37609718-37609740 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
1067385710 10:45816344-45816366 ATCTGCTGGAGCCTTGATCTTGG + Intronic
1067782019 10:49214687-49214709 ACCTGCTGGTGCCTTGATCTGGG - Intergenic
1068068786 10:52169314-52169336 ATCTGCTGATGCCTTGATCTTGG - Intronic
1068391446 10:56402458-56402480 ATCTGTTGGTGCCTTGATCTTGG - Intergenic
1068412064 10:56669102-56669124 ATCTGCTGGTGCTTTGATCTTGG - Intergenic
1068927814 10:62558251-62558273 ATCTGATGATGTCTTGATCTGGG + Intronic
1068945849 10:62728071-62728093 ATCTATTGGTGCCTTGATCTTGG - Intergenic
1069732629 10:70628350-70628372 ATCTGCTGGTGTCTTGATCTTGG - Intergenic
1069747538 10:70725482-70725504 ATCTGCTGGTGCCCTGATCTTGG - Intronic
1070020377 10:72579272-72579294 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1070104781 10:73421175-73421197 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
1070706687 10:78644731-78644753 ATCTGCTAGTGCCTTGATTTTGG - Intergenic
1071338046 10:84617777-84617799 ATCTGCTGGTGACTTGATCTTGG + Intergenic
1071533504 10:86407916-86407938 ACCAGCTGGTGCCTTGATCTTGG - Intergenic
1071921989 10:90360664-90360686 AACTGCTGGTGCCTTGATCTTGG + Intergenic
1072123347 10:92423484-92423506 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1072230597 10:93411266-93411288 ATCCGCCGGTGCCTTGATCTTGG - Intronic
1072288565 10:93940890-93940912 ATCTGCTAGTGCCTTGATCTTGG + Intronic
1072708658 10:97700892-97700914 ATCTGACAGTGCCTTGATTTTGG - Intergenic
1072897565 10:99379905-99379927 ATCTGCTGGCACCTTGATATTGG - Intronic
1073026618 10:100491975-100491997 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1073080894 10:100860004-100860026 ATCTGCTGGTGCTTTGATCTTGG - Intergenic
1073470476 10:103719050-103719072 ATCTGCTGGTGCCTTGGTTTAGG + Intronic
1073807798 10:107118259-107118281 ATCCGTTGCTGCCTTGATCTTGG + Intronic
1073877938 10:107947399-107947421 ATCTGCCAGTGCCTTGATATTGG - Intergenic
1073941406 10:108703062-108703084 ATCTGATGGTGCCTTGATCTTGG - Intergenic
1073982252 10:109168031-109168053 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1074146236 10:110719937-110719959 ATTTGCTGGTGCCTTGATCTTGG - Intronic
1074148395 10:110737309-110737331 ATCTGCTGGTGCCTTGATTGTGG + Intronic
1074258528 10:111828481-111828503 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1074754515 10:116614572-116614594 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1074783586 10:116819577-116819599 ATCAGTTGGTGTCTTGATTTTGG + Intergenic
1074836480 10:117300856-117300878 ATCTGCTGGTGCCCTGATCTTGG + Intronic
1075019523 10:118941286-118941308 ATCTGCTGGTGCTTTGATCTTGG - Intergenic
1075156835 10:119984813-119984835 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1075395941 10:122127100-122127122 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1075535342 10:123266827-123266849 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1075570430 10:123538002-123538024 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1075613551 10:123874193-123874215 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1075625260 10:123959575-123959597 ATCTGCTGGTGCCTTTATCTTGG + Intergenic
1075987431 10:126799850-126799872 ATTTGCTGGTACCTTGATATAGG - Intergenic
1076350879 10:129814436-129814458 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
1076398082 10:130156170-130156192 ATCTGCTGGTGCTTTGATCTTGG - Intronic
1077892445 11:6429274-6429296 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
1077956607 11:7027329-7027351 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1078087109 11:8240551-8240573 ATCTGTTGGTGCCTTGCTCTCGG - Intronic
1078194471 11:9123995-9124017 ATTTGCTGGTGCCTTGATCTTGG + Intronic
1078424130 11:11235521-11235543 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1078734742 11:14009714-14009736 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1078843638 11:15102149-15102171 ATCTGCTGATGCCTTGATCTTGG - Intergenic
1078931646 11:15916742-15916764 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1078964767 11:16325987-16326009 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1079091602 11:17484418-17484440 TTCTGCTGGTGCCTTGATCTTGG + Intergenic
1079147817 11:17869492-17869514 ATCAGCTGGTACCTTGATCTTGG - Intronic
1079778026 11:24558864-24558886 ATCTGATGATGGCTTGATCTTGG + Intronic
1079966539 11:26987090-26987112 ATCTGCTGGTACCTTGATTTTGG + Intergenic
1079969150 11:27015379-27015401 ATCTGTTGGTGCCTTGATTTTGG - Intergenic
1080377472 11:31730270-31730292 ACCTGTTGGTGCCTTGATCTTGG - Intronic
1080392129 11:31858067-31858089 ATCTACTGGTGCCTTGATCTTGG + Intronic
1080397276 11:31901868-31901890 ATCTGCTGATGCCTTGATATTGG - Intronic
1080559113 11:33445915-33445937 ATCTGTTGGTGCTTTGATCTTGG + Intergenic
1080695045 11:34596134-34596156 ATCTGCTGGTGCCTTGCTCTTGG + Intergenic
1080840296 11:35977719-35977741 ATCTGCTGGTGACTTGATCTTGG - Intronic
1080849083 11:36052253-36052275 ATGGGATGGTGACATGATATGGG + Intronic
1080942366 11:36933897-36933919 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1081063808 11:38513972-38513994 CTCTGCTGGTGCCTTGATCTTGG - Intergenic
1081064025 11:38517605-38517627 TTCTGCTGGTGCCTTGATCTTGG + Intergenic
1081848268 11:46256830-46256852 ATCTGCTGGTACCTTGATTTTGG + Intergenic
1082008879 11:47437361-47437383 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1083538436 11:63492636-63492658 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1083915816 11:65743174-65743196 ATCTGATAGTGTCTTGATCTTGG - Intergenic
1084100279 11:66943395-66943417 ATCTGCTGCTGCCTTGATCTTGG + Intronic
1084976414 11:72801713-72801735 ATCTGTTGGTGTCTTGATCTTGG + Intergenic
1084993913 11:72956561-72956583 ATCTGCTGGCGCCTTGATCTTGG - Intronic
1085654111 11:78296845-78296867 ATCTGCTGGTGCCTTGATCCTGG - Intronic
1085736360 11:79042558-79042580 ATCTGTTGGTGCCTTGATCTTGG + Intronic
1085830008 11:79889609-79889631 ATCTGTTAGTGCCTTGATCTTGG + Intergenic
1085846467 11:80071468-80071490 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1085877148 11:80422375-80422397 ATCTGCTGGTGCCTTGATTATGG - Intergenic
1086238328 11:84658984-84659006 ATCTGTTGGCGCCTTGATCTTGG + Intronic
1086532828 11:87806299-87806321 ATCTGCTGGTGCCCTGATCTTGG - Intergenic
1086744726 11:90410776-90410798 ATCTGCTGGTACCTTGATCTGGG - Intergenic
1086860487 11:91919596-91919618 ATCTGCTGGTGCTTTGATCTTGG - Intergenic
1086942616 11:92814093-92814115 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1087004024 11:93451038-93451060 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1087022118 11:93614262-93614284 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1087215502 11:95488716-95488738 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1087676562 11:101169238-101169260 GTCGGCCGGTGCCTTGATCTTGG + Intergenic
1087814987 11:102648543-102648565 ATCTGCTGGTGCCTTCATCTTGG + Intergenic
1088105636 11:106203919-106203941 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
1088252902 11:107877127-107877149 ACCTGCTGGTGCCTTGATCTTGG - Intronic
1088361021 11:108990112-108990134 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1088697906 11:112384273-112384295 ACCTGTTGGTGCCTTGATCTTGG - Intergenic
1088962675 11:114685304-114685326 ATCTGTTGATGCCTTGATCTTGG - Intronic
1089829577 11:121314953-121314975 ACCAGCTGGTGCCTTGATCTTGG + Intergenic
1089878384 11:121747826-121747848 CTCAGATGCTGCCTTGATCTTGG + Intergenic
1090374466 11:126279207-126279229 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1090980451 11:131716077-131716099 ATTGGCTGGTGTCTTGATCTTGG - Intronic
1091009693 11:131988041-131988063 ATCGGATGGTGCCTTGATATTGG - Intronic
1091521575 12:1249779-1249801 ATCTGCTGGTTCCTTGATCTTGG - Intronic
1092395100 12:8118979-8119001 ATATGCTGGTGCCTTGATCTTGG + Intergenic
1093214140 12:16343337-16343359 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1093378057 12:18455612-18455634 ATCTGCTGGTACCTTGATCTTGG - Intronic
1094802940 12:34058706-34058728 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1095222988 12:39640328-39640350 ATCTGTTGGTGCCTTGATCTTGG + Intronic
1095270647 12:40214718-40214740 ATCTGATGGTGCCTTAATAGTGG + Intronic
1095395140 12:41754246-41754268 ATCTTCTGGTGCCTTGATCTTGG + Intergenic
1095408474 12:41894622-41894644 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1095453853 12:42361272-42361294 ATCTGCTGGTACCTTGATCTTGG + Intronic
1095568642 12:43656544-43656566 GTCTGCTAGTGCCTTGATATTGG - Intergenic
1096540699 12:52305331-52305353 ATCGTACTGTGCCTTGATCTCGG - Exonic
1097292443 12:57929456-57929478 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
1097306331 12:58073117-58073139 ATCTGCTAGTGCCTTGATTTTGG + Intergenic
1097523468 12:60699911-60699933 ATCTGCTGGTGCATTGATCTTGG - Intergenic
1097575336 12:61386282-61386304 ATCTACTGGTGCCTTGATCTTGG - Intergenic
1097776096 12:63648186-63648208 ATCTGCTGGCGCCTTGATCTTGG + Intronic
