ID: 1091017381

View in Genome Browser
Species Human (GRCh38)
Location 11:132064325-132064347
Sequence TTTGCTAAATTGCAGTTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 329}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091017381 Original CRISPR TTTGCTAAATTGCAGTTGTT AGG (reversed) Intronic
900430619 1:2600877-2600899 TTAGATAAATTACAGGTGTTTGG - Intronic
902583638 1:17424962-17424984 TTTGCTTTTTTGGAGTTGTTCGG - Intronic
904202026 1:28826159-28826181 TTTGCTTTATTGCAGTGGTCTGG - Intronic
904664863 1:32112349-32112371 TTTGCTTTATTGCAGTGGTCTGG - Intronic
904863183 1:33555844-33555866 TTTGCTTTATTGCAGTAGTCTGG + Intronic
905260851 1:36717358-36717380 TTTGCTTTATTGCAGTAGTCTGG - Intergenic
906333161 1:44904892-44904914 TCTTCTAAATTGCAGTGATTAGG - Intronic
906898948 1:49812258-49812280 TTTGTTAAACTCCAATTGTTTGG + Intronic
907667422 1:56445800-56445822 TTTGTTAAAATGCAGATTTTAGG + Intergenic
909730915 1:78888307-78888329 TTTACTAATTTGAAGTTGCTGGG + Intergenic
909904741 1:81180292-81180314 TTTGCTATATTGCAGTGGTCTGG - Intergenic
912783095 1:112571814-112571836 TTTGCTTTATTGCAGTGGTCTGG - Intronic
913310963 1:117492511-117492533 TTTGCTACATTGCAGTAGTCTGG + Intronic
915006380 1:152641188-152641210 TTTGCTTTATTGCAGTGGTCTGG - Intergenic
917223455 1:172756757-172756779 ATTGCTGGATTGCAGTTGTATGG + Intergenic
917485798 1:175453507-175453529 GTTTCTAACTTGCAGTTTTTTGG + Intronic
917765975 1:178217545-178217567 TTTGCTTTATTGCAGTGGTCTGG - Intronic
918378029 1:183928729-183928751 GTTGCTAGATTGCTGTTCTTAGG + Intergenic
919159970 1:193816158-193816180 TTTGCTTTATTGCAGTGGTCTGG - Intergenic
919683963 1:200464210-200464232 TTTGCTTAATGGCAATTTTTGGG - Intergenic
919705119 1:200669163-200669185 TTTGCAAAATTACAGTTATTGGG + Intronic
921090521 1:211837842-211837864 TTTGCTAAAATGCAGATTCTGGG + Intergenic
921219749 1:212964889-212964911 TTTGTTAACTTGCATATGTTGGG + Intronic
921255142 1:213332158-213332180 TTTACTACATTTCAGTTGGTTGG - Intergenic
921408425 1:214807988-214808010 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
923294270 1:232578299-232578321 TTTGTTTTATTGCAGTTGTCTGG + Intergenic
923553314 1:234981167-234981189 CTTGCTAAATGGCCGTTGCTCGG - Intergenic
1062976802 10:1689781-1689803 TTTGCTAAGATGGACTTGTTGGG + Intronic
1063422230 10:5922347-5922369 TTTGCATAATTGCAATTGTAGGG + Intronic
1064792754 10:18976727-18976749 TTATCTAAGTTGCAGTTGATTGG - Intergenic
1067120717 10:43470087-43470109 TTTGCTTTATTGCAGTGGTCCGG + Intronic
1067947618 10:50700098-50700120 TTTGCTGAAGGGCAGGTGTTTGG + Intergenic
1068787923 10:60997323-60997345 TTTGTCAAAATGCAGTTGTGTGG + Intronic
1069397797 10:68008850-68008872 TTTGCTTTATTGCAGTTGTCTGG - Intronic
1069398213 10:68013327-68013349 TTTGCTTCATTGCAGTGGTCTGG + Intronic
1070882937 10:79865085-79865107 TTTGCTGAAGGGCAGGTGTTTGG + Intergenic
1071368882 10:84930476-84930498 TTTGCTTTATTGCTGTGGTTTGG - Intergenic
1071649504 10:87381389-87381411 TTTGCTGAAGGGCAGGTGTTTGG + Intergenic
1072094585 10:92164996-92165018 TTTGCTGTATTACAGTGGTTAGG - Intronic
1073781304 10:106841612-106841634 TTTGGTTTATTGCAGTTGTCTGG + Intronic
1075163053 10:120041568-120041590 TTTGCTGTATTTCAGTTATTTGG - Intergenic
