ID: 1091020150

View in Genome Browser
Species Human (GRCh38)
Location 11:132092314-132092336
Sequence GAGGCCAGGCACTCTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 1, 2: 0, 3: 42, 4: 331}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091020150_1091020156 3 Left 1091020150 11:132092314-132092336 CCTTCCTCAGAGTGCCTGGCCTC 0: 1
1: 1
2: 0
3: 42
4: 331
Right 1091020156 11:132092340-132092362 CCTGCCACTCCACTGAAAATGGG 0: 1
1: 0
2: 0
3: 11
4: 162
1091020150_1091020159 27 Left 1091020150 11:132092314-132092336 CCTTCCTCAGAGTGCCTGGCCTC 0: 1
1: 1
2: 0
3: 42
4: 331
Right 1091020159 11:132092364-132092386 GATCTCACCAAGATGACCACTGG 0: 1
1: 0
2: 0
3: 6
4: 88
1091020150_1091020154 2 Left 1091020150 11:132092314-132092336 CCTTCCTCAGAGTGCCTGGCCTC 0: 1
1: 1
2: 0
3: 42
4: 331
Right 1091020154 11:132092339-132092361 TCCTGCCACTCCACTGAAAATGG 0: 1
1: 0
2: 0
3: 24
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091020150 Original CRISPR GAGGCCAGGCACTCTGAGGA AGG (reversed) Intronic
900093819 1:932304-932326 GAGGCCAGGCAGACGGAGGAGGG - Intronic
900405024 1:2489155-2489177 GAGGCCAGGGCCTCAGAGGATGG - Intronic
900911383 1:5599248-5599270 GGGCCCAGCCACTCTGAGGCTGG + Intergenic
901020800 1:6254417-6254439 GAGGGCAGGCAGGCTCAGGAGGG - Intronic
901552501 1:10005965-10005987 GAGCCCTGGGACTCTGAGGAAGG - Intronic
901876592 1:12170151-12170173 GTGGCCAGGCACCCTGAGGCAGG + Intronic
902038327 1:13473709-13473731 GAGGCCCGACACACTGGGGAGGG - Intergenic
902082501 1:13830710-13830732 GAGGCCTGGCCCTCTGAATAGGG - Intergenic
903280162 1:22245700-22245722 GAGGCCAGGCTCTCTCAGAGGGG + Intergenic
903660058 1:24971533-24971555 GGGGCCTGGAACTCTGAGGGAGG - Intergenic
903665707 1:25006292-25006314 GAGGCCAGGCCCTCAGAGCACGG + Intergenic
903995874 1:27305220-27305242 GAGGGCAGGGACTCTGTGGAAGG + Intronic
904859525 1:33524949-33524971 GAAGCCAGTCACTCTGAGCATGG + Exonic
904966468 1:34378220-34378242 GAGGCCAGGCATAGAGAGGAAGG - Intergenic
905287211 1:36889343-36889365 GAAGCATGGCACCCTGAGGAGGG + Intronic
905747746 1:40433753-40433775 GAGGCCATGTATCCTGAGGAAGG + Intergenic
906225845 1:44120461-44120483 GAGGCCAAGCATTCTAAGAAGGG + Intronic
906728863 1:48064232-48064254 GAGGTCAGGCAGGCTGAGCAGGG + Intergenic
908063342 1:60375166-60375188 GAGTCCAGGCAGTATGAGGTGGG + Intergenic
908248575 1:62247266-62247288 CCGGCAAGGCACTCTGAGGAGGG + Intronic
908439982 1:64143683-64143705 GACGCCAGGGACCCTAAGGAGGG + Intronic
909395395 1:75166071-75166093 GAAATCAGGCACTCTGAGGCCGG + Intergenic
909409695 1:75335872-75335894 AAGGACGGGCACTCTGAGGCTGG - Intronic
909949079 1:81697834-81697856 CAGGAAATGCACTCTGAGGAGGG - Intronic
912262289 1:108121945-108121967 GCTGCCTGCCACTCTGAGGAGGG - Intergenic
912728635 1:112081561-112081583 CATGCCAGGCACTCTGATAAGGG + Intergenic
912744922 1:112238221-112238243 GAGGCCACCCACACTGAGAAGGG - Intergenic
912761526 1:112371528-112371550 GAGGACAGGCTATCTGATGAGGG - Intergenic
913518107 1:119622405-119622427 AGGACCAGGCACTTTGAGGAAGG - Exonic
914846137 1:151284339-151284361 AGGGCCAGGCACTCTGGGGAAGG + Intronic
916058532 1:161083881-161083903 GAGGCCAGGCTCACATAGGAAGG - Intronic
917220837 1:172727289-172727311 ATGGCCAGGCAGTCTTAGGAGGG - Intergenic
918786378 1:188769279-188769301 GAGGCCCTGCCCTTTGAGGAGGG - Intergenic
918802246 1:188986708-188986730 GAGGCCCTGCTCACTGAGGAAGG + Intergenic
919626408 1:199914737-199914759 GGGGCCAGGCAGGCTGAGGCCGG + Intergenic