1097811944 12:64028586-64028608 ATCTGCTGCTGCCTTGATCTTGG - Intronic
1098156007 12:67599461-67599483 ATCTGTTGGTGCCTTGATCTTGG - Intergenic
1098191737 12:67956312-67956334 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
1098327070 12:69313908-69313930 ATCTGCTGGTGCCTTGATATTGG + Intergenic
1098507546 12:71271647-71271669 ATCTGCTGGTGCCATGATCTTGG - Intronic
1098527024 12:71498402-71498424 ATCTGCTGGTACCTTGATCTTGG - Intronic
1099069129 12:78023953-78023975 TTCTGATGGTGCCTAGATCTAGG - Intronic
1099274937 12:80563216-80563238 ATCTGCTGGTGCCCTGATGTTGG - Intronic
1099339478 12:81410137-81410159 ATCTGCTGATGCCTTGATGTTGG + Intronic
1099347845 12:81525012-81525034 ATTTGAGGGTGCCTTGATCTTGG + Intronic
1099794374 12:87379418-87379440 ATCTGCTGCTGCCTTGATCTTGG + Intergenic
1100343951 12:93708881-93708903 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1100379274 12:94046624-94046646 ATGTGTTGGTGCCTTGATCTTGG - Intergenic
1100600093 12:96105442-96105464 ATCTGCTGGGGCCTTGATCTTGG + Intergenic
1100779697 12:98010761-98010783 AGCTGCTGGTGCCTTGATCTTGG + Intergenic
1101614002 12:106318593-106318615 ATCTGGTGGTGCTTTGATTTTGG - Intronic
1101691719 12:107088585-107088607 ATCTGCTGGTGCCTTGATTCTGG + Intronic
1101733104 12:107442907-107442929 ATCTGCTGGTGCCTTGATCCTGG - Intronic
1101734584 12:107453528-107453550 ATCTGCTGGTGCCTTGGTTTTGG + Intronic
1101762814 12:107672986-107673008 ATCTGCTGGTGCCTTGATGTTGG + Intergenic
1101819504 12:108173065-108173087 ATCTGCTGGCGCCTTGATCTTGG + Intronic
1102414336 12:112747385-112747407 ATCTGCTGGTGCTTTGATCTTGG + Intronic
1102817698 12:115881031-115881053 ATCTATTGGTGCCTTGATCTTGG + Intergenic
1103171572 12:118824995-118825017 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1103448347 12:121009665-121009687 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1103579405 12:121903224-121903246 ATTGGCTGGTGCCTGGATCTTGG - Intronic
1104002932 12:124871951-124871973 ATCTGCTGGCGCCTTGATCTTGG + Intronic
1104069099 12:125329234-125329256 ATCTGCTGGCGCCTTGATCTTGG + Intronic
1104093828 12:125538054-125538076 AGCGGATGGAGACTTGAGATGGG - Intronic
1104310535 12:127650859-127650881 ATCTGCTGGTTCCTTGATCTTGG - Intergenic
1104695616 12:130861397-130861419 ATGTGCTGGTGCCTTGATCTTGG - Intergenic
1106886645 13:34192449-34192471 ATCTGCTGATGCCTTGATCTTGG - Intergenic
1107057159 13:36118821-36118843 ATCTGCTGGTGTCTTGATCTTGG - Intronic
1107066410 13:36218036-36218058 ATCTGCTGCTGCCTTGATCTTGG + Intronic
1107371373 13:39753325-39753347 ATCTTTTGGTGCCTTGATTTTGG + Intronic
1107496567 13:40931066-40931088 ACCTGCTGGTGCATTGATATCGG + Intergenic
1107665228 13:42681451-42681473 AACAGATGGTGCCTTGGGATGGG + Intergenic
1107881621 13:44837080-44837102 GTCCGCTGGTGCCTTGATCTTGG - Intergenic
1108033777 13:46265448-46265470 ATCTGCTGGGGCCTTGATATTGG - Intronic
1108679519 13:52767460-52767482 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
1108745058 13:53385102-53385124 CTCTGGTGGTGCCTTGATCTTGG - Intergenic
1109271780 13:60263750-60263772 ATCTGCTGGTGCCTTGTTGTAGG + Intergenic
1109551192 13:63902589-63902611 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1109732661 13:66436342-66436364 AGATGATGGTGCCTTGATCTTGG + Intronic
1109979465 13:69888063-69888085 ATCTGATGGTGCCTTGATGTTGG - Intronic
1110266309 13:73541837-73541859 TTCTAAAGGTGCCTTGATATTGG - Intergenic
1110315950 13:74107024-74107046 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1110666598 13:78124774-78124796 ATTTGCTGGTGCCTTGATCTTGG - Intergenic
1110707532 13:78612198-78612220 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1111246174 13:85544619-85544641 ATCTTTTGGTGCCTTGATCTTGG + Intergenic
1111816644 13:93162429-93162451 ATCTGCTAGTGCCTTGATTTTGG - Intergenic
1111852523 13:93594729-93594751 ATCTGCTAGTGCCTTGATATTGG - Intronic
1111969764 13:94899868-94899890 ATCTGCGGGTGCCTTGATCTTGG - Intergenic
1112608052 13:100927376-100927398 ATCTGCTGGTGCCTTCATCTTGG + Intergenic
1112764268 13:102724066-102724088 ATCTGCTGGTGCCTAGATCTTGG + Intergenic
1113321286 13:109234934-109234956 ACCTGCTGGTGCCTTGATCTGGG + Intergenic
1113389100 13:109878578-109878600 ATCTGATGGCACCTTGATCTTGG + Intergenic
1113428493 13:110229721-110229743 ATCTGCTGGAGCCTTGATCTTGG + Intronic
1114731283 14:24995111-24995133 ATCTGCTGATGCCTTGATCTTGG - Intronic
1114888745 14:26888955-26888977 ATCTGCTGGTGTCTTGATCTTGG - Intergenic
1115009375 14:28525680-28525702 GTCTGATGGTGCCATGGTATTGG + Intergenic
1115658417 14:35466269-35466291 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1115705599 14:35994826-35994848 GTCGGCTGATGCCTTGATCTTGG + Intergenic
1115708922 14:36028442-36028464 ATTGGCTGGTGCCTTGATCTTGG + Intergenic
1115977019 14:39008079-39008101 ATCTGCTGGTGCTTTGATCTTGG - Intergenic
1116091531 14:40313240-40313262 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
1116155952 14:41206073-41206095 ATCTGACAGTGCCTTGATTTTGG - Intergenic
1116503198 14:45646085-45646107 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
1116837702 14:49787341-49787363 ATCTGCTGGTGCCTTGATGCTGG - Intronic
1118352329 14:64981987-64982009 ATCTGCAGGTGCCTTGATGTTGG - Intronic
1118437841 14:65787663-65787685 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1118591104 14:67401647-67401669 AACTGCTGGTACCTTGATATTGG + Intronic
1118815551 14:69311160-69311182 ACCTGCTGGTGCCTTGATCTTGG - Intronic
1118996398 14:70840486-70840508 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1119298026 14:73549077-73549099 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1119302312 14:73581262-73581284 ATCTGTGGGTGCCTTGATCTTGG - Intergenic
1119680073 14:76585550-76585572 ATCCACTGGTGCCTTGATCTTGG - Intergenic
1119863351 14:77953182-77953204 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1119911459 14:78353363-78353385 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1119992857 14:79218976-79218998 ATATGATGGTGCCTTGTTTTAGG + Intronic
1120150085 14:81023029-81023051 ATCTCTTGGTGCCTTGATCTTGG + Intronic
1120241466 14:81954448-81954470 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
1120306871 14:82781931-82781953 ATGGGATGGCACCTTGATCTTGG - Intergenic
1120398241 14:83995481-83995503 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1120720315 14:87883179-87883201 ATCTGCTGGTGCCTTGATGTTGG + Intronic
1120842182 14:89095634-89095656 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1120916214 14:89712884-89712906 ATCTGCTGCTGCCTTGATCTTGG - Intergenic
1121277892 14:92680083-92680105 GTCTGCTGGTGCCTTGATCTTGG - Intronic
1121659401 14:95623868-95623890 ATCTGCTGGTGCCTTCATCTTGG - Intergenic
1121677255 14:95763904-95763926 ATCTGCTGGTGCCTTGACCTTGG - Intergenic
1121881449 14:97503944-97503966 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1122039989 14:98980352-98980374 ATCTGCTGGTACCTTGATATTGG + Intergenic
1122841407 14:104465678-104465700 TTCAGATGGTGCCTGCATATGGG + Intergenic
1123104751 14:105835742-105835764 ATCGGCTGGAGCCTTGGTCTGGG - Intergenic
1124062111 15:26303305-26303327 ATCTGCCGGTGACTTGATATTGG - Intergenic
1124684805 15:31773360-31773382 ATCTGCAGGTGCCTTGATGTTGG - Intronic
1125217390 15:37290911-37290933 ATCTACTGGTGCCTTGATCTTGG - Intergenic
1125987383 15:44067512-44067534 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1126386481 15:48098899-48098921 ATCTGTTGGTGCCTTGATTTTGG - Intergenic
1126461775 15:48922453-48922475 ATCTACTGGTGCCTTGATCTTGG - Intronic
1126910965 15:53416416-53416438 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1126918410 15:53492089-53492111 ATAGGCTGATGCCTTGATCTTGG - Intergenic
1127346216 15:58102409-58102431 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1127733239 15:61819140-61819162 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1128320193 15:66688044-66688066 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
1129370394 15:75089974-75089996 ATCTGCTGGTGCCCTGATTTTGG - Intronic
1129380269 15:75160628-75160650 ATCTTCTGGTGCCTTGATCTTGG - Intergenic
1129655221 15:77519649-77519671 ATCTGCTGGGGCCTTGATCTTGG + Intergenic
1129751703 15:78069871-78069893 ATCTGCTGGTGCCTTCATCTTGG + Intronic
1129827576 15:78644513-78644535 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1130820915 15:87494884-87494906 ATCTGCTGGTGCCTTGTTCTTGG - Intergenic
1130921135 15:88345615-88345637 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1131322195 15:91405240-91405262 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
1131345160 15:91640081-91640103 ATCTGCTGGTGCCTTAATCTTGG - Intergenic
1131409498 15:92195009-92195031 ATCTGCTGGTGCCCTGATCTTGG + Intergenic
1131533212 15:93212336-93212358 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1131720756 15:95166074-95166096 ATCTGCTGGTACCTTGATTTTGG - Intergenic
1131740867 15:95389826-95389848 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