1075225286 10:120623712-120623734 TTTGCTGTATTGCAGCTGTCTGG + Intergenic
1075749474 10:124753620-124753642 TTTGCTAACTCTCAGTTGTTAGG - Intronic
1075964606 10:126600494-126600516 TTTGCTCATTTGCATTTGATTGG - Intronic
1076250804 10:128982563-128982585 TTTGCTAAACTGCAATTGCAAGG + Intergenic
1076548690 10:131263413-131263435 TTTGTTATATTGCAGTTGTTTGG + Intronic
1076660699 10:132054313-132054335 CTTGGTAAATTGAAGTTATTGGG - Intergenic
1078975672 11:16473244-16473266 TTTGCTTTATTGCAGTGGTCTGG - Intronic
1080064583 11:27996227-27996249 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
1081616967 11:44596887-44596909 CATGAAAAATTGCAGTTGTTGGG + Intronic
1082104833 11:48210428-48210450 TTTCCTAACTTGCAGTTTATTGG + Intergenic
1086216205 11:84384587-84384609 TTTTCCAAATTGCAGTTTTAAGG - Intronic
1088516882 11:110646138-110646160 TTTCCTAAATAGGAGTTATTAGG - Intronic
1088749758 11:112833852-112833874 TTTGCTAAAATGCAGATTATGGG - Intergenic
1089224181 11:116901918-116901940 TTTGCTGAATCTCAGTTGTTGGG - Intronic
1090623154 11:128579722-128579744 TTGGCAAAAGTGCTGTTGTTTGG - Intronic
1091017381 11:132064325-132064347 TTTGCTAAATTGCAGTTGTTAGG - Intronic
1091076030 11:132618033-132618055 GTTCCTATATTCCAGTTGTTGGG + Intronic
1092034551 12:5320795-5320817 TTTGCCTAATTGCTTTTGTTAGG - Intergenic
1092575662 12:9780242-9780264 TTTGCTATTTTCCAGTTGCTTGG + Intergenic
1092812068 12:12280695-12280717 TTTGATAAATTTCAATTTTTTGG + Intergenic
1093336302 12:17909225-17909247 TTTGCTGTATTCCAGTGGTTTGG + Intergenic
1095122883 12:38440182-38440204 TTTGCTTTATTGCAGTGGTCTGG - Intergenic
1095168893 12:39009690-39009712 TTTGCTTTATTGCAGTGGTTTGG + Intergenic
1098177924 12:67812873-67812895 TTTGCAATTTTGCACTTGTTTGG + Intergenic
1099344866 12:81486710-81486732 TTTTCTAAACTGAAGTTGTGTGG - Intronic
1099713206 12:86255797-86255819 ATTGTTAAATGGCAGTTCTTTGG - Intronic
1099715788 12:86291776-86291798 TTTGGCTAATTGCAGTTATTAGG - Intronic
1100267241 12:92989523-92989545 ATTGCTAAGTGGCAGTTGCTGGG - Intergenic
1101082172 12:101198552-101198574 TTTGGTAAATTGTATTTTTTAGG - Intronic
1101758964 12:107643608-107643630 TTTCCTGAATGGCAGCTGTTGGG + Intronic
1102794901 12:115680338-115680360 TTTGCTAAATTGCCACTGTGAGG - Intergenic
1104114078 12:125732383-125732405 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
1104695152 12:130857910-130857932 TTTGCCATCTTGCAGTTGTGGGG + Intergenic
1105324816 13:19360796-19360818 TTTGCTTTATTGCAGTAGTGTGG - Intergenic
1105337080 13:19482901-19482923 TTTGCTTTATTGCAGTGGTCTGG - Intronic
1105511322 13:21054104-21054126 TTTGCTAAATAGGAGTAGTTAGG - Intronic
1105868467 13:24482763-24482785 TTTGCTATATTGCAGTAGTGTGG + Intronic
1106060307 13:26284115-26284137 TTTGCTATATTCCAGAAGTTTGG - Intronic
1106071884 13:26420192-26420214 TTTGCTTTATTGCAGTTGTCTGG + Intergenic
1106456438 13:29931210-29931232 TTTGCTTTATTGCAGTGGTCTGG - Intergenic
1107194334 13:37630270-37630292 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
1107258016 13:38454265-38454287 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
1107851917 13:44578671-44578693 TTTGTTAAATTTAGGTTGTTAGG + Intergenic
1108246065 13:48515516-48515538 TTTGCCAAATTGAAGATCTTGGG - Intronic
1108278235 13:48833607-48833629 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