920512906 1:206564126-206564148 GAGGCAAGGGACTCTCAGCAGGG - Intronic
921070459 1:211654131-211654153 GAGTCCAGGCAGTGGGAGGAGGG + Intergenic
921836014 1:219779533-219779555 GAGTCCAGGCACAATGAGGAGGG + Intronic
922082273 1:222308728-222308750 GAGGCAGGGCAGGCTGAGGAGGG + Intergenic
922133811 1:222805703-222805725 GGTGCCTGGGACTCTGAGGAGGG + Intergenic
923373111 1:233332348-233332370 CAGGGAAGGCACTCCGAGGAAGG + Intronic
924474241 1:244369219-244369241 GAGGCCTGTCACTCAGAGAAGGG + Intronic
924558007 1:245133669-245133691 GATGCCAGGGGCTCTGGGGAGGG + Intergenic
1063051813 10:2457744-2457766 GAGGAGAGGCACCCTGAGGAGGG + Intergenic
1063865719 10:10363385-10363407 GAAGACAGTCACTCTGAGGGCGG + Intergenic
1064253692 10:13726583-13726605 GAGCTCAGAAACTCTGAGGATGG - Intronic
1064957367 10:20925548-20925570 CAGGCCAGCCACTCTGAAAAAGG - Intronic
1065844417 10:29733731-29733753 GCAGCCAGGCACGCTGATGAGGG - Intronic
1065862940 10:29886694-29886716 GAGGCCAGGTACTGTGGTGAGGG + Intergenic
1067293805 10:44962941-44962963 AGGGCCAGGCTCTCAGAGGAAGG + Intronic
1067744292 10:48923842-48923864 GAGGCCAAACACACTGAGCATGG + Intronic
1067769007 10:49110142-49110164 GAGGCCAGGAGAGCTGAGGAAGG + Intronic
1067833226 10:49622049-49622071 GAAGCCAGGCCCTGGGAGGAAGG + Intronic
1070124025 10:73605815-73605837 GTGGCTAGGCACTTTGGGGAAGG + Intronic
1070831308 10:79419661-79419683 GAGGCCAGTCCCTCTGAGCTTGG + Intronic
1071330063 10:84550146-84550168 GAGGCCAGGCTCCCTGAGAAGGG - Intergenic
1072072053 10:91927578-91927600 GGAGCCAGGCATTCTGAGCATGG - Intronic
1072241321 10:93497761-93497783 GAGGGAAGGCATGCTGAGGAAGG + Intronic
1072982908 10:100114796-100114818 GAGGCCAAGCACACTGCGGCCGG - Intergenic
1073069175 10:100782547-100782569 GAGGCCAGGCCCCCAGCGGAAGG + Intronic
1073181487 10:101586144-101586166 GAGCTCAGCCACTCTGTGGAAGG + Exonic
1073547450 10:104362973-104362995 AAGACAAGGCACTCTGAGCATGG - Intronic
1074136799 10:110634834-110634856 AAGCCCAGGTACTATGAGGATGG + Intergenic
1075688796 10:124381602-124381624 GAGGCCAGGGATGCTGAGGCGGG - Intergenic
1076451739 10:130561206-130561228 GAGGACACGCACTCTGAGAATGG - Intergenic
1076451869 10:130561713-130561735 GAGGACATGCACCCTGAGAATGG - Intergenic
1076476104 10:130752561-130752583 GAGGCCACTCACGCTGGGGACGG - Intergenic
1076804022 10:132846276-132846298 GAGGCCTTGCACCCTGCGGAGGG + Intronic
1078068626 11:8094211-8094233 GAGGCCAGGCCTGCTGGGGAGGG - Intronic
1078118511 11:8480989-8481011 GAGGACAGGCACTCTGACTATGG - Intronic
1078466629 11:11554873-11554895 GAGCCCAGGGTCTCTGAGCAGGG + Intronic
1079599702 11:22295686-22295708 GAGGTCATGCACATTGAGGAAGG + Intergenic
1081725197 11:45322992-45323014 GACGCCAGGCTCGCTGGGGAAGG - Intergenic
1081773690 11:45664478-45664500 AAGGCCAGGCTGCCTGAGGAAGG - Intronic
1082934058 11:58638443-58638465 CAGGCCAGGTACTATGGGGAAGG + Intergenic
1083300786 11:61738755-61738777 GTGGCCAGGCACACTGAGGCAGG + Intronic
1083791298 11:64988085-64988107 CAGGACAAGCACTCTGAGGCGGG - Exonic
1085267461 11:75245738-75245760 GAGGCCAGGCACAAAAAGGATGG - Intergenic
1086192744 11:84098685-84098707 TGGGCCAGGCACTGTGAGGAGGG - Intronic
1086243201 11:84720707-84720729 GAAGCCAGGCACTTAGAGGAGGG + Intronic
1088311693 11:108467236-108467258 GAGGAAAGGAGCTCTGAGGAAGG + Intronic
1090667146 11:128922041-128922063 AAGGCCAGGAGCTCTGGGGATGG + Intergenic
1091020150 11:132092314-132092336 GAGGCCAGGCACTCTGAGGAAGG - Intronic