1131762179 15:95636292-95636314 ATCTGCTGGTGACTTGATCTTGG - Intergenic
1133175465 16:4010959-4010981 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1133475561 16:6118391-6118413 ATCTGCTGGTGCTTTGATTTTGG - Intronic
1133707611 16:8370117-8370139 ATCTGCTGGGGCCTTGATCTTGG - Intergenic
1133830706 16:9320864-9320886 ATCTGTTGGTTCCTTGATCTTGG - Intergenic
1134186948 16:12091894-12091916 ATCTGTCGGTGCCTTGATCTTGG + Intronic
1134503962 16:14790583-14790605 ATCTGCAGGTGCCTTGATCTGGG + Intronic
1134576610 16:15338325-15338347 ATCTGCAGGTGCCTTGATCTGGG - Intergenic
1134725829 16:16418174-16418196 ATCTGCAGGTGCCTTGATCTGGG + Intergenic
1134894296 16:17870935-17870957 ATCTGCTGGCACCTTGATATTGG - Intergenic
1134941604 16:18293685-18293707 ATCTGCAGGTGCCTTGATCTGGG - Intergenic
1135018485 16:18944041-18944063 ATCTACTGGTGCCTTGATTTTGG + Intergenic
1135050812 16:19191468-19191490 ATCAGCTGGTGGCTTGATCTTGG + Intronic
1135059879 16:19262384-19262406 ATCTGCTGGTACCTTGATCTGGG + Intronic
1135178622 16:20253552-20253574 ATCAGCTGGTGCCCTGATCTTGG - Intergenic
1135279689 16:21143459-21143481 ATCTGTTGGTACCTTGATCTCGG + Intronic
1137034380 16:35556984-35557006 ATGGGATGGTGCCTCGTTTTTGG - Intergenic
1137292776 16:47063189-47063211 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1137389991 16:48073448-48073470 ATCTGCTGGTGCCTTGCTGTTGG - Intergenic
1137691264 16:50429675-50429697 ATCTGCTGGTGCCTTTATCTTGG + Intergenic
1137699374 16:50485438-50485460 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1138192670 16:55028468-55028490 ATCTGGTGGTGCCTTGATCTTGG + Intergenic
1138244336 16:55455465-55455487 ATCTGCTGGTGCCATGATCTTGG + Intronic
1138304274 16:55960042-55960064 ATTTGCTGGTGCCTTGATCTTGG - Intergenic
1138647467 16:58435580-58435602 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
1138791507 16:59909118-59909140 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
1139078180 16:63480835-63480857 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
1139243518 16:65418675-65418697 ATCTGCTGGAGCCTTGATCTTGG - Intergenic
1140008060 16:71099416-71099438 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1140231103 16:73117905-73117927 ATCTGCTGGTGCCTTCATCTTGG + Intergenic
1140293780 16:73688581-73688603 ATCTGCTGGTGCCTGGATCTTGG + Intergenic
1140596611 16:76423112-76423134 ATCTGCTGGTGCCTTCATTTTGG + Intronic
1140777658 16:78264828-78264850 ATCTGCTGGTGCCATGATCTTGG + Intronic
1141030047 16:80579701-80579723 ATCTACTGGTGCCTTGATCTTGG + Intergenic
1143213266 17:5205069-5205091 ATCTGCTGGCGCCTTGATCTTGG + Intergenic
1143250928 17:5522464-5522486 ATCTGCTGGCGCCTTGATCTTGG + Intronic
1143570903 17:7757764-7757786 ATCTGCTGGTGCCTTGCTCTTGG - Intronic
1144417738 17:15068079-15068101 ACCAACTGGTGCCTTGATATTGG - Intergenic
1144938144 17:18916742-18916764 ATCTGCTGGTGCCTTGATCCAGG - Intronic
1146180034 17:30692084-30692106 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1146309595 17:31757002-31757024 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
1146484840 17:33234644-33234666 ACCTGCTGGTGCCTTGATCTTGG - Intronic
1146511657 17:33454733-33454755 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1146672587 17:34751908-34751930 ATCTGCTGGCGCCTTGATCTTGG - Intergenic
1148689540 17:49519462-49519484 CTAGGATGGTTCCTTGAAATGGG - Intergenic
1149184892 17:53986009-53986031 ATCTGCTGGTGCCTTAATCTTGG - Intergenic
1149357377 17:55855448-55855470 ATCTGCTGGTGCCCTGATATTGG - Intergenic
1149775875 17:59356735-59356757 ATCTGGTGGTGCCTTGAACTTGG - Intronic
1150188660 17:63214543-63214565 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1150378625 17:64703025-64703047 ATCAGCTGATGCCTTGATTTTGG + Intergenic
1150505482 17:65693959-65693981 ATCTGCTGGTGCTTTGATCTTGG + Intronic
1150650923 17:67009671-67009693 ATCTGCTGGCGCCTTGATCTTGG - Intronic
1151234622 17:72710570-72710592 ATCTTCTGGTGCCTTGATCTTGG + Intronic
1152373584 17:79905876-79905898 ATCTGCTGGAGCCTTGATATTGG + Intergenic
1153077688 18:1183917-1183939 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1153519839 18:5941242-5941264 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1153664017 18:7352005-7352027 ATCCGCTGGTACCTTGATCTTGG + Intergenic
1153668996 18:7392460-7392482 ATCTGCTGGTGCCTTGATATTGG + Intergenic
1154392021 18:13945749-13945771 ATATGCTGGTGCCTTGATCTTGG + Intergenic
1154393811 18:13968890-13968912 ATCGGGTGATGCCTTGATCTTGG - Intergenic
1154938672 18:21088877-21088899 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1154957535 18:21274101-21274123 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1155005950 18:21729367-21729389 GTCGGCTGGTGTCTTGATCTTGG - Intronic
1155320899 18:24617950-24617972 GTCTGCTGGTGCCTTGATCTTGG - Intergenic
1155440155 18:25853985-25854007 ATCTGATGATGTCTTGAGATAGG + Intergenic
1155451697 18:25970113-25970135 ATCTGTGGGTGCCTTGATCTTGG + Intergenic
1155637652 18:27974835-27974857 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1156226329 18:35112884-35112906 ATCTGCTGGTGCCTTGGTCTTGG - Intronic
1156258223 18:35419686-35419708 ATCTGATAGTGCATTGATTTTGG + Intergenic
1156579990 18:38363723-38363745 ATCTATTGGTGCCTTGATCTTGG + Intergenic
1156581527 18:38382172-38382194 ATCTATTGGTGCCTTGATCTTGG - Intergenic
1157369140 18:47094232-47094254 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1157510517 18:48268906-48268928 ATCTGCTGGTGGCTTGATCTTGG - Intronic
1157663586 18:49466829-49466851 ATATGCTGGTGCCTTGATCTTGG + Intergenic
1157869952 18:51220879-51220901 ATTGGCTGGTGCCTTGATCTTGG - Intergenic
1157888782 18:51394584-51394606 ATCTGCTGGTGCCTTCATCTTGG + Intergenic
1158400341 18:57116113-57116135 ATCTGCAGGTGCCTTGATGTTGG - Intergenic
1158733694 18:60055372-60055394 ATCAGTTGGTGCCTTGATCTTGG - Intergenic
1158980463 18:62755643-62755665 ATCTACTGGTGCCTTGATCTTGG + Intronic
1159271616 18:66160182-66160204 ATCCGCTAGTGCCTTGACATGGG - Intergenic
1159443550 18:68511566-68511588 ATCTGTAGGTGCCTTGATCTTGG + Intergenic
1159642588 18:70880891-70880913 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
1159810577 18:73013845-73013867 ATCTGATGCTGCCTTGACCTTGG - Intergenic
1160104124 18:75953754-75953776 ATCTACTGGTGCCTTGATCTTGG - Intergenic
1160113985 18:76059720-76059742 AGCTGCTGGTGCCTTGATCTGGG + Intergenic
1160821911 19:1062859-1062881 ATGGGGTGGGGCCTTGGTATGGG - Intronic
1162552881 19:11367627-11367649 ATCTGCTGGGGCCTTGATCTTGG - Intergenic
1162868216 19:13565182-13565204 ATCTACTGGTGCCTTGATCTTGG + Intronic
1162877951 19:13634841-13634863 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1162978572 19:14223472-14223494 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
1163627975 19:18401814-18401836 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1165548573 19:36563021-36563043 ACCTGATGATGCCTTGATCTTGG + Intronic
1167729421 19:51242654-51242676 ATCTGCTGGTCCCTTGATCTTGG - Intronic
1167754662 19:51404657-51404679 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
925016869 2:534624-534646 ATCTGCTGGTGTCTTGATCTCGG - Intergenic
925456582 2:4021604-4021626 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
925715299 2:6779528-6779550 ATCTGCTGGTGCTTTGATCTTGG - Intergenic
926396454 2:12447452-12447474 ATCTGCTGGTTCCTTGATCTTGG + Intergenic
926428161 2:12758732-12758754 ATCTGCTGATGCCTTGATCTTGG + Intergenic
926840371 2:17073141-17073163 ATCTGCTGGTACCTTGATCTTGG + Intergenic
927191291 2:20518901-20518923 CTCTGTTGGTGCCTTGATCTTGG + Intergenic
927789136 2:25996445-25996467 ATCTGCTGGTGCCTTGATTTTGG - Intergenic
928415914 2:31091647-31091669 ATCTGCTGGTGCTTTGATCTAGG - Intronic
929166618 2:38888148-38888170 ATCTGCTAGTGCCTTGATCTTGG + Intronic
929520159 2:42642364-42642386 ATCTGATGGTGGCTTCATGTGGG + Intronic
930107186 2:47649548-47649570 ATATGCTGGTGCCTTGATCTTGG + Intergenic
931373228 2:61683507-61683529 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
931483383 2:62666290-62666312 ATCTGGTGGTGCCTTGATCTTGG - Intergenic
931685492 2:64788843-64788865 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
932001127 2:67886149-67886171 ATCTGCTGGTGCCTTCATCTTGG - Intergenic
932291471 2:70583690-70583712 ATCTGTTGGTGCCTTGATCTTGG - Intergenic
932515831 2:72348080-72348102 ATCTGTAGGTGCCTTGATCTTGG - Intronic
932634347 2:73375044-73375066 AACTGCTGGTGCCTTGATCTTGG + Intergenic
932634461 2:73376237-73376259 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
932689173 2:73897738-73897760 ATCTGCTGGTGCCTTGATCTTGG - Intronic
932836075 2:75038809-75038831 ATCTGCTGTTGCCTTGATCTTGG - Intergenic
933290844 2:80436658-80436680 ATCTGCTGGTGCCTCGATCTTGG - Intronic
933290904 2:80437131-80437153 ATCTGCTGGTCCCTTGATCTTGG + Intronic
933546228 2:83716149-83716171 ATCTGTAGGTGCCTTGATGTTGG - Intergenic
933755719 2:85636771-85636793 ATGTGATGGTGTCTTGATGTGGG + Intronic
934987180 2:98895982-98896004 ATCTGCTGGCGCCTTGATCTAGG + Intronic