1108632325 13:52298171-52298193 TTTGCTTTATTGCAGTGGTCTGG - Intergenic
1108654376 13:52514423-52514445 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
1109735703 13:66481600-66481622 TTTGCTTTATTGCAGTAGTCTGG + Intronic
1109957198 13:69583583-69583605 TTTGCTACATTCTAGTTCTTAGG + Intergenic
1111220294 13:85196431-85196453 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
1111280954 13:86024530-86024552 TTTGCTTTATTGCAGTGTTTTGG - Intergenic
1111800011 13:92969737-92969759 TTTGCTAAATGGGATTTTTTTGG + Intergenic
1114575446 14:23708590-23708612 TGAGCTAACTTGCAGGTGTTTGG + Intergenic
1114980331 14:28156879-28156901 TTTGTTATATTGGAGTTGTGGGG + Intergenic
1115043548 14:28960464-28960486 TTTGCTATATTGCAGAGGTCTGG - Intergenic
1115433768 14:33350379-33350401 TTTGCTAAATTTCAGCTTTTAGG + Intronic
1116604996 14:46980925-46980947 TTTGCTTTATTGCAGTAGTCTGG + Intronic
1119471063 14:74899546-74899568 TTTGCTAATTTGCCCTTTTTTGG + Intronic
1119766785 14:77195543-77195565 TTTGCTAAAATGCAGGTGGAAGG - Intronic
1120938935 14:89927199-89927221 TTGGTTGAATTGCTGTTGTTTGG + Intronic
1122022838 14:98853724-98853746 TTTGCTAACTTGGGGTTGTATGG - Intergenic
1124447351 15:29749429-29749451 GTTGTGAAATTGCAGCTGTTTGG + Intronic
1124639424 15:31387557-31387579 TTTGCTTTATTGCAGTGGTCTGG + Intronic
1126391831 15:48164947-48164969 TTTGCTTTATTGCAGTAGTCTGG + Intronic
1127641169 15:60917164-60917186 TTTCCTAAATTACATCTGTTTGG - Intronic
1128386254 15:67150752-67150774 CTTGAGAAATTGCAGTTGTCAGG + Intronic
1128399872 15:67267356-67267378 TTTGCTAAAATGCAGATGCTAGG - Intronic
1130729017 15:86471023-86471045 CTTGCCAAATTGCCCTTGTTAGG + Intronic
1130746121 15:86655726-86655748 ATTGCTAACTTGCAGTGGTCAGG + Intronic
1131749580 15:95492367-95492389 TTTTCAAAATAGCATTTGTTTGG + Intergenic
1131759270 15:95602320-95602342 TTTGCTTTATTGTTGTTGTTTGG - Intergenic
1133609595 16:7420675-7420697 TTTGATAAATAGCAGTAATTGGG + Intronic
1134388754 16:13798526-13798548 TTTACTAAACTGCAGCTGTAGGG - Intergenic
1137416319 16:48284733-48284755 TTTGCTTTATTGCAGTGGTCTGG + Intronic
1137682854 16:50365989-50366011 TTTGCTAACTTGAAATTTTTAGG - Intronic
1138013802 16:53411256-53411278 TTTGCTAAATATCATTTTTTTGG + Intergenic
1138162419 16:54766965-54766987 TTTATTCAAGTGCAGTTGTTTGG - Intergenic
1138299870 16:55917040-55917062 TCTGCTAAATTTCCCTTGTTTGG + Intronic
1139018318 16:62717169-62717191 TTTCCAAATTTGCAGTCGTTTGG - Intergenic
1140561801 16:75991274-75991296 TTTGGTAAGTTGCATTTGTATGG - Intergenic
1140815256 16:78615345-78615367 TTGGCTAAAAAGAAGTTGTTGGG + Intronic
1147049941 17:37786673-37786695 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
1148324460 17:46775134-46775156 GTTGCCAAATGGCAGATGTTTGG - Intronic
1148659981 17:49322501-49322523 TTTGCTTTATTGCAGTGGTCTGG - Intronic
1149877536 17:60251419-60251441 TTTACTAAAATAGAGTTGTTTGG - Intronic
1150662395 17:67094494-67094516 TTAGCTGTATTGCAGTAGTTTGG - Intronic
1151057524 17:71050516-71050538 TTTACTAAATAGCACTTGTATGG - Intergenic
1151609042 17:75159153-75159175 TCTACTAAATTGCAGTTTCTGGG + Intronic
1153547986 18:6229305-6229327 TTTTTTAAATTGTGGTTGTTTGG + Intronic
1153871907 18:9329670-9329692 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