1091207469 11:133831577-133831599 GACTCCTGGCATTCTGAGGAGGG - Intergenic
1091215459 11:133898765-133898787 GAGTCCAGGGACTGGGAGGAAGG - Intergenic
1092215517 12:6679062-6679084 GAGGGCAGGGACACTGAGGCAGG + Exonic
1092767913 12:11869825-11869847 CAGTCCAGGCTCTCCGAGGACGG + Exonic
1092777403 12:11956095-11956117 GAGGACAGACAAACTGAGGAAGG - Intergenic
1094047138 12:26179431-26179453 GGAGCCAGGCACTCTGAAGGGGG + Intronic
1094583583 12:31756954-31756976 AAGGCCAGGCACACAGAAGATGG + Intergenic
1095991636 12:48038638-48038660 GAAGCCAGAGACTCTGAGGTAGG + Intergenic
1096252267 12:50040811-50040833 CAGGCCAGCCACTCTGGAGAGGG + Intergenic
1097455719 12:59796307-59796329 GAGGCCCTGCCCACTGAGGAGGG - Intergenic
1101417823 12:104523853-104523875 GTGCCTAGGCACTTTGAGGAAGG + Intronic
1101632166 12:106505682-106505704 GAGAAAAGGCACTCTGGGGAGGG - Intronic
1102231237 12:111263952-111263974 GAGGCCAGGCACTCTGTATAGGG + Intronic
1102436831 12:112930592-112930614 GAGGCCAGTGAGGCTGAGGAGGG - Intronic
1104087911 12:125492958-125492980 AATACCAGGCACTCTGAGAAAGG + Intronic
1104770021 12:131355764-131355786 GAGGCCAGGCAGGCTTTGGAAGG + Intergenic
1104981009 12:132573123-132573145 AAGGCCAGGAACAGTGAGGAGGG - Intronic
1105241271 13:18611040-18611062 GGGGCCAGGGGCTCTGAGCATGG - Intergenic
1105591858 13:21799804-21799826 GAGCCCAGGACCTCTGGGGAGGG + Intergenic
1109097272 13:58134217-58134239 GAGGCCCTGCACAGTGAGGAGGG + Intergenic
1109763981 13:66869151-66869173 GGGGCCAGGAACTGTGATGAAGG - Intronic
1113133971 13:107068631-107068653 GAGGCCAGAGACTGTGAGGAAGG - Intergenic
1113457811 13:110461430-110461452 GAGCCCAGGGACACTGAAGATGG + Intronic
1115115704 14:29879080-29879102 GAGGCCAGGCAGGCTGAAGGTGG - Intronic
1115165837 14:30447968-30447990 TAGGCCAGGCACTCTTCAGAAGG - Intergenic
1119171182 14:72537429-72537451 GAGGCCATGGAGTCTGAGAAAGG + Intronic
1119543678 14:75456850-75456872 GAGAGCAGGCTGTCTGAGGAGGG + Intronic
1121069132 14:91000444-91000466 GATGCCAAGTACTCTGTGGAGGG - Intronic
1121121253 14:91377129-91377151 CAGGGCAGGCAGTCTGAGGTGGG - Intronic
1121439111 14:93937633-93937655 GAGGCCTGGGACTCTGAGTCAGG + Intronic
1122227399 14:100287632-100287654 GAGGCCAGGAATTCGGAGGGGGG - Intergenic
1122446646 14:101774504-101774526 GAGGCCACGCACTCAGAGACTGG - Intronic
1122817180 14:104319536-104319558 GAGGCCAGAGACACTGGGGAGGG - Intergenic
1124110298 15:26779296-26779318 GAGTCCAGGCAGTGTGAAGACGG + Intronic
1124159301 15:27254292-27254314 GAGGCCAGGGACTCTCGAGAAGG + Intronic
1124854473 15:33373999-33374021 GATTCCAGGCACTGTGAGGAAGG - Intronic
1125591301 15:40856153-40856175 TACTCCAGGCGCTCTGAGGATGG - Intronic
1128337656 15:66797745-66797767 GAAGCCAAGCACACTGAGGCTGG + Intergenic
1128556265 15:68633952-68633974 CAGGCCAGGCACTCTGAACACGG + Intronic
1128675786 15:69607571-69607593 GAGGCCAGGCATTCTGGGAAAGG - Intergenic
1128924429 15:71641459-71641481 TAGTCCAGGTACTGTGAGGAAGG + Intronic
1129275228 15:74441021-74441043 GATGCCAGGCACTCAGAGCTGGG - Intergenic
1129604590 15:77018688-77018710 GAGGCCAGGTTCTGTGAGGGAGG + Intronic
1129787752 15:78320733-78320755 GAGGCTGAGCACTCCGAGGATGG + Intergenic
1130794050 15:87189758-87189780 GAGACCAGGGCATCTGAGGATGG - Intergenic
1131101788 15:89696866-89696888 CAGGACAGCCACTCTGAGAAAGG - Intronic
1131838404 15:96412614-96412636 AGGACCAGGCACTCTGAGGAAGG + Intergenic
1132111451 15:99105042-99105064 GAGCCCAGGCACTTAGCGGACGG - Exonic
1137050638 16:35710806-35710828 GATTCCAGGCATTCTGATGATGG - Intergenic