935115534 2:100132331-100132353 ATAGCATGATGCTTTGATATAGG - Intronic
935235308 2:101133523-101133545 ATCTGCTGGTGCCTTGATCTTGG - Intronic
935268684 2:101415380-101415402 ATCTGCTGGTGCCTTGATCTTGG + Intronic
935326963 2:101946240-101946262 ATATGACGGTGCCTTGATCTTGG + Intergenic
935524440 2:104148095-104148117 ATTGGATTGTGCCTTGATCTTGG + Intergenic
936619445 2:114080341-114080363 ATCTGCTGGTGCCTTCATCTTGG - Intergenic
936948568 2:117953994-117954016 ATCTGTTGGTGCCTCGATCTTGG + Intronic
937029734 2:118728464-118728486 ATCTGCTGGTACCTTGATCTTGG + Intergenic
937035719 2:118780112-118780134 ATCTATTGGTGCCTTGATCTTGG + Intergenic
937116114 2:119406213-119406235 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
937134361 2:119540188-119540210 ATGTGCTGGTGCCTTGATCTTGG + Intergenic
937253151 2:120536694-120536716 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
937282796 2:120731823-120731845 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
937440986 2:121915918-121915940 ATCTGTTGGTACCTTGATCTTGG - Intergenic
937496572 2:122426482-122426504 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
937589470 2:123595754-123595776 ATCTGCTGATGCCTTGATCTTGG - Intergenic
937589898 2:123600246-123600268 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
938109840 2:128556538-128556560 ATCTGCTGGTGTCTTGATGTTGG + Intergenic
938132628 2:128730877-128730899 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
938684295 2:133721944-133721966 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
939089912 2:137768120-137768142 ATCTACTGGTGCCTTGATCTTGG - Intergenic
939119558 2:138100302-138100324 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
939383763 2:141469455-141469477 ATCTGCTGGTACCTTGATCTTGG - Intronic
939877777 2:147597497-147597519 ATCTGCTGGCGCCTTGATCTTGG + Intergenic
939988205 2:148852998-148853020 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
940039138 2:149341683-149341705 ACCAGCTGGTGCCTTGATCTTGG - Intronic
940042004 2:149370575-149370597 ATCTGCTGGTGCCCTGATCTTGG + Intronic
940069521 2:149669916-149669938 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
940493798 2:154399382-154399404 ATCGGTTGGCACCTTGATCTTGG - Intronic
940494984 2:154416263-154416285 ATCTGCTGGTGTCTTGATCTTGG - Intronic
940722097 2:157293249-157293271 ATCTGCTAGTGCCTTGATCTTGG - Intronic
940848918 2:158670259-158670281 ATCTGTTGGTGCCCTGATCTTGG - Intronic
941055953 2:160788279-160788301 ATCTGCGGGTGCCTTGATCTTGG + Intergenic
941097943 2:161262211-161262233 ATCTGTTGGAGCCTTGATCTTGG - Intergenic
941197214 2:162467826-162467848 ATCTGCTGTTGCCTTGATCTTGG - Intronic
941246886 2:163109567-163109589 ATCTGTTGGTGCCTTGATCCTGG - Intergenic
941531729 2:166678797-166678819 ATCTGTTGGTGCCTTGATCTTGG + Intergenic
941709430 2:168696611-168696633 ATCTGCTGGTGCCTTGATCTGGG - Intronic
942225006 2:173807413-173807435 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
942426889 2:175869478-175869500 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
942471617 2:176266767-176266789 ATCTGCTGGTGCCTTGATCATGG + Intergenic
942814961 2:180042153-180042175 AAATGATGGTGCCTTGATCTTGG + Intergenic
942955985 2:181773899-181773921 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
943083547 2:183284643-183284665 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
943505422 2:188750388-188750410 ATCTGCTGGGGCCTTGATCTTGG + Intronic
943719474 2:191188843-191188865 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
943781523 2:191829372-191829394 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
943828523 2:192427919-192427941 ATCCGTTGGTGCCTTGATCTTGG - Intergenic
943834029 2:192496154-192496176 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
944009719 2:194959108-194959130 AACTGATGATGCCTTAATATTGG + Intergenic
945048060 2:205799190-205799212 ATCTGTTGGTGCCTTGATCTTGG - Intergenic
945195494 2:207233599-207233621 ATCTGTTGGTGCTTTGATCTTGG + Intergenic
945524748 2:210874389-210874411 ATCTGATGGTACCTTGATCTTGG - Intergenic
946128153 2:217582460-217582482 ATCTTCTGGTGCCTTGATCTTGG + Intronic
946173034 2:217906530-217906552 TTCTGAGGGGGCCTTGATATGGG - Intronic
946356758 2:219190977-219190999 AGCTGCTGGTGCCTTGATCTTGG + Intergenic
946628467 2:221640964-221640986 ATCAGACAGTGCCTTGATCTAGG - Intergenic
946630943 2:221668449-221668471 ATCATCTGGTGCCTTGATTTTGG - Intergenic
946638803 2:221760637-221760659 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
947288628 2:228546497-228546519 ATCTGCTGGTGCTTTGATGTTGG - Intergenic
947673589 2:231958583-231958605 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
947988335 2:234467397-234467419 ATCTGCTGGTGCCTTGATCCTGG + Intergenic
948146723 2:235713803-235713825 ATCTGCAGGTGCCTTGATCTTGG - Intronic
948180719 2:235977932-235977954 ATCAGCTGGTGCCGTGATCTTGG - Intronic
948875812 2:240827273-240827295 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1168842551 20:918871-918893 ATCGGCTGGTGCCTTGATCTTGG + Intergenic
1169312044 20:4551345-4551367 ATCCTATGGTGCATTGATCTAGG + Intergenic
1169785760 20:9357741-9357763 ATCTGTTGGCGCCTTGATCTTGG + Intronic
1169830845 20:9823241-9823263 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1170040387 20:12034012-12034034 CTCTGCTGGTGCCTTGATCTTGG + Intergenic
1170561972 20:17566545-17566567 ATCTGCTGGTGACTTGATCTTGG - Intronic
1170722772 20:18898387-18898409 CTCTGCTGGTGCCTTGATCTTGG + Intergenic
1171054607 20:21894143-21894165 ATCTGCTGGCGCCTTGATCTTGG + Intergenic
1171166950 20:22980417-22980439 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1171381778 20:24738831-24738853 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
1171436409 20:25128255-25128277 ATCTGCTGGTGCCTGGATCTTGG - Intergenic
1173010680 20:39178955-39178977 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1173395292 20:42673558-42673580 ATCTGCTGGCACCTTGATATTGG - Intronic
1173433013 20:43008353-43008375 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1173536745 20:43820556-43820578 ATCTGCTGGTGCCTTCATCTTGG + Intergenic
1173574598 20:44104016-44104038 ATCTGTTGGTGCCTTGATCTTGG + Intergenic
1173707494 20:45123477-45123499 ATCTGCTGGTGCCTTGATCTTGG - Exonic
1173758369 20:45538269-45538291 ATCCGATGGTGAGTTGTTATGGG - Intronic
1174144537 20:48442203-48442225 ATCTGATACTGCCTTGATCTTGG - Intergenic
1174821656 20:53731614-53731636 GTCTGCTGGTGCCTTGATCTTGG + Intergenic
1174866287 20:54139335-54139357 ATTTGTTGGTGCCTTGATCTTGG - Intergenic
1175608822 20:60333351-60333373 ATCTGCCGGTGCCTTGATCTTGG - Intergenic
1176006886 20:62870192-62870214 ATATGCTGGTGCCTTGATCTGGG - Intergenic
1177007147 21:15687433-15687455 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1177201060 21:17956614-17956636 ATATGCTGGTGCCTTGATCTTGG - Intronic
1177203612 21:17985871-17985893 ATCTGCTGGTACCTTGATCTTGG - Intronic
1177220461 21:18185754-18185776 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1177530263 21:22349754-22349776 ATCTGCTGGTGCCTTCATCTTGG + Intergenic
1177640850 21:23843210-23843232 ATCCGCTAGTGCCTTGATCTTGG - Intergenic
1177804617 21:25862239-25862261 ATTTGCTGGTGCCTTGATCTTGG - Intergenic
1178237543 21:30859789-30859811 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1178252396 21:31016783-31016805 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1178306503 21:31495296-31495318 ATCTGCCGGTGCCTTGATCTTGG - Intronic
1178374068 21:32051879-32051901 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1178435361 21:32553400-32553422 ATCTGCTGCTGCCTTGATCTTGG + Intergenic
1178519943 21:33281012-33281034 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1179149829 21:38800268-38800290 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1179350043 21:40600283-40600305 ATCTGCTGGTGCCCTGATCTTGG - Intronic
1179482461 21:41686850-41686872 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
1180616153 22:17129149-17129171 ATCTGCTGATGCCTTGATCTTGG + Intronic
1180947888 22:19706816-19706838 ATCTGCTGGTGCCTCGATCTTGG + Intergenic
1182693817 22:32182825-32182847 ATCTGCTGGTGCCTTGCTCTTGG - Intergenic
1182782085 22:32876133-32876155 ATGTGATGGTGCCTCGATATTGG - Intronic
1182831777 22:33310081-33310103 CTCGGGTGGTGCCTGGAAATAGG - Intronic
1182908684 22:33960966-33960988 TTCTGCTGGTGCCTTGATCTTGG + Intergenic
1183017792 22:35004172-35004194 ATCTGCTGGTGCCTAGATCTTGG - Intergenic
1184722795 22:46325080-46325102 ATCTGCAGGTGCCTTGATCTTGG - Intronic
949373024 3:3355423-3355445 ATCTGCTGGTACCTTGATCTTGG + Intergenic
949843712 3:8349748-8349770 ATCTGATAGTGCCTTGATCTTGG + Intergenic
950220695 3:11193487-11193509 ATCTGCTGGTGCCTTGATCTTGG - Intronic
950500824 3:13362446-13362468 ATCTGCTGGTGCCTTGACCTTGG + Intronic
950832469 3:15888276-15888298 ATCACCTGGTGCCTTGATCTTGG + Intergenic
950842420 3:15980184-15980206 ATCTGCTGGTGCCTTGATATTGG - Intergenic