1153896655 18:9568371-9568393 TTTGCTCTTTTGCAGTGGTTTGG + Intronic
1154227818 18:12524064-12524086 TTTGTTTCATTGCAGTGGTTTGG + Intronic
1154398689 18:14014028-14014050 TTTGCTTTATTGCAGTGGTCTGG - Intergenic
1155824766 18:30426253-30426275 TTTACTTCATTGCAGTGGTTTGG + Intergenic
1155853836 18:30807253-30807275 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
1156387337 18:36617892-36617914 TTTGCTAAATTACATTTCCTAGG + Intronic
1156658775 18:39320555-39320577 TTTGCTTAATTTAAATTGTTTGG - Intergenic
1157167398 18:45370612-45370634 TTTGCAAAATAGCAGTGCTTAGG + Intronic
1157535544 18:48454702-48454724 TTTGCTGAATAGCAATGGTTCGG - Intergenic
1158589251 18:58765869-58765891 TTTCCTAAATTTCATTTCTTTGG + Intergenic
1158720989 18:59924365-59924387 TTAGTTAATTTGCAGTTGTTTGG - Intergenic
1162417753 19:10548349-10548371 TATGCAAAATTGTAGGTGTTTGG + Intronic
1163213857 19:15862195-15862217 TTTGCTAAAATGCAGATGCCTGG - Intergenic
1164490025 19:28701639-28701661 TTTGCTTTATTGCAGTGGTCTGG - Intergenic
1165103358 19:33453678-33453700 TTTGCTTTATTGCAGTAGTCTGG + Intronic
1165697270 19:37910057-37910079 TTTCAGACATTGCAGTTGTTAGG + Intronic
925665323 2:6248454-6248476 TTTCCAAAAGTGCAGTTGCTGGG - Intergenic
926649396 2:15325212-15325234 TTTGCTTTATTGCAGTAGTCTGG - Intronic
927319619 2:21727836-21727858 TTTGCTAAAATACATTTGTTAGG + Intergenic
928528998 2:32171517-32171539 AGTGTAAAATTGCAGTTGTTTGG + Intronic
929094198 2:38248165-38248187 GTTGCTCACTTGCAGTTGCTGGG + Intergenic
929097292 2:38275564-38275586 TTTGCTTTATTTCAGTTGTCTGG - Intergenic
929888105 2:45896235-45896257 TTTGCTAAATTTTAGAGGTTGGG + Intronic
930211733 2:48646095-48646117 TTTGTTAAAATCCAGTTTTTTGG + Intronic
931279383 2:60775679-60775701 TTTGCTTTACTGCAGTTGTCTGG - Intronic
931292523 2:60887562-60887584 TTCCCTAAATTACAGTTATTTGG + Intronic
931489598 2:62729961-62729983 TTTGCTTTATTACAGTGGTTTGG - Intronic
931895388 2:66723333-66723355 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
931998990 2:67866367-67866389 ATTGCAGAATTGCAGATGTTAGG - Intergenic
932175856 2:69601149-69601171 TTTGCTTTATTGCAGTGGTCTGG + Intronic
932185967 2:69695744-69695766 TTTGCTTTATTGCAGTGGTTGGG - Intronic
933237138 2:79877282-79877304 TTTGTTAAATGACAATTGTTAGG - Intronic
933944021 2:87268757-87268779 TTTGCTTTATTGCAGTGGTGTGG - Intergenic
934113301 2:88762521-88762543 TATGTTAAATTTCAGATGTTAGG + Intergenic
934127461 2:88911451-88911473 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
935821785 2:106900488-106900510 CTTGCAAAATTCCACTTGTTAGG - Intergenic
936169726 2:110158481-110158503 TGTGTTAAATTTCAGATGTTAGG + Intronic
936266402 2:111012400-111012422 TTTGCTTTATTGCAGTGGTCTGG + Intronic
936336198 2:111592822-111592844 TTTGCTTTATTGCAGTGGTGTGG + Intergenic
936755221 2:115700577-115700599 TTTGCTTAATTGCTTTTGCTAGG - Intronic
937423463 2:121777790-121777812 TTTGCTTTATTGTAGTTGTCTGG - Intergenic
937519777 2:122698412-122698434 TCTACTAAGTTGCAGTTTTTGGG - Intergenic
937796692 2:126031079-126031101 TGTTCTAAATGGTAGTTGTTTGG + Intergenic
938218103 2:129539841-129539863 TTTGCTAAATTGATGTTATATGG - Intergenic
939583074 2:143974321-143974343 TTTCCTAAATTGCAATACTTGGG - Intronic