1137384610 16:48030064-48030086 GAGTCCCAGCACTCAGAGGAAGG - Intergenic
1137725481 16:50653933-50653955 GGGGCCAGGAACTTTGAGGAGGG + Intergenic
1138117132 16:54369721-54369743 CAGGCCAGCCCCTCTTAGGAAGG + Intergenic
1138422677 16:56909772-56909794 GAGCCCAGAAATTCTGAGGAAGG + Intronic
1139027879 16:62841524-62841546 GAGGGAAGGCACAGTGAGGATGG + Intergenic
1140400367 16:74666449-74666471 GAGGCTAGGCTCTCGGGGGAAGG + Intronic
1140410096 16:74736183-74736205 GGGGCCAGGAGCTCTGAGCAAGG + Intronic
1140477343 16:75245492-75245514 GAGGCCGGGGGCTCTGTGGAGGG + Intronic
1140478466 16:75250518-75250540 GAAACCAGGGACTCTCAGGAGGG + Intronic
1140888033 16:79261625-79261647 GAGGCCAGGGACACTGCAGAGGG + Intergenic
1141057573 16:80832794-80832816 GCAGCCAGGCACTCTCAGAACGG + Intergenic
1141103746 16:81216283-81216305 GAGGTCACCCACTCAGAGGAAGG + Intergenic
1141460593 16:84176625-84176647 GAGGCCAGGGATGGTGAGGAGGG - Intronic
1141577413 16:84973070-84973092 GAAGCCAGGCCCTCTCAGCAGGG + Intergenic
1142885800 17:2911552-2911574 GACGGCAGGCTCTCTGAGGGTGG - Intronic
1143265599 17:5634757-5634779 GAGGCCATGCATGCTGAGGCCGG - Intergenic
1143615357 17:8046279-8046301 GAGGCCTGGCGCTCAGAGGTGGG + Intronic
1143836884 17:9699957-9699979 GAGGGGAGGCACTGTGAGGTTGG + Intronic
1146056403 17:29583497-29583519 GAGGCCAGGCGCTGTGGCGAAGG + Exonic
1146322865 17:31859861-31859883 GAGGTTAGGCACTGTGGGGAAGG - Intergenic
1146944775 17:36866137-36866159 GAGGCCAGGCAGGCTGAGCAAGG - Intergenic
1147250090 17:39147979-39148001 GAGGTGGGGCTCTCTGAGGAGGG + Intronic
1147438326 17:40431519-40431541 GAGGCTAGGGTCTCTGAGGAGGG + Intergenic
1147497015 17:40926434-40926456 GAGGCCATGGACTCCGAGGAAGG - Intronic
1147819649 17:43234206-43234228 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147820957 17:43241601-43241623 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147821765 17:43246093-43246115 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147822857 17:43252248-43252270 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147824431 17:43261395-43261417 GTGGCCAGGCCCCCTGTGGAAGG + Intergenic
1147825375 17:43267052-43267074 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147826498 17:43273519-43273541 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147827387 17:43278397-43278419 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147828495 17:43284558-43284580 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147829604 17:43290710-43290732 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147831381 17:43300460-43300482 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1148697155 17:49567546-49567568 CAGGCCCGGCACTCTCTGGAGGG - Intergenic
1148804148 17:50255884-50255906 GAGCCCAGGATCGCTGAGGAGGG - Intergenic
1148847117 17:50535936-50535958 GAGGCCATGCACTCTTAGGTGGG + Intronic
1150580444 17:66468999-66469021 AAGGCCATGGACTCTGAGAATGG + Intronic
1151301586 17:73231418-73231440 GAGGCCAGGCTCCCTCGGGAAGG + Intronic
1152123863 17:78434880-78434902 GGGGCCAGGCACTCTGTGTGGGG + Intronic
1152340993 17:79724771-79724793 GAGGTCAGGCTCTCTGAAGCAGG - Intergenic
1152381089 17:79942551-79942573 CAGGCCAGGCCTTCTGAGGAAGG - Intronic
1153810698 18:8749378-8749400 GAGGCCAGGCTGGCTGCGGACGG + Intronic
1153858396 18:9173799-9173821 GAGTCCAGGCAGTCTGGGCAAGG - Intronic
1155513126 18:26597164-26597186 GAGCCCAGGCAAGTTGAGGAGGG + Intronic