951103919 3:18720934-18720956 ATCTGCTTGTGCCTTGATCTTGG - Intergenic
951681099 3:25295432-25295454 ATCTGCTGGTACCTTGATCTTGG + Intronic
951706605 3:25550389-25550411 ATCTCCTGGTGCCTTGATCTTGG - Intronic
952314261 3:32218795-32218817 AACGGATGGTACCCTCATATTGG - Intergenic
952509832 3:34041906-34041928 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
952766765 3:36961078-36961100 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
952775112 3:37038334-37038356 ATCTGTCGGTGCCTTGATCTTGG - Intronic
953367894 3:42362498-42362520 ATCAGCTAGTGCCTTGATCTTGG - Intergenic
953408405 3:42672258-42672280 ATCTCCTGGTGCCTTGATCTTGG + Intergenic
954898251 3:53995984-53996006 ATCTGCTGGTACCTTGATCTTGG + Intergenic
955123165 3:56082382-56082404 ATCTGCTGATGCCTTGATCTTGG + Intronic
955165117 3:56503406-56503428 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
955466610 3:59243494-59243516 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
955732222 3:61998936-61998958 ATCTGCTGGTGCCTTAATCTTGG - Intronic
956106973 3:65829527-65829549 ATCTGCTGGTGCCTTGATCTTGG + Intronic
956146137 3:66192442-66192464 ATCTGCTGGTGCATTGATTTTGG + Intronic
956352630 3:68354698-68354720 ATCTCTTGGTGCCTTGATCTTGG - Intronic
956914636 3:73858510-73858532 ATCTGCTGATGCCTTGATCTAGG - Intergenic
956980975 3:74636934-74636956 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
957732774 3:84162704-84162726 ATCTGCTGGTGCTTTGATCTGGG + Intergenic
958470563 3:94512613-94512635 ATCTGATGGTGCCTCAATTTTGG + Intergenic
958484761 3:94690714-94690736 ATCTACTAGTGCCTTGATATTGG - Intergenic
958576947 3:95962509-95962531 ATCTTTTGGTGCTTTGATATTGG - Intergenic
958671515 3:97211483-97211505 ATCTTCTGGTGCCTTGATCTTGG - Intronic
959018071 3:101158484-101158506 ATCTGCTGGCACCTTGATATTGG + Intergenic
959407261 3:105975606-105975628 ATCTGTTGGTGCCTTGATCTTGG + Intergenic
959420653 3:106124263-106124285 AATGAATGGTGCCTTGATCTTGG + Intergenic
959470370 3:106742674-106742696 ATCTGATGGGGCCTTGATCTTGG - Intergenic
959512221 3:107226519-107226541 ACCCGCTGGTGCCTTGATCTTGG + Intergenic
959726953 3:109554448-109554470 ATCTTCTGGTGCCTTGATCTTGG - Intergenic
959752958 3:109859768-109859790 ATCTGTTGGAGCCTTGATCTTGG + Intergenic
960004316 3:112766504-112766526 ATCTACTGGTGCCTTGATCTTGG + Intronic
960121587 3:113952735-113952757 ATCTGCTGCTGCCTTGATCTTGG - Intronic
960143429 3:114173201-114173223 ATCTTCTGGTGCCTTGATCTTGG + Intronic
960977866 3:123193984-123194006 ACCTGCTGGTGCCTTGATCTTGG - Intronic
961061521 3:123832764-123832786 ATCTGCTGGTGTCTTGATCTTGG + Intronic
961067392 3:123887555-123887577 ATCTGTTGGAGCCTTGATCTTGG - Intergenic
961683735 3:128616057-128616079 ATCTGCCGGTGCCTTGATCTTGG + Intergenic
961702166 3:128753613-128753635 ATCTGCTGGAGCCTTGATTTTGG - Intronic
962252592 3:133845464-133845486 ATCTGCTGGAGCCTTGATCTTGG + Intronic
962373724 3:134842233-134842255 ATCTGCTGGTGCCTTGATCTTGG + Intronic
962685461 3:137843288-137843310 ATCTGCTGGTACCTTGATCTTGG + Intergenic
962687402 3:137860748-137860770 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
963173731 3:142277458-142277480 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
963367061 3:144349177-144349199 GTTGGATGGTGCCTTAAAATGGG + Intergenic
963534495 3:146511186-146511208 ATCTGTTGGTGACTTGATCTTGG + Intergenic
963850906 3:150209484-150209506 ATCTGCTGGTACCTTGATCTTGG + Intergenic
964265506 3:154890311-154890333 ATCTGGAGGTGCCTTGATCTTGG + Intergenic
964525746 3:157613967-157613989 ACCTGATGGTGCCTTGATCTTGG - Intronic
964838458 3:160967409-160967431 ATCTGCTGGTGCCTTGACCTTGG - Intronic
964843924 3:161025670-161025692 AGAGGCTGGTGCCTTGATCTTGG + Intronic
965391663 3:168111739-168111761 ATCTGTTGGTGCCTTGGTTTTGG - Intergenic
965523821 3:169696125-169696147 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
965756426 3:172032352-172032374 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
965759882 3:172064262-172064284 ATTTGTTGGTGCCTTGATTTTGG + Intronic
965768690 3:172158079-172158101 ATCTGCTGGTGCCTTGATCTTGG + Intronic
966239716 3:177743041-177743063 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
966493538 3:180555114-180555136 ATCTGCTGGTGTCTTGATCTTGG - Intergenic
966583337 3:181593195-181593217 CTCTGCTGGTGCCTTGATCTTGG - Intergenic
966632948 3:182098671-182098693 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
966792815 3:183689442-183689464 ATCTGCTGGTGCCTTGATATTGG - Intergenic
967042399 3:185705685-185705707 ATCTGCTGGTGCCTTGATCTTGG - Intronic
967168869 3:186808262-186808284 ATCTTATGGTGCCTTGATCTTGG - Intergenic
967414466 3:189201096-189201118 ATGTGCTGGTGCCTTGATCTTGG + Intronic
967863576 3:194172135-194172157 ATCTGATGGTGCCTTGATCTTGG - Intergenic
968258685 3:197300936-197300958 ATCTGATGGTGTTTTGATCTTGG - Intergenic
969256728 4:6007477-6007499 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
969593593 4:8135595-8135617 ATCTGCTGGTGCCTTCATCTGGG + Intronic
969965246 4:10987249-10987271 ATCTGCTGGTGCCTTGATCTCGG + Intergenic
969970344 4:11040515-11040537 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
970478102 4:16444857-16444879 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
970583188 4:17491965-17491987 ATCTGCTGGTGCCTTCATCTTGG + Intronic
970599565 4:17630491-17630513 ATCTGCTGGTGCCTTGATCTTGG + Exonic
970805254 4:20023572-20023594 ACCTGCTGGTGCCTTGATTTTGG - Intergenic
970836591 4:20416240-20416262 ATCTGCTGGTGCCTTGAACTTGG - Intronic
970970445 4:21977183-21977205 GTCTGCTGGTACCTTGATATTGG - Intergenic
971361949 4:25946329-25946351 ATCTGCTGGTGCTTTGATTTTGG - Intergenic
971459693 4:26881567-26881589 ATCTGCTGGTGCCTTTATCTTGG + Intronic
971763906 4:30804664-30804686 ATCTGCTGGTGCCTTGCTCTTGG + Intronic
971938521 4:33185953-33185975 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
972009145 4:34153544-34153566 ATCTGCTGGTGCCTTGAGCTTGG - Intergenic
972181627 4:36474056-36474078 ATCTGCTGGTGCCGTGATCTTGG - Intergenic
972339960 4:38143581-38143603 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
972379645 4:38507551-38507573 ATCTGCTGGTGTCTTGATCTTGG - Intergenic
972973397 4:44604779-44604801 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
973199936 4:47488950-47488972 ATCTGCTGGCGCCTTGATTTTGG + Intronic
973602812 4:52558711-52558733 ATCTGCTGATGCCTTGATCTTGG - Intergenic
973604381 4:52571971-52571993 ATCTGCTGGTGTCTTGATCTTGG - Intergenic
973854752 4:55000115-55000137 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
973909063 4:55560905-55560927 ATCTGCTGGCGCCTTGATCTGGG + Intronic
973926835 4:55747526-55747548 ATCAGCTGGTGCCTTGCTCTTGG + Intergenic
973971046 4:56214137-56214159 ATCTGACAGTGCCTTGATCTTGG - Intronic
974015736 4:56647365-56647387 GTCTGCTGGTGCCTTGATCTTGG - Intergenic
974308829 4:60176638-60176660 ATCTGCGGGTGCCTTGATCTGGG + Intergenic
974331453 4:60484066-60484088 ATCTGCTTGTGCCTTGATTTTGG + Intergenic
974750517 4:66134586-66134608 ATCTGCTGGTGCCTTTATCTTGG - Intergenic
974837266 4:67266096-67266118 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
975200548 4:71583112-71583134 ATCTGCTGGTGCCTTGATCCTGG + Intergenic
975974900 4:80083936-80083958 ATCTGTTGGTACCTTGATCTTGG - Intronic
976376287 4:84349425-84349447 ATCTGCTGGTACCTTGATCTTGG - Intergenic
976517361 4:85984347-85984369 ATCTGCTGGTGCCTTGATCTTGG - Intronic
976635270 4:87281096-87281118 ATCTGCTGGTGCCTTGATCTCGG + Intergenic
976738903 4:88338855-88338877 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
976746659 4:88409961-88409983 ACCTGATGGTGCCTTGGTCTTGG - Intronic
977127350 4:93186926-93186948 ATCTGTTGGTGCCTTGACTTTGG - Intronic
977570027 4:98619784-98619806 ATCTGCTGGAGCCTTGATTTTGG - Intronic
977605661 4:98982856-98982878 ATCTGCGGGTGCCTTGATTTTGG - Intergenic
977682371 4:99810750-99810772 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
977976315 4:103270838-103270860 ATATGCTGGTGCCTTGATCTTGG - Intergenic
977983730 4:103357984-103358006 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
978531327 4:109717108-109717130 ATCTGCTAGTGCCTTGATCTTGG + Intronic
979348112 4:119612735-119612757 ATCTGCTGGTGCCTTGATCTTGG + Intronic
979400979 4:120249006-120249028 ATTGGCTGGTGCCTTGATCTGGG + Intergenic
979543938 4:121918219-121918241 ACCTGCTGGTGCCTTGATCTTGG + Intronic
979618152 4:122768099-122768121 ATCTGTTGGTACCTTGATCTTGG - Intergenic
979748367 4:124244881-124244903 ATCTCCTGGTGCCTTGATCTTGG + Intergenic
979925575 4:126558878-126558900 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
980196748 4:129599388-129599410 AGGTGATGGTGCCTTGATCTTGG - Intergenic
980206722 4:129729205-129729227 ACCTGCTAGTGCCTTGATATTGG + Intergenic
980742933 4:136975150-136975172 ATCTGATGGCGACTTGATCTTGG - Intergenic
981050769 4:140307144-140307166 ATCTGCTGGTGTCTTGATCTTGG + Intronic
981102670 4:140847375-140847397 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