939652635 2:144784039-144784061 TTTGCTTTATTGCAGTGGTCTGG - Intergenic
939845399 2:147238944-147238966 TTTGCTAAATTGAAAATATTTGG + Intergenic
940020214 2:149148390-149148412 TTTGCCAAACTACAGATGTTGGG + Intronic
941515819 2:166476259-166476281 TTTAATAAATTACAGTTATTTGG - Intronic
941955293 2:171197827-171197849 CTTGCTAAAATGCAGATGCTTGG + Intronic
942041829 2:172073518-172073540 TTTTTTTAAGTGCAGTTGTTGGG - Intronic
943559914 2:189448613-189448635 TTTGCTTATTTTCAGTTGTAGGG + Intronic
944224544 2:197337124-197337146 CTTTCTAAAATGCAGGTGTTAGG + Intergenic
944529613 2:200654501-200654523 TTTGCTTTATTGCTGTGGTTTGG + Intronic
947310982 2:228801852-228801874 TTTGCCAAATGGCAGTGGTCTGG - Intergenic
947654424 2:231814024-231814046 TTTGCTTTATTGCAGTGGTCTGG - Intergenic
1170104201 20:12736203-12736225 TTTGTTAATCTGCAGTTGTGAGG - Intergenic
1170174204 20:13449998-13450020 TTTGCTCTATTGAAGTTGTTTGG - Intronic
1170502212 20:16986463-16986485 TTTGCTTGATTGCAGTGGTCTGG + Intergenic
1170992226 20:21313570-21313592 TTTGCTAAATGGCAACTATTTGG + Intronic
1171824424 20:29881360-29881382 TTTGCTTTATTGCAGTTTTCTGG + Intergenic
1173893042 20:46528188-46528210 TTTGCCAGCTTGCAGTTGGTGGG + Intergenic
1174944042 20:54965055-54965077 GTAGCTAAATTGCAATTATTTGG + Intergenic
1175025440 20:55897057-55897079 TTTGCTTTATTGCAGTTGTCTGG - Intergenic
1176736486 21:10552282-10552304 TTTGCTTTATTGCAGTGGTCTGG + Intronic
1177527760 21:22318273-22318295 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
1183012359 22:34957263-34957285 ATTGCTCAATTGCGTTTGTTGGG - Intergenic
1183501602 22:38182955-38182977 TTCAATAAATGGCAGTTGTTAGG + Intronic
1183532653 22:38370396-38370418 TTTGCTTTATTGCAGTGGTCTGG - Intronic
949412246 3:3778582-3778604 TTTTTTTAATTGCAGTTTTTGGG + Intronic
949499613 3:4667152-4667174 TTTGCTTAATTACATTTGTGTGG + Intronic
949622487 3:5829881-5829903 TTTGCTTTATTGCAGTGGTCTGG - Intergenic
949787100 3:7753781-7753803 CTTGCTAAAATGCAAATGTTGGG - Intergenic
950562258 3:13739420-13739442 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
950921548 3:16699735-16699757 TTTCCAAAATTTCAGTTATTTGG - Intergenic
950989012 3:17411359-17411381 GTTGCTTTACTGCAGTTGTTTGG + Intronic
951789244 3:26461453-26461475 TTTGCTAAATTATCTTTGTTAGG - Intergenic
952084030 3:29796048-29796070 TTTGCTTTATTGCAGTAGTCTGG - Intronic
952555905 3:34530643-34530665 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
952639391 3:35574491-35574513 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
953559509 3:43975597-43975619 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
955613998 3:60786173-60786195 TTGGCTAAGTTCAAGTTGTTAGG - Intronic
957115654 3:76021553-76021575 TTTGCTTTATTGCAGTGGTCTGG - Intronic
957764766 3:84609001-84609023 TTTGCTTAATTTAAGGTGTTTGG - Intergenic
958502240 3:94927351-94927373 TTTGCTTTATTGCAGTGGTCTGG - Intergenic
958800933 3:98754977-98754999 TTTGCTTTATTGCAGTGGTGTGG + Intronic
959355911 3:105328132-105328154 TTTGCTGTATTGCAGTGGTCTGG + Intergenic
959818991 3:110709867-110709889 TGTTCTAAATTGCAGTTATTTGG - Intergenic
960579394 3:119262173-119262195 TTTGCTTTATTGCAGTGGTCTGG - Intergenic
960734678 3:120765507-120765529 TTTGCTAAATTGTAGCTGGCAGG + Intronic
