ID: 1091018644

View in Genome Browser
Species Human (GRCh38)
Location 11:132078408-132078430
Sequence GGTACCTGGGTGAGTGCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091018638_1091018644 18 Left 1091018638 11:132078367-132078389 CCTCGGTGTGGCTCAGGCTGCTA 0: 1
1: 0
2: 2
3: 30
4: 234
Right 1091018644 11:132078408-132078430 GGTACCTGGGTGAGTGCCACCGG 0: 1
1: 0
2: 2
3: 15
4: 165
1091018637_1091018644 19 Left 1091018637 11:132078366-132078388 CCCTCGGTGTGGCTCAGGCTGCT 0: 1
1: 0
2: 3
3: 34
4: 236
Right 1091018644 11:132078408-132078430 GGTACCTGGGTGAGTGCCACCGG 0: 1
1: 0
2: 2
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091018644 Original CRISPR GGTACCTGGGTGAGTGCCAC CGG Intronic
900242964 1:1625636-1625658 GGCACCTTGGTGAGCGCCCCGGG - Exonic
900368475 1:2321033-2321055 GGTGCCTGGGTGACTGCTACAGG + Intergenic
900400227 1:2470003-2470025 AGCACCTGGGTGAGGGCTACAGG + Intronic
900503458 1:3017692-3017714 GGTACCCGTGTGAGACCCACAGG - Intergenic
905281396 1:36851706-36851728 GGTGCCTTGGTGAGTGCCTCTGG + Intronic
906154035 1:43603666-43603688 GTTCCTTGGGTGGGTGCCACTGG - Exonic
906322030 1:44822968-44822990 GGTACCTGTCTGTGGGCCACAGG + Intronic
906922407 1:50078610-50078632 GGTTCCTAGGTGAGTGGAACTGG + Intronic
907601439 1:55775100-55775122 GGAACCTGGGGGAGTGTAACTGG - Intergenic
912686049 1:111766129-111766151 GGAATCTGGGGGAGTGACACAGG - Exonic
914001088 1:143694992-143695014 AGTCCCTGGGTGAGGGCCACAGG - Intergenic
914511522 1:148336399-148336421 AGTTCCTGGGTGGGGGCCACAGG + Intergenic
915952295 1:160197606-160197628 GAGACCTGGGTGAGTGCCCCTGG + Exonic
916003234 1:160636244-160636266 GGTACCTGGGGGAGGGCCATGGG + Intronic
918341665 1:183572948-183572970 CGACCCTGGGTGAGAGCCACAGG - Intronic
919425258 1:197421906-197421928 GTTACCAGTGTGACTGCCACAGG + Exonic
919930523 1:202218433-202218455 GGACCCTAGGTGTGTGCCACCGG + Intronic
920665942 1:207963237-207963259 GGAGCCTGGGAGAGGGCCACTGG - Intergenic
922042559 1:221910978-221911000 GGTCCCTGTGGGACTGCCACTGG + Intergenic
924205172 1:241704958-241704980 GGTACCTGGTTGTGGGCCAATGG + Intronic
1062800716 10:377675-377697 GGTGCCTGGATGAGTGACAGCGG - Intronic
1070540739 10:77413429-77413451 GGTACCTGGGAGAATGCCCGTGG - Intronic
1070807160 10:79277325-79277347 GGTAAGTGGGTGGGTGCCATGGG + Exonic
1070976643 10:80610606-80610628 GGTCCCTGGGTGAGAGGCAGGGG - Intronic
1072754804 10:98012254-98012276 GTCTCCTGGGTGTGTGCCACAGG - Intronic
1075989256 10:126819914-126819936 TGTCCCTGGATGAGTACCACTGG + Intergenic
1076818417 10:132925938-132925960 GGTACCACGGCAAGTGCCACAGG - Intronic
1076903532 10:133351363-133351385 GGGACCTGGGGGAGAGTCACAGG - Exonic
1077110098 11:858526-858548 GGAACCGGGGTGAGTGTCAGCGG - Intronic