981260430 4:142712161-142712183 ATCTGCTGGTGCCTTGATCTTGG + Intronic
981578149 4:146226470-146226492 TTCTGATGGTGCCTTCATCTTGG - Intronic
981661488 4:147172377-147172399 ATCTGCTGGTGCCTTGATGTTGG - Intergenic
982099620 4:151955167-151955189 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
982527476 4:156497653-156497675 ACCAGATGGCGCCTTGATCTTGG - Intergenic
982554612 4:156843286-156843308 ATCTGCTGGTGCCTTGATCTTGG + Intronic
984399507 4:179243832-179243854 ATCTGCTGATGCCTTGATTTTGG - Intergenic
984600356 4:181719450-181719472 ATCGGCTGGTGTTTTGATCTCGG - Intergenic
984694616 4:182767033-182767055 ATCAGGTGGTGCCATGATGTGGG + Intronic
985010669 4:185579319-185579341 ATCTGCTCGTGCCTTGATCTTGG + Intergenic
985168000 4:187117876-187117898 ATCTGCTGGTGCTTTGATCTTGG - Intergenic
986020800 5:3800378-3800400 ATCTGATGATGCCTTGATCTTGG - Intergenic
986406080 5:7426374-7426396 ATCTGCCGGTGCCTTGATCTTGG - Intronic
986543195 5:8868986-8869008 ATCTGCTGGAGCCTTGATCTTGG - Intergenic
986674540 5:10171469-10171491 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
986833394 5:11607183-11607205 ATCTGATGGCACCTTGATCTTGG + Intronic
987255432 5:16145454-16145476 ACCTGACGGTGCCTTGATATTGG + Intronic
987506139 5:18775620-18775642 ATCTGCTGGTGCCTTAATCTTGG - Intergenic
987690464 5:21259883-21259905 ATCTGCTGGTGCCTTGATATTGG - Intergenic
987703023 5:21426325-21426347 CTCTGATGGCGCCTTGATCTTGG - Intergenic
987965541 5:24867559-24867581 ATCCACTGGTGCCTTGATCTTGG - Intergenic
988151087 5:27381370-27381392 ATCCACTGGTGCCTTGATCTTGG + Intergenic
988393498 5:30666480-30666502 ATCTGCTGTTACCTTGATATTGG - Intergenic
988442963 5:31253058-31253080 ATTTGCTGGTGCCTTGATCTTGG - Intronic
988521656 5:31950946-31950968 ATCTGCCGGTGCCTTGATCTTGG - Intronic
988566345 5:32322525-32322547 ATCTGCTGGCGCCTTGATCTTGG + Intergenic
988739834 5:34059466-34059488 ATCTGATGGTGCCTTGATCTTGG - Intronic
988786463 5:34569941-34569963 CTCTGATGGTGCCTTGATCTTGG - Intergenic
989476071 5:41874467-41874489 ATATGCTGGTGCCTTGATCTTGG - Intergenic
989476419 5:41879180-41879202 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
989506868 5:42236377-42236399 AACTGCTGGTGCCTTGATCTTGG - Intergenic
989744938 5:44817786-44817808 ATCTGCTGGTGCCTTGATCTTGG + Intronic
989777788 5:45230180-45230202 ATCTGCTGATGCCTTGATCTTGG + Intergenic
990160073 5:52928041-52928063 ATCTGTTGGTGCCTTGATCTTGG + Intronic
990230379 5:53706495-53706517 ATCAGTTGGCACCTTGATATTGG + Intergenic
990465463 5:56067301-56067323 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
990949637 5:61286025-61286047 CTCTGCTGGTGCCTTGATCTTGG - Intergenic
990962703 5:61411654-61411676 ATCTGATGGCACCTTGATCTTGG - Intronic
992070546 5:73144680-73144702 ATCTGCCGGTGCCTTGATCTGGG + Intergenic
992154659 5:73943130-73943152 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
992159497 5:73986939-73986961 ATCTGCTGATGCCTTGATCTTGG - Intergenic
992261215 5:74972154-74972176 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
992458101 5:76934745-76934767 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
992849784 5:80795397-80795419 ATCTGCTGGTACCTTGATCTTGG - Intronic
993107259 5:83613269-83613291 ATCTGCTGGTGCCTTGATTTTGG + Intergenic
993168718 5:84387985-84388007 ATCTGCTGGTGCATTGATCTTGG + Intergenic
993276486 5:85866227-85866249 ATCCGATGGTGTTTTGATTTAGG + Intergenic
993815441 5:92538995-92539017 ACTGGATGGTACCTTGATCTTGG + Intergenic
993958071 5:94261826-94261848 ATGGGATGGTGGCTTGAATTAGG - Intronic
994163282 5:96581009-96581031 ATCTGCTGGTGCCTTGGTCTTGG + Intronic
994714460 5:103305155-103305177 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
994729972 5:103480552-103480574 ATCTGACAGTGCCTTGATCTTGG + Intergenic
995205898 5:109481068-109481090 ATTGACTGGTGCCTTGATCTGGG + Intergenic
995367401 5:111378249-111378271 ATCTTCTGGTGCCTTGATCTTGG + Intronic
995739357 5:115338770-115338792 GTCTGCTGGTGCCTTGATCTTGG - Intergenic
996049028 5:118910805-118910827 ATCTGCTGGTGCCTTGATCTTGG - Intronic
996073599 5:119162421-119162443 ATCTGCTGGTGTCTTGATCTTGG - Intronic
996331261 5:122331608-122331630 ATCTGCTGGTGCCTTGATCTTGG - Intronic
996480723 5:123972523-123972545 ATCTGCTGTTGCCTTGATCTTGG - Intergenic
996832930 5:127759503-127759525 ATCTGTTGGTGCCTTGATCTTGG + Intergenic
996861249 5:128068576-128068598 ATCTGATGTTGCTTTAATATAGG + Intergenic
997023118 5:130025616-130025638 ATCTACTGGTGCCTTGATCTGGG - Intronic
997909401 5:137855039-137855061 ATCTGCTGGTGCCTTGGTCTTGG + Intergenic
998380738 5:141723505-141723527 GTCTGTTGGTGCCTTGATCTTGG - Intergenic
998485930 5:142502158-142502180 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
998537071 5:142943373-142943395 ATTTGATGGTGCCTTGATCTTGG - Intronic
999490209 5:152042814-152042836 ATCTGCTGATGCCTTGATTTTGG - Intergenic
999589958 5:153134008-153134030 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
999816147 5:155178319-155178341 ATCTGCTGGTGCTTTGATCTAGG + Intergenic
999957776 5:156720907-156720929 ATAGGATGGTGCCTTGGACTAGG + Intronic
1000308474 5:160018228-160018250 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1000729409 5:164813534-164813556 GTCTGATGGTGCCATGATCTTGG + Intergenic
1000738818 5:164939184-164939206 ATCTGCTGGTGCCTTGAACTTGG - Intergenic
1000783484 5:165513742-165513764 ATCTGTTGGTGCCTTGATCTTGG - Intergenic
1001003425 5:168029067-168029089 ATCTGCAGGTGCCTTGATCTTGG - Intronic
1001021754 5:168188994-168189016 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1001446862 5:171792072-171792094 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1001553204 5:172619142-172619164 ATCTGCTGGCGCCTTGATCTTGG - Intergenic
1001966462 5:175913368-175913390 ATCTGCTGGTGCCCTGATCTTGG - Intergenic
1002250486 5:177925836-177925858 ATCTGCTGGTGCCCTGATCTTGG + Intergenic
1002558344 5:180061936-180061958 ATCTGCTGGTGCCTTGAACTTGG - Intronic
1002592151 5:180298256-180298278 ATCTGCCGGTGCCTTGATCTTGG + Intergenic
1002601954 5:180358859-180358881 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1002610013 5:180411197-180411219 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1003193061 6:3890993-3891015 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1003389856 6:5704185-5704207 ATCTGCTGGTGCCTTGACCTTGG - Intronic
1003622129 6:7709743-7709765 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1004289281 6:14351666-14351688 ATATGCTGGTGCCTTGATTTTGG - Intergenic
1004371803 6:15059270-15059292 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1005248010 6:23910685-23910707 ATTGGCTGGTGCCTCGATCTTGG + Intergenic
1005442659 6:25887364-25887386 ATCTCCTGGTGCCTTGATCTTGG - Intergenic
1005518264 6:26575007-26575029 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1006810217 6:36815543-36815565 ATTTGCTGGTGCCTTGATATTGG + Intronic
1007036068 6:38674894-38674916 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1007076114 6:39067381-39067403 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1008141836 6:47840647-47840669 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1008224139 6:48891695-48891717 ATCTGCTGGTGCCTTAATCTTGG - Intergenic
1008523935 6:52388657-52388679 ATCTGCTGGTGCCTTCATCTTGG + Intronic
1008654513 6:53597938-53597960 ATCTGCTGGCGCCTTGATCTTGG - Intronic
1009336916 6:62502404-62502426 ATCTGCTGGAGCCTTGATTTTGG + Intergenic
1009556035 6:65168421-65168443 GTCTGCTGGTGCCTTGATCTTGG - Intronic
1009623136 6:66101264-66101286 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1010225415 6:73484340-73484362 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1010784770 6:79987394-79987416 ACCTGTTGGTGCCTTGATTTTGG + Intergenic
1010819186 6:80393526-80393548 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
1011106582 6:83788020-83788042 ACCTGTTGGTGCCTTGATCTTGG + Intergenic
1011255839 6:85420005-85420027 ATCTTCTGGTGCCTTGATCTTGG - Intergenic
1011384606 6:86781756-86781778 ATCTGCTGGTGCCTTAATCTTGG - Intergenic
1011489319 6:87874374-87874396 TTCCAATGGTGCCTTGGTATTGG + Intergenic
1011805469 6:91067936-91067958 ATCTGCTGGCGCCTTGATAGTGG + Intergenic
1011889900 6:92145075-92145097 ATCTGTGGGTGCCTTGATCTAGG + Intergenic
1012282515 6:97345531-97345553 ATCTGCTGGTGCCTTGACTTTGG - Intergenic
1013497275 6:110710579-110710601 ATCTCCTGGTGCCTTGATCTTGG - Intronic
1013594126 6:111645650-111645672 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1013805227 6:113989343-113989365 ATCTGCTGGTGCCTTCATTTTGG - Intronic
1013991323 6:116257586-116257608 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1014220548 6:118794786-118794808 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
1014568828 6:122984504-122984526 ATCTGCTGGTGGCTTGATCTTGG - Intergenic
1014577411 6:123090696-123090718 ATATGCTGGTGCCTTGATTTTGG - Intergenic
1014666973 6:124250197-124250219 ATCTGCTGGTGCCTTGATCAGGG + Intronic