1159599060 18:70411346-70411368 GAGGAAAGGCCCTATGAGGACGG + Intergenic
1160627719 18:80224006-80224028 GAGGGCAGGCACTCCGAACAGGG + Intronic
1161120149 19:2521308-2521330 TAGGCCAGGCCCTCTGGAGAAGG + Intronic
1162721575 19:12665926-12665948 GAGGCCAGGCCCTCCCAGGCAGG + Intronic
1163572280 19:18089692-18089714 GAGTCCAGGGGCACTGAGGAGGG + Intronic
1163712489 19:18855046-18855068 GAGGCCCCGCGCGCTGAGGACGG - Intronic
1163836584 19:19578606-19578628 GAAGCCTGGCAGTTTGAGGAGGG - Intronic
1164373281 19:27660032-27660054 AAGGCCAGGCACTCTAATGATGG - Intergenic
1164505774 19:28860102-28860124 GAGGCCAGCCACACGGAAGAGGG + Intergenic
1165308817 19:35018649-35018671 GAGGCCAGACACTCAAGGGAAGG + Intronic
1165321691 19:35089324-35089346 CAGGTCAGGCATTCTGAGGGTGG - Intergenic
1166562072 19:43739518-43739540 GAGGATAGGCAGTCTGAGGGAGG + Intronic
1166635088 19:44444219-44444241 GAGGCCAGGCAAGGTGGGGAAGG - Intronic
1166783012 19:45352106-45352128 GAGGACAGGCAGGCTGAGGGTGG + Intronic
1166996780 19:46723197-46723219 GAGGCCAGGCGCTGGGAGGTGGG + Exonic
1167363441 19:49042520-49042542 GAGGCCAATAACTCTGAAGAAGG + Intergenic
1167365055 19:49050408-49050430 GAGGCCGATAACTCTGAGGAAGG - Intergenic
1167967492 19:53159080-53159102 GAGCCCGGGCACTCTGGGGGCGG + Intergenic
1168539561 19:57198854-57198876 GAGGCCAGGTCCCTTGAGGAAGG - Intronic
925337967 2:3112416-3112438 GAGTCCAGGAGCTCAGAGGAGGG - Intergenic
925351426 2:3203689-3203711 GAGGCCAGCCGCTCTGGGGCAGG - Intronic
925429446 2:3778455-3778477 GAGGGCAGGCAGGCTGTGGAGGG + Intronic
925848182 2:8052503-8052525 GAGCCCAAGCAGGCTGAGGAGGG + Intergenic
925912157 2:8581074-8581096 GAGGACAGGGACTCTCAGCAGGG + Intergenic
926085352 2:10016439-10016461 GAGCCCAAGGACTCTGAGTATGG - Intergenic
926573304 2:14553382-14553404 GGGGCCAGGCAGCCAGAGGAGGG + Intergenic
927864078 2:26577622-26577644 GAGGGCAGGCACTCACAGGACGG - Exonic
927864281 2:26578767-26578789 GTGGCCAGGCAACCTGAAGAAGG - Intronic
927963928 2:27257680-27257702 TGGGCCAGCCACTCTGATGAGGG - Intronic
928730432 2:34225564-34225586 GAGACAAGACACTGTGAGGAGGG + Intergenic
929785731 2:44989723-44989745 AAGGCCACCCACACTGAGGACGG - Intergenic
931458859 2:62433183-62433205 CAGGCCAGGCACTCTCTGCATGG - Intergenic
932442149 2:71744227-71744249 ATGGGCAGGGACTCTGAGGAAGG - Intergenic
932584900 2:73021626-73021648 GAGGCCAGGCTCTCTGGGGGTGG + Intronic
933767650 2:85721236-85721258 GAGAACAGGCACTTTGAGGCTGG + Intergenic
934158006 2:89221233-89221255 GGGGCAAGTGACTCTGAGGAAGG + Intergenic
934209259 2:89961191-89961213 GGGGCAAGTGACTCTGAGGAAGG - Intergenic
935131685 2:100265426-100265448 GAGGCCATGCGCTCTGTGAAAGG + Intergenic
937093327 2:119221058-119221080 GAGGCAAGGAAGTGTGAGGACGG + Intergenic
938613283 2:132971356-132971378 TAGGCCAGGGTCTCTGGGGAGGG + Intronic
941361491 2:164557260-164557282 GGTGCCAGGCAGCCTGAGGAGGG + Intronic
941827456 2:169916470-169916492 GAGCCCAGGCAGGATGAGGAGGG - Intronic
942453989 2:176125232-176125254 GAAGCCAGGCACTTTCAGGCTGG + Intergenic
942600970 2:177640742-177640764 GAGGCCAGAAACTCAGTGGACGG + Intronic
946189127 2:217998415-217998437 GGGGCCAGGCACTCTAGTGAGGG + Intronic
946394054 2:219434622-219434644 GGGGCCAGGCACACTACGGAGGG + Intergenic
946404470 2:219485021-219485043 GAGCCCAGGGACTCGGCGGAAGG - Exonic
946616499 2:221516179-221516201 GAGGCCAGGCTCTGTGAAAAGGG + Intronic
947534468 2:230932030-230932052 GAGGCCAGGCTGTCTGGGGATGG - Intronic
948780714 2:240320093-240320115 GAGGCGAGGCTCTCCCAGGACGG - Intergenic