1077252189 11:1565591-1565613 GGTACCTGGCTGCGTGCAGCCGG + Exonic
1077800504 11:5531463-5531485 AGAATCTGGGTGAGTGGCACAGG - Intronic
1081307704 11:41533956-41533978 CTTACCTGGGTGAGTAACACAGG - Intergenic
1081615213 11:44586880-44586902 GGAAACAGGGTGAGTGGCACAGG + Intronic
1081850281 11:46270874-46270896 GGAACCTGGGTTAGGGCCAATGG + Intergenic
1081992036 11:47343141-47343163 TGTACCTGGGTGGGGGCCGCAGG + Exonic
1084070000 11:66727981-66728003 GGTACCTGTGTGGCTGGCACGGG + Intronic
1084350957 11:68598902-68598924 CCTACCTGTGTGAGTGTCACAGG - Intronic
1084456388 11:69270289-69270311 GGTACCGGAGGGAGTCCCACAGG + Intergenic
1085580369 11:77644780-77644802 AGTTCCTGGGTGGGGGCCACAGG + Intergenic
1086881955 11:92159967-92159989 GGTTCCTGGGTGCAGGCCACAGG + Intergenic
1088567781 11:111191194-111191216 TGTCCCTGGCTGTGTGCCACAGG - Intergenic
1089084913 11:115808756-115808778 GGTTCCTGGGTGGGAGCCACAGG + Intergenic
1089956560 11:122576666-122576688 GGTTCCTGGGTGAGGGCCACAGG + Intergenic
1091018644 11:132078408-132078430 GGTACCTGGGTGAGTGCCACCGG + Intronic
1093401667 12:18753784-18753806 GGAGCCAGGGTGAGTGCTACTGG + Intergenic
1098925996 12:76349802-76349824 GGTTACTTGGTGAATGCCACAGG - Intergenic
1100367481 12:93935089-93935111 GGACCCTGGGTGGGGGCCACAGG - Intergenic
1101652138 12:106686954-106686976 GCTGCCTGGGTGAGTGAGACGGG + Exonic
1104887492 12:132119179-132119201 GGTACCTGGGATGGTGCCGCAGG - Intronic
1108182439 13:47854469-47854491 AGTACATGGGTAACTGCCACAGG - Intergenic
1108846018 13:54679187-54679209 GGTTCCTGGGTGAGGGCCACCGG - Intergenic
1110572479 13:77021010-77021032 GGTACATGGGAGAATGCCAAAGG - Intronic
1111249635 13:85586487-85586509 AGTTCCTGGGTGGGGGCCACAGG + Intergenic
1112064725 13:95781054-95781076 GGCAGCTGGGCAAGTGCCACTGG - Intronic
1112238296 13:97656179-97656201 GGTTCCTGGTGGAGTGCCATAGG - Intergenic
1112672808 13:101660348-101660370 AGTTCCTGGGTGGGAGCCACAGG + Intronic
1113424957 13:110200198-110200220 GGGACCTGGGAGAATACCACAGG + Intronic
1114977820 14:28123746-28123768 AGTTCCTGGGTGTGGGCCACAGG - Intergenic
1115649934 14:35395848-35395870 GATACCTGTCTGAGTCCCACAGG + Intergenic
1117445571 14:55800809-55800831 AGTTCCTGGGTGGGGGCCACAGG - Intergenic
1121011215 14:90521339-90521361 AGTTCCTGGGTGAGAGCCAGTGG - Intergenic
1121127503 14:91417617-91417639 GTGACCTGGGTGAGTGCGCCTGG - Exonic
1121455885 14:94038672-94038694 AGTGCCTGGCTGGGTGCCACGGG - Intronic
1122538924 14:102485845-102485867 GAGACCAGGGTGTGTGCCACTGG + Intronic
1123937102 15:25199308-25199330 GGCACCTGGCTGATGGCCACTGG - Intergenic
1123941821 15:25220354-25220376 GGCACCTGGCTGACTGACACTGG - Intergenic
1123945703 15:25237847-25237869 GGAACCTGGCTGACTGACACTGG - Intergenic
