ID: 1091021229

View in Genome Browser
Species Human (GRCh38)
Location 11:132101971-132101993
Sequence CTGTAGGAATGGTGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091021229_1091021238 8 Left 1091021229 11:132101971-132101993 CCCATTTCCCACCATTCCTACAG 0: 1
1: 0
2: 2
3: 12
4: 229
Right 1091021238 11:132102002-132102024 GCTGGAAGGTAGAATTGCAATGG 0: 1
1: 0
2: 1
3: 21
4: 210
1091021229_1091021237 -6 Left 1091021229 11:132101971-132101993 CCCATTTCCCACCATTCCTACAG 0: 1
1: 0
2: 2
3: 12
4: 229
Right 1091021237 11:132101988-132102010 CTACAGGTCACACTGCTGGAAGG 0: 1
1: 0
2: 3
3: 13
4: 274
1091021229_1091021235 -10 Left 1091021229 11:132101971-132101993 CCCATTTCCCACCATTCCTACAG 0: 1
1: 0
2: 2
3: 12
4: 229
Right 1091021235 11:132101984-132102006 ATTCCTACAGGTCACACTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091021229 Original CRISPR CTGTAGGAATGGTGGGAAAT GGG (reversed) Intronic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
900906782 1:5564844-5564866 CTGTAGGAAAAGAGAGAAATTGG - Intergenic
901363783 1:8727790-8727812 CTTTAAGAATAGTGGGTAATTGG - Intronic
901819339 1:11816696-11816718 CTGGAGGGATGGTGGGCCATAGG + Intronic
903076342 1:20769951-20769973 CTCTAGGAATGGGGTGAACTAGG + Intronic
904274799 1:29374128-29374150 TTTTGGGAATGGTGAGAAATAGG + Intergenic
904764405 1:32832573-32832595 ATGTAGGAATACTGGGCAATGGG - Intronic
906812446 1:48842209-48842231 TTGCTGGAATGATGGGAAATGGG - Intronic
907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG + Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909488000 1:76195756-76195778 CTGGAGGAATGTTGGGGAGTAGG - Intronic
910051719 1:82982085-82982107 CTGTAGCACTGCTGGGAAATAGG + Intergenic
910340809 1:86184802-86184824 TTGCAGGAATGGTGGGGGATGGG - Intergenic
910368839 1:86494585-86494607 ATGTAGGAATTGTGGGGAAATGG - Intronic
910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG + Intergenic
911099664 1:94085051-94085073 CTGTAGCAATTGGGGGAAAGTGG + Intronic
912972147 1:114293672-114293694 CTGGAGGAAGGCTGGGAAACTGG - Intergenic
914250449 1:145917943-145917965 CTGGAGAAATGGTGAGATATGGG - Intronic
914894348 1:151655220-151655242 CTTTAGGAATGGAGCTAAATTGG - Intronic
915061574 1:153190192-153190214 CTGTATGAAGGGTGGGAGACAGG - Intergenic
916001527 1:160621121-160621143 CAGTAAGGATGGTGGGAAAGTGG + Intronic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916885464 1:169063588-169063610 CAGGAGGTATGGTGGGAAAAAGG - Intergenic
917027397 1:170659292-170659314 CAGAAGGAATGGTTGGAAAGTGG + Intergenic
919763638 1:201113083-201113105 CTGTAGGGATGGGAGGAGATGGG - Intergenic
920406538 1:205717624-205717646 TTGTAGGGAGGGTGGGCAATGGG - Exonic
922455465 1:225770490-225770512 CGGTAGGGAAGGTGGGAAAGGGG - Intergenic
922916125 1:229259212-229259234 CTGTAGGAATTGTTGGGTATTGG - Intergenic
1064063358 10:12158800-12158822 CTGGAGGCAGGGTGGGAGATAGG - Intronic
1064994189 10:21282033-21282055 CTATAGGAATGGGAAGAAATTGG - Intergenic
1066048959 10:31618179-31618201 CTGCAGGAAGGGTGGGAGGTGGG - Intergenic
1066391203 10:34978591-34978613 TTGTAGGGATGGAGGGACATGGG + Intergenic
1067664949 10:48269808-48269830 CTGTAGCACAGATGGGAAATGGG + Intronic
1068564839 10:58563127-58563149 CTGTAGGCATGGTGAGATAGTGG + Intronic
1069347837 10:67490581-67490603 GTGGAGGGATGGTGGGAGATGGG + Intronic
1069667642 10:70174163-70174185 CAGAAGGAGTGGTAGGAAATGGG + Intergenic
1070535449 10:77373980-77374002 CTGTGGGAAGGGTGGATAATGGG + Intronic
1070780592 10:79135458-79135480 CTGGTGGCTTGGTGGGAAATGGG - Intronic
1072539398 10:96386841-96386863 GTGTAGGAACGATGGGCAATGGG - Intronic
1074486220 10:113884000-113884022 CTGGAGGCATGATGGGAGATGGG + Intronic
1074769921 10:116726575-116726597 CAGAAGGAACTGTGGGAAATTGG - Intronic
1076225503 10:128771635-128771657 CTGGAGGAGTGGTGGGAAGGGGG + Intergenic
1079645597 11:22860702-22860724 GGGTAGAAAAGGTGGGAAATTGG - Intergenic
1080213117 11:29810022-29810044 CTGTAATAATGATAGGAAATTGG + Intergenic
1080313900 11:30926440-30926462 CTGTCAGAAAGGTGGAAAATGGG + Intronic