948802585 2:240439614-240439636 AGGTCCAGGCCCTCTGAGGATGG - Intronic
948873758 2:240816976-240816998 GAGGCCAGCCAGGCTGAGGGTGG + Intronic
1168802404 20:652098-652120 GAGGCCAGTGACTCTGACCAAGG + Intronic
1169145217 20:3248142-3248164 GAGGCCAGGAAACCTGAGGATGG - Intergenic
1169394086 20:5214475-5214497 AAGACCAGGCACTCTGGGTAGGG + Intergenic
1170801432 20:19593740-19593762 GAGGACAGCCACACTGTGGAGGG - Intronic
1172306228 20:33882611-33882633 GAGGCCAGGCACTAGCTGGATGG + Intergenic
1173136548 20:40443823-40443845 GAGGCCAGGCCCTCTCAGCTTGG - Intergenic
1173931915 20:46827831-46827853 GAGGCCATGTACCCTGAGGTGGG - Intergenic
1174268841 20:49351951-49351973 GAGGCCAGCCAGACTGAAGAAGG - Intergenic
1174899901 20:54488381-54488403 AAGGCAAGTCATTCTGAGGAAGG - Intronic
1174986908 20:55465144-55465166 GGGACCAGGGACTCTCAGGATGG + Intergenic
1175239822 20:57538792-57538814 GGGGACACCCACTCTGAGGAAGG + Intergenic
1175295157 20:57903272-57903294 GATTCCAGGGCCTCTGAGGAAGG + Intergenic
1175418338 20:58816176-58816198 GAGGCCAGGGGCGCTGGGGAAGG - Intergenic
1176013087 20:62910981-62911003 GAGGCCAGTGACACTGTGGAGGG - Exonic
1176428384 21:6562326-6562348 GAGCCCAGGCACTGAGAGGTGGG + Intergenic
1178244530 21:30937829-30937851 AAGGCCAGACACTGTGTGGAGGG - Intergenic
1178807456 21:35851325-35851347 GAGGCCAGCCTCTCTGGGGACGG + Intronic
1179523676 21:41961719-41961741 GAAGCCAGAGACTCTCAGGAAGG + Intergenic
1179703874 21:43170642-43170664 GAGCCCAGGCACTGAGAGGTGGG + Intronic
1180020976 21:45126826-45126848 AAGCCCAGCCACTTTGAGGAGGG - Intronic
1180025845 21:45161611-45161633 GATGCCATGCACACTGTGGATGG + Intronic
1180056196 21:45360336-45360358 AAGGCCAGGCACTCTGACACGGG + Intergenic
1180184500 21:46132738-46132760 GAGGCCGGGCAGCCTGCGGAGGG - Exonic
1181858652 22:25801165-25801187 GAAGCCAGGCACACTGAGAAGGG - Intronic
1184065897 22:42120351-42120373 AGGGCCGGGCACTGTGAGGAGGG + Intergenic
1184383347 22:44160299-44160321 GAGGACAGGGAATCTCAGGAAGG + Intronic
1184610979 22:45602942-45602964 GACGGCAGGCTCTCTGAGGCAGG - Intergenic
1184751564 22:46489296-46489318 GATGCCATGCTCTCTGACGAGGG + Intronic
1184786236 22:46673307-46673329 GAGACCAGGCAGTTTGAGAAGGG + Intronic
1184871047 22:47238697-47238719 GAGGCAGGGTGCTCTGAGGAAGG - Intergenic
1184883899 22:47330205-47330227 GAGCCCAGGCACTGCCAGGATGG - Intergenic
1185238675 22:49728975-49728997 GAGGCCCTGCACGCTGGGGAGGG + Intergenic
949852704 3:8434864-8434886 GGGACCAGGCACTCAGAGGCTGG - Intergenic
950360973 3:12449092-12449114 GAGACAAGGCTCTCTGAAGAGGG - Intergenic
950361761 3:12454401-12454423 GAGGCCAGGCACTTTGTCCAAGG - Intergenic
950678869 3:14571259-14571281 GAGGCCAGGCAATGTGAGTGAGG - Intergenic
950684804 3:14608811-14608833 GAGGCCCTGCAGCCTGAGGAAGG - Intergenic
951352157 3:21619298-21619320 CAAGCCAGTCACTGTGAGGATGG - Intronic
952999804 3:38922216-38922238 GAGGCCAAGCCCTCAGTGGATGG + Intronic
953937457 3:47058194-47058216 GAGGCCAGGCATGATGAGGCAGG + Intronic
953982275 3:47418760-47418782 GAGGGCCGGCACCCTCAGGACGG - Exonic
954035044 3:47846892-47846914 GAAGCCAGGCACCTTGATGACGG - Exonic
955111938 3:55958615-55958637 GAGGCCAGGGGTGCTGAGGATGG - Intronic
955832110 3:63015601-63015623 GAGGCCCTGCCCGCTGAGGAAGG + Intergenic
958971447 3:100615079-100615101 AAAGGCAGGCACTGTGAGGAAGG + Intronic
959707662 3:109354020-109354042 TTGCCCAGGCTCTCTGAGGAGGG + Intergenic
960855822 3:122101120-122101142 GAGGAGAGGGAGTCTGAGGAGGG + Intronic