962210877 3:133476591-133476613 TTTGCTAAAATGTAGTTTTAGGG - Intergenic
963292991 3:143512452-143512474 TTTGCTTTATTGCAGTGGTCTGG - Intronic
963513989 3:146284799-146284821 TTTGCTATTGTGCAGATGTTGGG - Intergenic
964440094 3:156699648-156699670 TTTGCTTTATTGCAGTGGTCTGG + Intronic
964535154 3:157713284-157713306 TTTGCTCTATTGCAGTGGTCTGG + Intergenic
965396133 3:168162261-168162283 TTTGCCAAAGTGCATTAGTTAGG + Intergenic
967598192 3:191352706-191352728 TTTGCTTTATTGCAGTGGTCTGG + Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
969783089 4:9426641-9426663 TTTACTAAATTGGATTTTTTTGG - Intergenic
970260889 4:14223438-14223460 CTTGCTAAATTGCAGATGCTTGG + Intergenic
970962227 4:21885632-21885654 TGTGCTAAATTAGGGTTGTTTGG - Intronic
971538016 4:27779176-27779198 TTTGCTTTATTGCAGTGGTGGGG + Intergenic
971587677 4:28425345-28425367 TTTGCTTAATTGCAGTGATCTGG - Intergenic
972768727 4:42175649-42175671 TTTGCTTCATTGCAGTGGTCTGG - Intergenic
972970797 4:44573962-44573984 TTTGCACAATTGCTGTTCTTTGG - Intergenic
974260788 4:59520428-59520450 TTTGCTAAATTGGAATGGTAAGG - Intergenic
974633852 4:64532976-64532998 TTTCCTGAATGGCAATTGTTTGG + Intergenic
975405867 4:73988506-73988528 TTTTCTATACTGCAGTTTTTAGG + Intergenic
976360318 4:84170607-84170629 TATGCTAAATTTGAGATGTTGGG - Intergenic
976518673 4:86001671-86001693 TATTCTAAAGTGCAGTTGTTGGG - Exonic
978155130 4:105481167-105481189 TTTGCAAAATGACAGTTTTTAGG - Intergenic
978348147 4:107793417-107793439 TTTGCTACATTCTAGTTGCTGGG - Intergenic
978687971 4:111471020-111471042 TTTGCTCAATTGCAGGTTCTGGG + Intergenic
979426003 4:120567700-120567722 TTTAATAAATTGCAATTGTTTGG - Intergenic
979823479 4:125203125-125203147 TTTGCTTTATTGTAGTTGTCTGG + Intergenic
981549300 4:145927174-145927196 TTTTCTAATCTGCACTTGTTTGG - Intronic
982494371 4:156072063-156072085 ATTGCTAAAGGGCAGTTCTTTGG - Intergenic
983078630 4:163357190-163357212 TTTACTAAAGTGTAGTTGATGGG - Intergenic
983120332 4:163875852-163875874 TTTGCTAAATTGCCTCTCTTTGG - Intronic
983252267 4:165358532-165358554 TTTGCTTAATGGAAGCTGTTAGG + Intergenic
983896837 4:173090211-173090233 TTTGAGAAATTGAAGCTGTTGGG + Intergenic
984046318 4:174803917-174803939 TTTGCAAACTTGTAGTTGTAGGG + Intronic
984581790 4:181518364-181518386 TTTGCTTAATGGCACTTCTTAGG + Intergenic
986776532 5:11019157-11019179 TTTGCTTTATTGCAGTAGTGTGG + Intronic
986787773 5:11130689-11130711 TTTCCTAACTTGCAGTACTTGGG + Intronic
987290619 5:16505184-16505206 ATTACTAAATTCCAGTTGTACGG + Intronic
987420795 5:17718044-17718066 CTTGTGCAATTGCAGTTGTTTGG + Intergenic
988521146 5:31946619-31946641 TTTGTAAAATGACAGTTGTTCGG - Intronic
989532992 5:42529372-42529394 TTTGCTTCATTGCAGTGGTCCGG + Intronic
989802454 5:45560182-45560204 TTTGCTTTATTGCAGTGGTCTGG + Intronic
990893414 5:60672033-60672055 ATTGCTTAACTGCAGTTGTAGGG - Intronic
991077593 5:62558136-62558158 TTTGCTAATTTGCAGGATTTAGG - Intronic
991332992 5:65512703-65512725 TTTGTTTTATTGCAGTTGTCTGG + Intergenic
991412992 5:66363330-66363352 TTTGCTTTATTGCAGTGGTCTGG - Intergenic
992592785 5:78312988-78313010 TTTGCTTTATTGCAGTGGTCTGG - Intergenic
993341072 5:86725737-86725759 TTTGCTAAATGGCATTATTTGGG + Intergenic
995100822 5:108302567-108302589 TTATCTTAATTACAGTTGTTTGG - Intronic