1124364343 15:29061747-29061769 GGTAACTGGGTGTGTCCCCCAGG + Intronic
1124559757 15:30760735-30760757 GGCACTTGGCTGAGTGGCACAGG - Intronic
1125336820 15:38635043-38635065 GCTACCTGGGTGGCTGACACAGG - Intergenic
1125613239 15:40987016-40987038 GGTACTTGGCTGTGTGCCAAGGG - Intronic
1130998670 15:88920728-88920750 AGTTCCTGGGTGGGGGCCACAGG - Intergenic
1132752920 16:1467083-1467105 GGAACCTGGGCACGTGCCACTGG + Intronic
1135845538 16:25915051-25915073 GGGACCTGAGTGAATGCCACTGG - Intronic
1136343657 16:29661878-29661900 GACTCCTGGGTGAGAGCCACAGG - Intergenic
1136655337 16:31706054-31706076 GGTCCCTGAGTGGGTGCCCCTGG - Intergenic
1137910970 16:52378030-52378052 GCAACCTAGATGAGTGCCACAGG + Intergenic
1138551842 16:57752727-57752749 GGGACCAGGCTGGGTGCCACAGG + Intronic
1139088501 16:63617308-63617330 AGTCCCGCGGTGAGTGCCACTGG - Intergenic
1139143183 16:64293053-64293075 GGTTCCTGGGTGGGGGCCATAGG - Intergenic
1141336794 16:83163521-83163543 TGGACATGGGTGAGTGCCAATGG - Intronic
1142065654 16:88060901-88060923 GGTCCATGGGGGAGCGCCACAGG + Intronic
1143014464 17:3884225-3884247 GGTACCTGGGTACTTCCCACAGG + Intronic
1143048659 17:4103806-4103828 GGTACTCGGGAGAGTGACACAGG + Intronic
1148693652 17:49546704-49546726 GGGGCCTGGGTGAGGGCCAGTGG - Intergenic
1150689153 17:67348882-67348904 GCTACTTGGGAGGGTGCCACAGG + Intronic
1151277388 17:73045885-73045907 GGTTGGTGGCTGAGTGCCACGGG - Intronic
1160521423 18:79510466-79510488 GGCACCTGCGTGGTTGCCACAGG + Intronic
1160994422 19:1876076-1876098 GGTACCTGGCTGGGTCCCAGCGG + Intergenic
1161332388 19:3694507-3694529 GGTGTCCAGGTGAGTGCCACCGG - Intronic
1162765298 19:12915731-12915753 GGTACAGGGGTGAGTGCAAGGGG - Intronic
1163497655 19:17655979-17656001 GGGGCCTCGGTGGGTGCCACTGG + Exonic
1166264116 19:41666509-41666531 AGTTCCTGGGTGAGGGTCACAGG + Intronic
1166844438 19:45718086-45718108 GGTACCTGGGTGTTTTCCAGAGG - Intronic
1166873545 19:45884457-45884479 GGTCCTTGGGTGAGTGGCCCAGG + Exonic
1168271610 19:55253034-55253056 GTAACCTGGGTGAGTGCCCCAGG - Intronic
925348618 2:3186996-3187018 GGCACCTGGGTGAGTGGATCAGG - Intergenic
925546209 2:5019648-5019670 GGAAAATGGGTGAATGCCACTGG + Intergenic
925964806 2:9054299-9054321 GGTACCTTGATCAGTGCCAAAGG + Intergenic
925993603 2:9273701-9273723 AGTTCCTGGGTGGGGGCCACAGG + Intronic
926752306 2:16207795-16207817 GTTCCCTGGGTGGGGGCCACAGG + Intergenic
929992669 2:46802916-46802938 GGCACCTGTGTGAAGGCCACAGG + Intergenic
932280663 2:70489174-70489196 GGTGCCTGGCTCTGTGCCACAGG + Intronic
935084103 2:99827825-99827847 GGTACAAGGGTGAGTGAAACAGG - Intronic
938549907 2:132370555-132370577 GGAGCCTGGGCGAGTGCCCCTGG + Intergenic
938758954 2:134406444-134406466 TGTTCCTAGGTGAGTCCCACAGG - Intronic