961534211 3:127559612-127559634 CAGGCCAGGCACGTTCAGGATGG + Intergenic
964669573 3:159210045-159210067 GAGGCCATGAACCCAGAGGAAGG + Intronic
964709349 3:159655447-159655469 GGGGCCAGGCACTATGAGGCTGG + Intronic
965863042 3:173170180-173170202 GAGACCAAGTCCTCTGAGGAAGG + Intergenic
968188731 3:196652029-196652051 GAGCCCTGCCACACTGAGGAGGG + Intronic
968401454 4:301985-302007 GATGCCAGGCACACTGACGAAGG + Intronic
968447927 4:661846-661868 GAGGCCAGGCAGTCGGATGGAGG + Intronic
968891718 4:3372948-3372970 GAGGCCATGGTCGCTGAGGAAGG + Intronic
968943924 4:3653768-3653790 GAGGGCAGGCAGGCAGAGGAAGG - Intergenic
968966519 4:3771644-3771666 GAGCCCAGGCTCTCTGCAGAGGG - Intergenic
969075135 4:4572275-4572297 GAGGCCAGGCAGGATGAGCAGGG - Intergenic
969367215 4:6703461-6703483 GAGCCCAGGCAGGGTGAGGAGGG - Intergenic
970998140 4:22291539-22291561 GTGGGCAGGGCCTCTGAGGAAGG + Intergenic
971173006 4:24252711-24252733 AAGCCCAGGGAATCTGAGGAGGG - Intergenic
973130391 4:46641170-46641192 GAGGCCAGTCACCTTGGGGAAGG - Intergenic
973166218 4:47080698-47080720 GAAGCCAGGCACACTGGGCATGG - Intronic
973861041 4:55065069-55065091 GAGGCCAAGCGCTCTGAGTCAGG + Intergenic
976548857 4:86371347-86371369 GGGCCCAGGCACACTGTGGATGG - Intronic
978064621 4:104381126-104381148 GAGGACAGGCAGTTTAAGGAGGG + Intergenic
980072410 4:128258132-128258154 GAGGCCAGGGACACAGTGGAAGG + Intergenic
980957531 4:139444439-139444461 GAGGCCAGTCCCCTTGAGGAAGG + Intergenic
985969158 5:3361810-3361832 GAAGGCAGGCACTCAGGGGAAGG + Intergenic
995206387 5:109486084-109486106 GAGGCCAGGCATATTGAGGCTGG - Intergenic
996409648 5:123144182-123144204 GAGCACAGGCTCCCTGAGGAGGG - Intronic
997929948 5:138064293-138064315 CAGGCCAGGCACTGTGTTGAGGG + Intergenic
998265504 5:140664928-140664950 GAGGAGAGGCCCGCTGAGGATGG + Exonic
1001311777 5:170616311-170616333 TGGGCCAGGCACACTGAGGTGGG + Intronic
1002024776 5:176389321-176389343 GTGGCCAGGCAACCTGAGGAGGG - Exonic
1002459608 5:179366794-179366816 GAGGCCAGGCACTCTGAGTATGG + Intergenic
1006116457 6:31778418-31778440 GAGCCCAGGCGCTTTGAGCAGGG - Intronic
1006132790 6:31878905-31878927 GAGGCCCGGGACCCTGTGGAGGG - Intronic
1006380101 6:33692356-33692378 GAGGCCAGGCGTCCTGAGGGTGG + Intronic
1007253657 6:40513563-40513585 GGTGCCAGGCACTGTGAGCAGGG + Intronic
1009277237 6:61698734-61698756 GAGGCCATGCCCCCTGAGTAGGG - Intronic
1009558242 6:65202958-65202980 GCAGCCAGGCTCTCTGAGGCAGG - Intronic
1011493595 6:87916987-87917009 ATGGCCTGGCACTCTGAGGCAGG - Intergenic
1012795169 6:103750561-103750583 GAGGCAGGGCACGCTGAAGATGG - Intergenic
1013068913 6:106710497-106710519 GACACCAGGCACACTGAGGCAGG - Intergenic
1018469668 6:164084235-164084257 GAGGACATGGACTCTGAGGCGGG - Intergenic
1019029969 6:169001450-169001472 CATGCCAGACACTCTCAGGATGG + Intergenic
1019044283 6:169131290-169131312 GAGTTTAGGCACTCTGTGGAGGG + Intergenic
1019062222 6:169264791-169264813 CAGGGCAGGGGCTCTGAGGATGG + Intergenic
1019698518 7:2461041-2461063 GAGGCCAGGCACTGTGGCCAGGG + Intergenic
1019730800 7:2628345-2628367 GAGGCGGGGCGCTCTGAGGGAGG + Intergenic
1020256713 7:6506492-6506514 CAGGGCAGGGACACTGAGGATGG + Intronic
1022474131 7:30699400-30699422 GATTCCAGGCACTGAGAGGAAGG + Intronic
1022843832 7:34190608-34190630 AAGGTCAGGCAGCCTGAGGATGG - Intergenic
1023504376 7:40884962-40884984 GAGGCCAGGCAAGCTGACCAAGG - Intergenic
1024225934 7:47327036-47327058 CAGGCCAGCCACGCAGAGGAGGG + Intronic