995307624 5:110672546-110672568 TTTGGAAATTTGAAGTTGTTTGG - Intronic
996728541 5:126694739-126694761 TTTCCTAAATTACAGAGGTTTGG - Intergenic
997703308 5:135922136-135922158 TTTGCTTTATTGCAGTGGTCTGG - Intergenic
999688993 5:154129191-154129213 TTTGCTTTATTGCAGTGGTCTGG + Intronic
1001057631 5:168462494-168462516 TTTGTTAAAATGCAGTTTTCAGG - Intronic
1003957023 6:11173600-11173622 TTTTCTTAATTATAGTTGTTGGG + Intergenic
1004569113 6:16827865-16827887 TTTGCTTTATTGCGGTGGTTTGG - Intergenic
1005509844 6:26502301-26502323 TGAGCTAACTTGCAGGTGTTTGG + Intronic
1005748897 6:28865431-28865453 TTTGTGAAATAGCAGTTGTAAGG + Intergenic
1005771141 6:29072836-29072858 TTTGCTATATTGCATTTCTTGGG - Intronic
1007065044 6:38981785-38981807 TTTGCCAAGTTGGAGTTCTTGGG - Intronic
1007332532 6:41124470-41124492 TTTCCTAAATTTCAGATGGTGGG + Intergenic
1008136892 6:47787481-47787503 TAAGCTAAATAGCAGATGTTGGG - Intronic
1008377500 6:50808943-50808965 TTTGCTAAATTATAGCTTTTGGG + Intergenic
1009387256 6:63100040-63100062 TTTGTTTAATTGCAGTTGCCTGG - Intergenic
1010699945 6:79031974-79031996 CTTGCTTAATTGCAGTGGTCTGG - Intronic
1010898969 6:81402191-81402213 TTTGCCAAATTCAAGTTGCTGGG - Intergenic
1011029141 6:82902271-82902293 ATTCCTAATTTGCAGTTGTTAGG - Intronic
1011051942 6:83160997-83161019 TTTGATGAATTTCAGTTGTTGGG + Intronic
1011226931 6:85118077-85118099 TTTGTTAAACTGAAGTTTTTTGG + Intergenic
1012030621 6:94056911-94056933 TTTGATAGATTGTAGTTGCTGGG + Intergenic
1012383080 6:98643482-98643504 TTTGCTACACAGCAATTGTTAGG - Intergenic
1012390506 6:98732802-98732824 TTTGCTATATTGCAGTGGTCTGG - Intergenic
1013859693 6:114620689-114620711 TTTTCTAAATTTCAGTTCCTAGG - Intergenic
1013988131 6:116221397-116221419 TTTGCTAAAATGTACTTGGTTGG - Intronic
1014268312 6:119307270-119307292 TAAGCTAAATTCCTGTTGTTGGG - Intronic
1014671439 6:124309347-124309369 TTTTCTAAATTGAAATTTTTGGG + Intronic
1015990006 6:138930091-138930113 ATTTTTAAATTGCAGATGTTGGG - Exonic
1017315050 6:153021185-153021207 TTTGCTACATCCCAGTTGTGTGG - Intronic
1021215811 7:17913735-17913757 TTTGTTAATTTGCTATTGTTTGG - Intronic
1022951199 7:35339849-35339871 TTTGCCAAAATGCAGTTGGATGG - Intergenic
1023753375 7:43392890-43392912 TTTGCTGAATTGCAGTTTTAGGG + Intronic
1027440752 7:78216832-78216854 TTTGCTATATTACACTTCTTGGG + Intronic
1027917545 7:84345078-84345100 TTTGCTCTATTGCAGTGGTTTGG - Intronic
1029446660 7:100616824-100616846 TTTGCTAAATTACATGTGTATGG + Intergenic
1030726138 7:112926522-112926544 ATCGTTAAATTGAAGTTGTTTGG - Intronic
1031091657 7:117364148-117364170 TTTGCTAAATTTCATGTTTTAGG - Intronic
1031896868 7:127360246-127360268 TTTGAAAAAATGCAGATGTTTGG - Intronic
1033112893 7:138598134-138598156 TTTGTTAAAATGCAGATTTTTGG + Intronic
1036977990 8:13436150-13436172 TTTGCTTTATTGCAGTGGTCTGG + Intronic
1037206301 8:16324058-16324080 ATTGTTACATTGCAGTTGTTAGG - Intronic
1037666549 8:20974771-20974793 TTTGCTAACTTGCAGTCTTATGG + Intergenic
1040841298 8:51788171-51788193 TTAGCTTAATTGTAGTTGTCTGG + Intronic
1041580306 8:59450916-59450938 TTTGCTTATTTGCTGTGGTTAGG + Intergenic
1041882704 8:62770482-62770504 CTTCCTAAATTGCAGATGATTGG + Intronic
1043172965 8:76988331-76988353 TTTGCTTTATTGCAGTGGTCTGG - Exonic