941553962 2:166952211-166952233 TGTAGCTGGGTGAGTGACCCTGG - Intronic
941760729 2:169239910-169239932 TGCACTTGGGTGAGTTCCACAGG + Intronic
945192167 2:207200184-207200206 GGTCCGTGGGTTACTGCCACTGG - Intergenic
948272212 2:236683352-236683374 GGTTCCTGGGCCAGTGTCACTGG + Intergenic
948309480 2:236974381-236974403 AGTTCCTGGGTGAGGGCCATAGG - Intergenic
1172801946 20:37582004-37582026 GATACTTGGGGGACTGCCACAGG + Intergenic
1173663812 20:44751736-44751758 GGGAAGTGGCTGAGTGCCACGGG - Exonic
1173901471 20:46592785-46592807 GGTACCTGAGTGAGTGAAACAGG + Intronic
1174484567 20:50852983-50853005 GGGTTCTGGGTGAGTGCCAAGGG + Intronic
1174940176 20:54918331-54918353 GGTTCCTGGGTGGGGGCCACAGG + Intergenic
1176081881 20:63277634-63277656 GGTGCCAGGGCCAGTGCCACAGG - Intronic
1177549384 21:22600275-22600297 GGTTCCAGGGTGAGGGCCACAGG + Intergenic
1180957636 22:19747992-19748014 GGCATCAGGGTGAGTGACACTGG + Intergenic
949509388 3:4755023-4755045 TGTTCCTGGGTCAGAGCCACAGG + Intronic
953500054 3:43424573-43424595 AGTTCCTGGGTGAGGGCCACAGG - Intronic
954613317 3:51957538-51957560 GGTAGCTGGGGGAGTGGCATGGG - Exonic
956714773 3:72069311-72069333 GGTACCTGAGTGAGTGGGAGAGG - Intergenic
960596051 3:119409249-119409271 GGTCCCTGGTTGAGAACCACCGG + Intronic
966934863 3:184699510-184699532 AGTTCCTGGGTGGGGGCCACAGG + Intergenic
967068724 3:185943423-185943445 GATTCCTGTGTGTGTGCCACAGG + Intergenic
968228223 3:196989213-196989235 GGCACCAGGCTTAGTGCCACCGG - Intronic
970086607 4:12354859-12354881 GGTACCTGGGTAGATCCCACAGG - Intergenic
971238360 4:24864431-24864453 GGTTCCTGGGTGAGGGTCACAGG - Intronic
972661421 4:41120320-41120342 GGGACCTGGGTGAGTGAGCCAGG - Intronic
974495813 4:62625178-62625200 GGTATATTAGTGAGTGCCACGGG + Intergenic
975416076 4:74106068-74106090 GCTTCCTGGCTGTGTGCCACAGG - Intergenic
976746569 4:88408986-88409008 AGTTCCTGGGTGGGGGCCACAGG + Intronic
984606020 4:181787002-181787024 GGGACATGAGAGAGTGCCACAGG - Intergenic
984980188 4:185273081-185273103 TGCACCTGGTTGAGAGCCACTGG + Intronic
989754472 5:44936068-44936090 GGGGCCTGGAAGAGTGCCACAGG + Intergenic
990463203 5:56048273-56048295 GGAGCCTGGGTGAGTGCCTTTGG - Intergenic
995398946 5:111718970-111718992 TCTACCTGGATGATTGCCACAGG + Intronic
997846034 5:137286715-137286737 GGTACCTGGGTCCCTGTCACTGG - Intronic
1001090516 5:168736803-168736825 GGGACCTGGGTTTCTGCCACAGG + Intronic
1003080541 6:3017565-3017587 GGTGCCTGCGTGAGTGTCCCTGG + Intronic
1003819420 6:9879147-9879169 AGTTCCTGGGTGGGGGCCACAGG - Intronic
1006167080 6:32071312-32071334 AGAACCTGGGTGAGAGTCACAGG + Intronic
1007584694 6:42982153-42982175 GGTACCTGGGTAAGGGACACAGG + Intergenic