1024364371 7:48504387-48504409 GAGGCCTGGCACTGCGAGGATGG + Intronic
1027141673 7:75662009-75662031 GTGGACAGGGTCTCTGAGGAGGG + Intronic
1033897707 7:146095100-146095122 GAGGACAGGCAAACTGAGCAGGG + Intergenic
1034312410 7:150100321-150100343 GAGGCCAGCTGCACTGAGGATGG - Intergenic
1034536231 7:151727597-151727619 GTGGCCAGTGACCCTGAGGAGGG - Intronic
1034570458 7:151951588-151951610 GAGGCAAAGAAGTCTGAGGATGG + Intergenic
1034677977 7:152905424-152905446 GAGGACAAGCTCCCTGAGGATGG + Intergenic
1034843397 7:154420488-154420510 GTTGCCAGGCACTGGGAGGAGGG + Intronic
1034850157 7:154486079-154486101 GAGGCAAGGTACACTGAGGCAGG - Intronic
1035056636 7:156040448-156040470 GAAGCCAGGCGCTCTGCCGAAGG + Intergenic
1035633701 8:1127593-1127615 GAGGCCAAGCACTGAGAGGAGGG + Intergenic
1035755690 8:2030098-2030120 GAGGCCATCCACACTGTGGAGGG + Intergenic
1037504274 8:19515107-19515129 CAGGAAAGGCACTCTGAGGCTGG - Intronic
1037589419 8:20300737-20300759 GATGGTAGGGACTCTGAGGAAGG + Intronic
1040880760 8:52201762-52201784 CAGCCCAGGGAGTCTGAGGACGG - Intronic
1041188576 8:55328835-55328857 AAGGACAGGTTCTCTGAGGAGGG - Intronic
1041288023 8:56280735-56280757 GAGACCAAGTCCTCTGAGGACGG - Intergenic
1041891694 8:62876823-62876845 GAGGCAAGGAACTTAGAGGATGG + Intronic
1042346013 8:67728825-67728847 GAACCCAGGCAGGCTGAGGATGG + Intronic
1045226316 8:100249584-100249606 GATGCCAGGGACTGAGAGGAAGG + Intronic
1046544470 8:115631580-115631602 TAGGCCTGTCACTGTGAGGAAGG - Intronic
1049206634 8:141366646-141366668 CAGGACGGGCACTCTGAAGAGGG + Intronic
1049554623 8:143275759-143275781 GGGGCCAGGCACCCAGTGGATGG - Intronic
1049574921 8:143385557-143385579 CAGGCCGGGCCATCTGAGGAAGG - Intergenic
1055787982 9:79891590-79891612 GAGGCCAGGCACACAGATAAGGG - Intergenic
1056420079 9:86415885-86415907 TAGGACAGCCTCTCTGAGGAGGG + Intergenic
1056549755 9:87642517-87642539 GAGGCCATCCACACTGAGGAAGG - Intronic
1056775404 9:89508661-89508683 AAGCCCAGGCACACTGGGGAGGG + Intergenic
1056781725 9:89555751-89555773 GAGGCCTGGCAATTTGAAGAAGG + Intergenic
1057883124 9:98808097-98808119 GAGGCCCGGGGCTCTGAGGGCGG - Intronic
1061237251 9:129350349-129350371 GTGGCCAGACACACTGAGCAGGG - Intergenic
1062173601 9:135148783-135148805 TAGGCCAGGTATCCTGAGGAGGG + Intergenic
1062293594 9:135811086-135811108 GATGCCAGGCAGGGTGAGGATGG - Exonic
1062357654 9:136172438-136172460 GAGGGCTGGCACTGTGGGGAGGG + Intergenic
1062577693 9:137216220-137216242 GAGGCCTGGCACTCAGGGGCTGG - Intronic
1062629143 9:137455865-137455887 GAGACCAGGCAGCCTGAGGCTGG + Intronic
1186518342 X:10183999-10184021 GAGCCCAGGCAATCTGCAGATGG - Intronic
1190292354 X:49001312-49001334 GAGGGGAGGAACTCTGAGGGAGG - Intronic
1191254664 X:58274565-58274587 GAGGCCAGGCTTTCAGAGGGAGG - Intergenic
1192190013 X:68985386-68985408 GTGGCCAGGAAAGCTGAGGAAGG - Intergenic
1194032196 X:88831346-88831368 GAGGCCAGGTCCCTTGAGGAAGG - Intergenic
1195177628 X:102326391-102326413 GAGGCCAGGTAGTGTGGGGATGG + Intronic
1195181236 X:102360702-102360724 GAGGCCAGGTAGTGTGGGGATGG - Intronic
1197277135 X:124492819-124492841 GAGGCAGGGAACTCTAAGGAAGG + Intronic
1197934824 X:131729353-131729375 GAAGGCAGGGACTCTGAGCATGG + Intergenic
1201468607 Y:14311361-14311383 TAGGCCTGTCAGTCTGAGGAGGG - Intergenic
1202252543 Y:22888286-22888308 TAGGCCAGGCACACAGATGATGG - Intergenic
1202405532 Y:24522035-24522057 TAGGCCAGGCACACAGATGATGG - Intergenic
1202465248 Y:25148047-25148069 TAGGCCAGGCACACAGATGATGG + Intergenic