1044122840 8:88419133-88419155 TTTGTTAGATTGCTTTTGTTGGG + Intergenic
1044449527 8:92318196-92318218 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
1044616013 8:94142213-94142235 TTTGCTTTATTGCAGTGGTCTGG - Intronic
1044682126 8:94792069-94792091 TTAGGTAACTTACAGTTGTTAGG + Exonic
1046022719 8:108685652-108685674 TTTGCCTCATTGCATTTGTTAGG - Intronic
1046658241 8:116920594-116920616 TTTTCTAAATAGCAGTCTTTTGG + Intergenic
1047400909 8:124546466-124546488 TTTGCTATATTGCAGCGGTCTGG + Intronic
1049917416 9:331761-331783 TTTGCTAACTGGCTGTTGATAGG - Intronic
1050002373 9:1091656-1091678 TTAGCAAAATTGAAATTGTTAGG - Intergenic
1050779836 9:9319259-9319281 CTTGCTAAATTCCAGTGTTTGGG + Intronic
1051010007 9:12400295-12400317 TTTGCTTTATTGCAGTGGTCTGG + Intergenic
1051235522 9:14994350-14994372 TGTCCTAAATTCTAGTTGTTAGG + Intergenic
1051447599 9:17156715-17156737 TTTGCTTTATTGCAGTGGTCTGG - Intronic
1052569642 9:30202970-30202992 AGTGCTAAATTCCAGTTATTGGG + Intergenic
1053748798 9:41232912-41232934 TTTGCTTTACTGCAGTTGTCTGG - Intergenic
1054923153 9:70561954-70561976 TTTGCTAAATTCCCTTTTTTAGG + Intronic
1056274447 9:84980051-84980073 TTTGCTTTATTGCAGTGGTATGG + Intronic
1056364545 9:85890787-85890809 TATGCTAATTTGCATTTCTTTGG - Intergenic
1056575398 9:87852563-87852585 TTTGCTGAAGGGCAGGTGTTTGG - Intergenic
1057762362 9:97887193-97887215 TTTGCTTTATTACAGTGGTTTGG + Intergenic
1057769428 9:97954513-97954535 TATGATAAAGTGCATTTGTTTGG + Intergenic
1057936212 9:99241149-99241171 TTTCACAAATTGCAGTTCTTAGG - Intergenic
1058534853 9:105948413-105948435 TTTTCTAATTTTCATTTGTTTGG + Intergenic
1059049811 9:110911814-110911836 TTTGCTCTATTGCAGTGGTCTGG + Intronic
1060776647 9:126379646-126379668 TTTGCTAATTTACAATTGTTTGG + Intronic
1061471782 9:130832667-130832689 TTTGCTATGTTGCATTAGTTTGG - Intronic
1203377482 Un_KI270442v1:387722-387744 TTTGCCTTATTGCAGTTGTCTGG + Intergenic
1188055877 X:25540893-25540915 TTTCCTAAAGTGGATTTGTTAGG - Intergenic
1188228468 X:27631387-27631409 TTTCCTAAATTGCTCTGGTTGGG - Intronic
1189917579 X:45871526-45871548 TTTGCTTTATTGCAGTGGTCTGG - Intergenic
1190460524 X:50668884-50668906 TTTGCTTTATTGCAGTGGTCTGG - Intronic
1190619811 X:52275105-52275127 TTTCCTAACTTGCTGTTTTTTGG - Intergenic
1190802303 X:53802510-53802532 TTTGCTACATTGGTGTTGTGTGG - Intergenic
1192028407 X:67481804-67481826 TTTGCTTTATTGCAGTGCTTTGG - Intergenic
1192332601 X:70189110-70189132 TTTGCCATATTGCATTTGCTAGG - Intronic
1193139565 X:78012864-78012886 ATTCCTATATTGCAGTTTTTCGG + Exonic
1193207927 X:78770912-78770934 TTTGCTAAATAGGTGCTGTTGGG - Intergenic
1194559260 X:95400617-95400639 TTTGTTAAATTAGAATTGTTAGG - Intergenic
1197196399 X:123706206-123706228 TATTTTAAATTGCAATTGTTTGG - Intronic
1198058870 X:133023502-133023524 GTTTCTAAATTTCAGTTTTTTGG - Intergenic
1198168224 X:134078271-134078293 TTTTTTAATTTGCTGTTGTTTGG - Intergenic
1198627799 X:138598245-138598267 CTTGCTAGATTTCAGTTTTTAGG + Intergenic
1198758502 X:140006164-140006186 TTTGCTGGATGGAAGTTGTTAGG + Intergenic
1198780255 X:140227428-140227450 TTTGCTGGATGGAAGTTGTTAGG - Intergenic
1201234269 Y:11894778-11894800 TTTGATTAATTCCCGTTGTTGGG + Intergenic
1202594758 Y:26525481-26525503 TTTGCTTTATTGCAGTAGTCTGG + Intergenic