1015004777 6:128266025-128266047 GTCTGTTGGTGCCTTGATTTTGG + Intronic
1015358094 6:132304293-132304315 AACTGCTGGTGCCTTGATTTTGG + Intronic
1015470290 6:133597636-133597658 ACCTGCTGGTGCCTTGATCTGGG + Intergenic
1015500525 6:133927976-133927998 ATCTGCTGGAGCCTTGATCTTGG + Intergenic
1015758010 6:136627721-136627743 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1016019440 6:139220226-139220248 ATCTGCTGGTACCTTGATACTGG + Intergenic
1016059289 6:139612089-139612111 ATCTGTTGGTTCCTTGATCTTGG + Intergenic
1016265389 6:142227321-142227343 ATCTGCTGGTGCCTTGATTTTGG - Intergenic
1016294665 6:142562208-142562230 ATCTGCTGGGGCCTTGATCTTGG - Intergenic
1016536348 6:145111006-145111028 ATCTGCTGGTGCCTTGATTTTGG - Intergenic
1016536604 6:145113430-145113452 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1016562168 6:145408779-145408801 ATATGCTGGTGCCTTGATCTTGG - Intergenic
1016641652 6:146356327-146356349 ATCTGTTGGTGCCTTGTTCTTGG - Intronic
1016926602 6:149356481-149356503 GTCTGCTGGTGCCTTGATCTTGG - Intronic
1017155031 6:151315268-151315290 TTCTGTTGGTGCCTTGATCTGGG - Intronic
1017192362 6:151668146-151668168 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1017368352 6:153672331-153672353 ATCTGTTGCTGCCTTGATCTGGG - Intergenic
1017429610 6:154358207-154358229 ATCTGCTGGCGCCTTGATCTTGG + Intronic
1017606738 6:156142737-156142759 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1017792892 6:157817093-157817115 ATCTGCTGGTGCCTTGATGTTGG + Intronic
1018484083 6:164222616-164222638 ATCTGTTGGTGCCTTGATTTTGG + Intergenic
1018491004 6:164293378-164293400 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1018537366 6:164835785-164835807 ATCTGCTGGTGCCTTGATGTTGG - Intergenic
1018753234 6:166825612-166825634 ATCTGCTGGTGCCTTGACCTTGG - Intronic
1020356539 7:7281999-7282021 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1020412727 7:7911287-7911309 ATCTGCTGGTGCCTTGATGTTGG - Intronic
1020565743 7:9793467-9793489 ACCTGCTGGTGCCTTGATCTGGG - Intergenic
1020614337 7:10440048-10440070 ATCGGTTGGCACCTTGATGTTGG - Intergenic
1021022650 7:15622987-15623009 ATCTGCTGATGCCTTGATCTTGG + Intronic
1021866280 7:24961630-24961652 ATCTGCTGGTGCCTTGATATTGG + Intronic
1022147269 7:27557545-27557567 ACCTGTTGGTGCCTTGATCTTGG - Intronic
1022158419 7:27683320-27683342 ATCTCTTGGTGCCTTGATCTTGG - Intergenic
1022198812 7:28095831-28095853 TCCTGATGGTGCCTTGATCTGGG - Intronic
1022386819 7:29907715-29907737 ATCTGTTGGTGCCTTGATCTTGG + Intronic
1022934999 7:35165784-35165806 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1023062477 7:36341839-36341861 ATTTGATGGTGCCTTGATTTTGG + Intronic
1023122212 7:36921123-36921145 ATTTGCTGGTGCCTTGATTTTGG + Intronic
1023165405 7:37338443-37338465 ATCCACTGGTGCCTTGATCTTGG + Intronic
1023368847 7:39491789-39491811 ATTTGCTGGTGCCTTGATCTTGG + Intronic
1023416090 7:39934182-39934204 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
1023508419 7:40924106-40924128 ATCTGGTGGTGCCTTGAATTTGG + Intergenic
1023539579 7:41251153-41251175 ATCTGCTTGTGCCTTGATCTTGG - Intergenic
1023895980 7:44433144-44433166 ATCTTCTGGTGCCTTGATCTTGG + Intronic
1024267581 7:47618688-47618710 ATCTGCTGGTGGCTTGATCTTGG + Intergenic
1026104603 7:67410847-67410869 ATCTGCTGGTGTCTTGATCTTGG + Intergenic
1026244448 7:68606293-68606315 ATCTGCTGGTGACTTGATCTTGG + Intergenic
1026253812 7:68693536-68693558 AACTGCTGGTGCCTTGATCTTGG - Intergenic
1026614475 7:71889207-71889229 ATCTGCTGATGCCTTGATCTTGG - Intronic
1027367019 7:77469037-77469059 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1027371706 7:77512948-77512970 ATCTGCTTGTGCCTTGATCTTGG + Intergenic
1027377970 7:77573328-77573350 ATCTGCTGGTGCCTTCATCTTGG - Intronic
1027834824 7:83227480-83227502 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1027844927 7:83360916-83360938 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1028175727 7:87656024-87656046 ATCTGATGGTGCTTTGATCTTGG + Intronic
1028629077 7:92913917-92913939 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1028721279 7:94034819-94034841 ATCAGCTGGTGCCTTGATCTTGG + Intergenic
1029542383 7:101191641-101191663 TTCGGCTGGTGCTTTGATCTCGG + Intergenic
1029830949 7:103258549-103258571 ATCTGCTGGCGCCTTGATCTTGG + Intergenic
1029970823 7:104787449-104787471 ATCTGTTGGTGCCTTAATCTTGG - Intronic
1030099894 7:105936501-105936523 ATCTGCTGGTGCCTTAATCTTGG + Intronic
1030190937 7:106809419-106809441 ATCTGCTGGTGCCCTGATCTTGG - Intergenic
1030203438 7:106928990-106929012 ATCTGCTGGTGCCTTGTTCTTGG - Intergenic
1030225825 7:107149419-107149441 ATCTTCTGGTGCCTTGATCTTGG - Intronic
1030533808 7:110741572-110741594 ATCTGTTGGTGCCATGATCTTGG + Intronic
1030693501 7:112559237-112559259 ATCTGCTGGTGCTTTGATCTTGG - Intergenic
1030866192 7:114704330-114704352 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1031016158 7:116578864-116578886 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1031308427 7:120163473-120163495 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1031313020 7:120222933-120222955 ATCGTATTCTGCATTGATATGGG + Intergenic
1031718328 7:125135955-125135977 ATCTGCTGGTGCTTTGATCTTGG + Intergenic
1032146937 7:129392342-129392364 ATCTGCTGGCGCCTTGATCTTGG - Intronic
1032892424 7:136212835-136212857 ATCTGCAGGTGCCTTGATCTTGG - Intergenic
1032961790 7:137044005-137044027 ATCTGATGGTGCCTGGATCTTGG - Intergenic
1033266220 7:139889615-139889637 ATCTGTTGGTTCCTTGATCTTGG - Intronic
1033486981 7:141800188-141800210 ATCTGCTGGTGCCTCGATCTTGG + Intergenic
1034031794 7:147774710-147774732 ATTGGATGGCACCTTGATGTTGG + Intronic
1035491502 7:159283380-159283402 ATCTGTTGGTGCCTTGATGTTGG + Intergenic
1035937903 8:3862978-3863000 ATCTGTTGGTACCTTGATATTGG - Intronic
1036058762 8:5290826-5290848 ATCTGCTGGTGTCTTGATCTTGG - Intergenic
1036079209 8:5535130-5535152 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
1036145463 8:6250851-6250873 ATCTGCTGGCACCTTGATATTGG + Intergenic
1036443536 8:8802530-8802552 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1036591241 8:10170441-10170463 ATCTGCTGGTGCCTTGGTTTTGG + Intronic
1037002043 8:13731817-13731839 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1037651862 8:20846302-20846324 ATCAACTGGTGCCTTGATATTGG - Intergenic
1037692538 8:21194387-21194409 CTCTAATGATGCCTTGATATTGG - Intergenic
1038156571 8:24996984-24997006 ATGGGAACGTGCCTTGAAATAGG - Intergenic
1038159712 8:25025031-25025053 ATCTGTTGATGCCTTGATCTTGG - Intergenic
1038286852 8:26212882-26212904 ATCTGCTGGAGCCTTGATTTGGG + Intergenic
1038394315 8:27235851-27235873 ATCTGCTGGCACCTTGATATTGG + Exonic
1038431413 8:27503194-27503216 ATCTGCTGGAGCCTTGATCTTGG + Intronic
1038684553 8:29704454-29704476 ATCTGCTAGTGCCTTGATCTTGG - Intergenic
1038738747 8:30197826-30197848 ATCTGCTGGTGCCTCGATCTTGG + Intergenic
1038849033 8:31256100-31256122 ATGTGTTGGTGCCTTGATCTTGG - Intergenic
1038854573 8:31317357-31317379 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1038888126 8:31688408-31688430 ATCTGCTGGTACCTTGATCTTGG + Intronic
1039000904 8:32979414-32979436 ATGGGATGCTCCCTTGATGTAGG + Intergenic
1039029673 8:33295801-33295823 ATCTGCTGGTGCCTGGATCTTGG - Intergenic
1039211553 8:35220780-35220802 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1039745904 8:40426411-40426433 ATCAGCTGGTGCCTTGATATTGG + Intergenic
1040071823 8:43194891-43194913 ATCTACTGGTGCCTTGATCTTGG + Intronic
1040462576 8:47662920-47662942 ACCTGCTGGTGCCTTGATCTGGG + Intronic
1040862081 8:52009011-52009033 ATCTCCTGGTGCCTTGATCTTGG + Intergenic
1040984568 8:53279709-53279731 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1041117379 8:54553337-54553359 ATCTTCTGGTGCCTTGATCTTGG - Intergenic
1041300219 8:56403820-56403842 ATCTGCTGGTGCCTTGTTCTTGG + Intergenic
1041461753 8:58119292-58119314 ATCTGCTGGTGCCTTGAACTTGG - Intronic
1041640883 8:60200204-60200226 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1042045947 8:64651774-64651796 ATCTGGTGCTGCCTTGATCTTGG + Intronic
1042103495 8:65298651-65298673 ATCTGTTGGTGCCTTGATCCTGG + Intergenic
1042114285 8:65414440-65414462 ATCTGCTGGTGTCTTGATCTTGG - Intergenic
1042350195 8:67769215-67769237 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1042357208 8:67841345-67841367 ATGTGCTGGTGCCTTGATCTTGG - Intergenic
1042474675 8:69233714-69233736 ATCTGCTGGGGCCTTGATCTAGG - Intergenic
1042819406 8:72914066-72914088 ATCTGCTGGTGTCTTGATCTTGG - Intronic
1042843242 8:73145959-73145981 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
1042935234 8:74051783-74051805 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
1042990271 8:74631746-74631768 ATCTGCTGGTGCCTTGACCTTGG - Intronic
1043379790 8:79690294-79690316 AGCTGCTGGTGCCTTGATCTTGG - Intergenic
1043585627 8:81766051-81766073 ATCTGCTGGTGCCATGATCTTGG + Intergenic
1043651025 8:82592326-82592348 AAATGATGGTTCCTTGATATTGG - Intergenic