1008603249 6:53116274-53116296 GGGACCTAGGTAAGTGTCACTGG + Intergenic
1011486008 6:87842141-87842163 GGTTCCTGGGTAGGGGCCACAGG + Intergenic
1012067765 6:94571075-94571097 GGTAGCAGCGTGAGTGACACTGG + Intergenic
1012307340 6:97675110-97675132 GGTACCTGGGTGTGTGGGATTGG + Intergenic
1012618097 6:101302781-101302803 AGTTCCTGGGTGGGGGCCACAGG - Intergenic
1014763205 6:125381056-125381078 AGTTCCTGGGTTAGTGTCACAGG - Intergenic
1017927128 6:158920394-158920416 AGTTCCTGGGTGGGGGCCACAGG - Intergenic
1019266051 7:117945-117967 GGGATCTGCGTGAGTGCCCCCGG - Intergenic
1019277343 7:182605-182627 GGGATCTGCGTGAGTGCCCCCGG - Intergenic
1019290124 7:246176-246198 GGCAGCTGGGTCAGGGCCACGGG + Intronic
1022185292 7:27961429-27961451 GGTGTGTGGGTGAGTGGCACAGG + Intronic
1023402369 7:39799808-39799830 GGCTCCTGGGAGAATGCCACAGG + Intergenic
1024647249 7:51380857-51380879 GGCTCCTGGGAGAATGCCACAGG - Intergenic
1025259188 7:57405777-57405799 GGTACCTCCGTGAGTGCCGGGGG - Intergenic
1025609662 7:63067376-63067398 GGTACCTCCGTGAGTGCCGGGGG + Intergenic
1027579472 7:79976145-79976167 GGTTCCTAGGTGGGGGCCACAGG + Intergenic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1031922785 7:127613811-127613833 GGTCCCTGGGTGGGTACCCCGGG + Exonic
1037890865 8:22623107-22623129 GGGACCTGGCAGGGTGCCACGGG + Intronic
1038648625 8:29382195-29382217 GGCACCTGTCTGAGTGACACAGG - Intergenic
1039301729 8:36216761-36216783 AGTTCCTGGGTGGGGGCCACAGG - Intergenic
1042281104 8:67056980-67057002 AGTACCTGGCAGAATGCCACAGG + Intronic
1043428599 8:80172722-80172744 AGTGCTGGGGTGAGTGCCACAGG - Intronic
1043586558 8:81777040-81777062 TCTAGCTGTGTGAGTGCCACAGG + Intergenic
1046667072 8:117015861-117015883 GGTACATTGGGGAGAGCCACAGG + Intronic
1049587682 8:143439724-143439746 GGGGCCTGGGTGAGTCCCACGGG - Intronic
1049859833 8:144890750-144890772 GGTACTTGTGTGAGGGCCTCAGG - Intronic
1051242180 9:15069964-15069986 GGTACCTGGGACAGTGAGACGGG + Intergenic
1051753472 9:20369063-20369085 GGGACATGGGTGAGTGGGACAGG + Intronic
1053450168 9:38187078-38187100 AGTTCCTGGGTGGGGGCCACAGG - Intergenic
1059535277 9:115074925-115074947 GGAACCTGGGTGATGGGCACAGG + Intronic
1061057635 9:128232835-128232857 GATGCCAGGGTGAGTGGCACAGG - Intronic
1061402446 9:130375858-130375880 GGTACCTGTGTGGGGGCCAGTGG - Intronic
1061607096 9:131718817-131718839 GCTAGCTGGCTTAGTGCCACGGG + Intronic
1061991117 9:134159282-134159304 GGTGCCTGGGTCTGTCCCACGGG + Exonic
1062292935 9:135805502-135805524 GGGTGCTGGGTGAGTGCCAGTGG - Intergenic
1062678671 9:137763955-137763977 GGCACCAGGGTGAGGGCCATGGG - Intronic
1192182134 X:68922712-68922734 ATTTCCTGGGTGAGTGCCATGGG - Intergenic
1193432581 X:81427459-81427481 GTTATTTGTGTGAGTGCCACAGG + Intergenic