1043867844 8:85395900-85395922 ATCTGCTGGTACCTTGATCTTGG - Intronic
1044443759 8:92249898-92249920 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1044775932 8:95687898-95687920 ATCTGCTGGAGCCTTGATCTTGG - Intergenic
1045260133 8:100565594-100565616 ATCTGCTGATGCCTTGATCTTGG - Intergenic
1045554293 8:103200676-103200698 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1046381892 8:113461474-113461496 ATCTGCAGGTGCCTTGATCTTGG + Intergenic
1046738562 8:117804337-117804359 ATCTGCTGGTGCCTTGATCTGGG + Intronic
1046831657 8:118752756-118752778 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1046902370 8:119536959-119536981 ATCTGCTGGTGCCTTGGTCTCGG + Intergenic
1047141135 8:122141127-122141149 ATCTCATGGTGGCTTGATGTAGG - Intergenic
1047182449 8:122602508-122602530 ATCAGCTGGCACCTTGATATTGG + Intergenic
1047373341 8:124274179-124274201 ATCTACTGGTGCCTTGATCTTGG + Intergenic
1047820692 8:128516864-128516886 ATCTGCTGGTGACTTGATCTTGG + Intergenic
1047879977 8:129182396-129182418 ATCTCCTGGTGCCTTGATTTTGG - Intergenic
1048366100 8:133740055-133740077 GTCTGCTGGTGCCTTGATCTTGG + Intergenic
1048382641 8:133880929-133880951 ATCTGCTGGTGCCTTGATGTTGG + Intergenic
1048602758 8:135935698-135935720 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1048642769 8:136382877-136382899 ATCTGCTTGTGCCTTGATCTTGG + Intergenic
1049111111 8:140644062-140644084 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1050067003 9:1770826-1770848 ATCTGTTGGTGCCCTGATTTTGG - Intergenic
1050103928 9:2146116-2146138 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1050149496 9:2605185-2605207 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1050320371 9:4446367-4446389 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1050615524 9:7398133-7398155 ATCTGCTGGTGCCTTTATCTTGG - Intergenic
1050755401 9:8996605-8996627 ATCTGCTGGTGCCTTGGTCTTGG - Intronic
1050877597 9:10658774-10658796 ATCTGTTAGTGCCTTGATCTTGG + Intergenic
1050971632 9:11883947-11883969 ATCTGCTGGTGCCTTAATCTTGG + Intergenic
1051446622 9:17146619-17146641 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1051512104 9:17889490-17889512 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1051519966 9:17975361-17975383 ATCTGCTGGTGCCCTGATCTTGG - Intergenic
1051740618 9:20248424-20248446 ATCTGTTGGCGCCTTGATTTTGG - Intergenic
1051884265 9:21873575-21873597 ATCTGTTGGTGCCTTGATCTTGG + Intronic
1053033897 9:34808590-34808612 AACTGTTGGTGCCTTGATCTTGG - Intergenic
1053359508 9:37474302-37474324 ATCTGCTGGCGCCTTGATCTTGG + Intergenic
1054919512 9:70527925-70527947 GTCTGCTGGTGCCTTGATCTTGG + Intergenic
1056100291 9:83294265-83294287 ATCTGCTGGTGTCTTGATCTTGG + Intronic
1056255769 9:84798094-84798116 ATCTGCTGGTGCCTTGATATCGG - Intronic
1056335335 9:85563047-85563069 ATCTGCTGATGCCTTGATCTTGG + Intronic
1056693366 9:88826553-88826575 ATCTGCTGGTGCCTTGATCATGG + Intergenic
1056782140 9:89558688-89558710 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1057056296 9:91963772-91963794 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
1058032224 9:100212966-100212988 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1058404860 9:104661366-104661388 ATCTGCTGGTACCTTGATCTTGG - Intergenic
1058735538 9:107890684-107890706 ATCTGCTGATGCCTTGATCTTGG - Intergenic
1058736893 9:107902081-107902103 ATCTGTTGGTGTCTTGATCTTGG - Intergenic
1058849968 9:109002173-109002195 ATCTGTTGGTGCCTTGATCCTGG - Intronic
1059507705 9:114814689-114814711 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1059898818 9:118899278-118899300 ATCTGCTGGTGTCTTGATCTTGG - Intergenic
1060043315 9:120320345-120320367 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1060087905 9:120717993-120718015 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1060316739 9:122518378-122518400 ATCTGCTGGTACCTTGATCTGGG - Intergenic
1060500366 9:124149187-124149209 CTCTGCTGGTGCCTTGATCTTGG - Intergenic
1061223762 9:129267967-129267989 ATCTGCTGGTGCCTTAATCTTGG + Intergenic
1061272700 9:129552482-129552504 ATCTGTTGGTGCCTTGACTTTGG - Intergenic
1062051723 9:134450738-134450760 ATCCGCAGGTGCCTTGATCTTGG - Intergenic
1062705151 9:137934785-137934807 ATGGGGTGGTCCCTTGATGTAGG - Intronic
1185542022 X:910127-910149 ATCTGCTGGTGCCTTCATCTTGG - Intergenic
1186170536 X:6871936-6871958 ATCTGCTGGTGCCTTAATTTTGG - Intergenic
1186302846 X:8219300-8219322 ATCTGGTGGGGCCTTGATCTTGG - Intergenic
1186364427 X:8876087-8876109 ATCTGCTGGGGCCTTGATCTTGG + Intergenic
1186683708 X:11902323-11902345 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1186690120 X:11966411-11966433 ATCTGTTGGTGACTTGATCTTGG + Intergenic
1186987064 X:15028557-15028579 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1187948354 X:24448156-24448178 ATCTGCTGGTGCCTTGACCTTGG - Intergenic
1188049041 X:25461906-25461928 ACCTGTTGGTGCCTTGATCTTGG - Intergenic
1188134079 X:26472494-26472516 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1188228411 X:27630788-27630810 ATCTGCTGGTGCCTTGAGCTTGG - Intronic
1188287152 X:28341568-28341590 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1188351806 X:29140704-29140726 ATCTGATGGTGACTTGATCTTGG - Intronic
1188363163 X:29281897-29281919 ATTGGCTGGTACCTTGATCTTGG - Intronic
1188395970 X:29684232-29684254 ATCTGCTGGCGCCTTGATCTTGG - Intronic
1189106121 X:38237398-38237420 ATCTGCTGGTGCCTTGATCCTGG + Intronic
1189255156 X:39632310-39632332 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1189287674 X:39863424-39863446 ATCTGCTGATGCCTTGATCTTGG - Intergenic
1189302621 X:39963307-39963329 ACTTGATGGTGCCTTGATCTTGG + Intergenic
1189351169 X:40276893-40276915 ATCTGCTGGTGCCTCGATCTTGG + Intergenic
1189366853 X:40395457-40395479 ATCTGACAGTGCCTTGATCTTGG - Intergenic
1189526448 X:41827373-41827395 ATCTGCTGGTACCTTGATCTTGG - Intronic
1189815572 X:44821543-44821565 ATCTGCTGGTACCTTGATTTTGG - Intergenic
1189818139 X:44844789-44844811 ACCGGATGGTGCCTTGTTAAAGG + Exonic
1189963622 X:46349760-46349782 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1190153534 X:47968172-47968194 ATCAGCTGGTGCCTTGATCTTGG + Intronic
1190163948 X:48056096-48056118 ATCTGCTGGCACCTTGATATTGG - Intronic
1190369827 X:49730016-49730038 ATCTGCTGGTGCCTTGACCTTGG + Intergenic
1190993891 X:55585274-55585296 ATCAGCTAGTGCCTTGATTTTGG + Intergenic
1191699245 X:64021691-64021713 ATCCGCTGGTGTCTTGATCTTGG + Intergenic
1191873883 X:65774125-65774147 ATCTGCTGGTGACTTGATGTTGG + Intergenic
1192705075 X:73520712-73520734 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1193052724 X:77118092-77118114 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1194334712 X:92630865-92630887 ATCTGCTGGTGCCTTGTTCTTGG - Intergenic
1194364665 X:92999600-92999622 ATTTGATAGTGCCTTGATCTTGG + Intergenic
1194840166 X:98730536-98730558 ATCTGCTGGTGCTTTGACATTGG - Intergenic
1194846198 X:98812224-98812246 ATCTGCTGGTGCCTTGATCATGG + Intergenic
1195461668 X:105133679-105133701 ATCTGCTGGTGCCTTGACCTTGG - Intronic
1195462773 X:105146073-105146095 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1195498302 X:105564022-105564044 ATCTGTTGGTGCCTTGATCTTGG - Intronic
1195513496 X:105745080-105745102 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1195995407 X:110726448-110726470 ATCTGATGGTACCTTGATCTTGG + Intronic
1196080811 X:111628427-111628449 ATCTGCTGTTGCCTTGATTTTGG + Intergenic
1196323206 X:114368739-114368761 ATCTGCTGGTGCATTGATATTGG - Intergenic
1196327170 X:114420141-114420163 ATCTGTTGGTGCCTTGATCTTGG + Intergenic
1196541332 X:116911928-116911950 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1196580621 X:117374897-117374919 ATCTGCTAGTGCCTTGATCTTGG + Intergenic
1196931279 X:120684269-120684291 ATCTGCTGTTGCCTTGATCTTGG - Intergenic
1196974868 X:121148228-121148250 ACCCTGTGGTGCCTTGATATTGG + Intergenic
1197004782 X:121482334-121482356 ATCTTCTGGTGCCTTGACATCGG - Intergenic
1197506749 X:127314719-127314741 ATGTGCTGGTGCCTGGATATTGG + Intergenic
1198180629 X:134204973-134204995 ATCTGCAGGTGCCTTGATCTTGG - Intergenic
1198195255 X:134353905-134353927 ATCTGCTGGTGCCTCGATCTTGG + Intergenic
1198301292 X:135336259-135336281 ATCTGCTGGTGCCTTGATTTTGG + Intronic
1198317181 X:135479776-135479798 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
1198787369 X:140303606-140303628 ATCTGCTGGTACCTTGATCTTGG + Intergenic
1198792833 X:140364364-140364386 ATCTGCTGATGCCTTGATCTTGG + Intergenic
1199742411 X:150747990-150748012 ATCTGCTGGGGCCTTGATGTTGG - Intronic
1199845039 X:151686669-151686691 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1200643190 Y:5747918-5747940 ATCTGCTGGTGCCTTGTTCTTGG - Intergenic
1200672893 Y:6115861-6115883 ATTTGATAGTGCCTTGATCTTGG + Intergenic
1201503817 Y:14675681-14675703 AGATGATGGTGCCTTGATCTTGG - Intronic
1202096889 Y:21260527-21260549 AGCAGATGGTGCCCTTATATAGG - Intergenic