1083958693 11:66002087-66002109 CAGTTGGACTGGTGGGAACTGGG - Exonic
1085993525 11:81881593-81881615 TTGGAAGAATGGTGGGAAACAGG - Intergenic
1086004922 11:82026812-82026834 CTGTAGAAAAGGTCGGAAAGAGG - Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089058936 11:115610237-115610259 CTGTGGGAAGGGGGGGAAAGGGG - Intergenic
1089646338 11:119882282-119882304 TTTTGTGAATGGTGGGAAATAGG + Intergenic
1090548585 11:127792944-127792966 CTGGACGAATGGTGTGGAATGGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091573967 12:1715119-1715141 CTGTAGGAAGGCTAGGATATGGG + Intronic
1093233974 12:16583703-16583725 CTGTAGGAATGGATTGAAAAAGG + Intronic
1093797551 12:23331111-23331133 CTATAGGAAGGCTGTGAAATGGG - Intergenic
1096756683 12:53805287-53805309 CTGTAGGAATTGTGAAACATTGG - Intergenic
1097100914 12:56588761-56588783 CTGTAGGAAGGTTGGGGAAGTGG + Intronic
1097759986 12:63452395-63452417 GGGTAGGAATAGAGGGAAATGGG + Intergenic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098986476 12:77017847-77017869 TTGTAGGAAGGGAGGGAAAGTGG + Intergenic
1100013887 12:89985446-89985468 ACATAGGAATGGTGGGAAAGAGG - Intergenic
1100691809 12:97046409-97046431 ATGGTGGAATGGTGGGAGATGGG - Intergenic
1101094524 12:101323454-101323476 GTGTTGGAATGGTGTGAAACAGG - Intronic
1101761004 12:107659129-107659151 CTGAAGGCATGCTAGGAAATAGG - Exonic
1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG + Exonic
1104789511 12:131472970-131472992 CCAGTGGAATGGTGGGAAATGGG + Intergenic
1107213604 13:37888666-37888688 GTGTATGATTGATGGGAAATAGG - Intergenic
1107844054 13:44492681-44492703 CTGGAGGAATGGTGGAGGATGGG + Intronic
1108212567 13:48153034-48153056 CTGTTGGAAGGATGGGAGATGGG - Intergenic
1110198638 13:72821177-72821199 TGTTAGGAATGGTGAGAAATGGG + Intronic
1111707986 13:91775327-91775349 CAGTAGAAATGGTGGTAAAATGG - Intronic
1112395755 13:99029303-99029325 CTGTAGGGCTGGGGGCAAATAGG - Intronic
1113080043 13:106509845-106509867 CTGTAGGGTGGGTGAGAAATTGG + Intronic
1114035013 14:18616044-18616066 CAGTAAGATTTGTGGGAAATGGG + Intergenic
1114123632 14:19698972-19698994 CAGTAAGATTTGTGGGAAATGGG - Intergenic
1114634297 14:24178671-24178693 CTGTAAGAATGGTGGGGGTTGGG + Exonic
1114945120 14:27671758-27671780 CAGTAGGAATAGGAGGAAATAGG - Intergenic
1115587536 14:34829589-34829611 TTGTAGGAATGGTAGGGAAGTGG - Intronic
1117003287 14:51393551-51393573 CTGTGGGAATGCTGGGCCATGGG - Intergenic
1117679858 14:58192855-58192877 CAGTAGGAATGGAGTAAAATAGG + Intronic
1119783733 14:77297043-77297065 TGGTGGGAATGGTGGGAACTCGG + Intronic
1120764094 14:88312515-88312537 CAGTAGAAATGCTGGGGAATGGG - Intronic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1126189929 15:45868683-45868705 CACTTGGAATGGTGGTAAATGGG - Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1128457460 15:67840267-67840289 ATGAAGGAATCATGGGAAATAGG + Intergenic
1129536296 15:76315981-76316003 CTGGAGGAATGGTGCCATATTGG + Intergenic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1130064710 15:80594128-80594150 CTGGGGGAATGCTGGGAAAATGG + Exonic
1132538683 16:497006-497028 CTGAAGGAGTGTTGGGAAAGGGG + Intronic
1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG + Intergenic
1135046880 16:19163204-19163226 CTGTGGGCATGGCTGGAAATAGG - Intronic
1136021768 16:27445098-27445120 GGGTGGGCATGGTGGGAAATGGG - Intronic
1137297582 16:47110932-47110954 CCGTGAGAATGGTGGAAAATTGG + Intronic
1139939730 16:70596562-70596584 CTGAGGCAGTGGTGGGAAATGGG - Intronic
1141057746 16:80834315-80834337 TTGTAACAATGGTGGGAGATGGG - Intergenic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1143124230 17:4631481-4631503 CTCTAGGGAGGGTGGGACATGGG + Exonic
1145180489 17:20746055-20746077 CTGTAGAAATGATGGGGAAGAGG + Intergenic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148824541 17:50382789-50382811 CTGAAGGAATGAGGAGAAATGGG - Exonic
1149734655 17:58981317-58981339 CTGAAGGGATGGTGGGAAGGGGG - Exonic
1149840087 17:59955028-59955050 CTGTAGAAATGATGGGGAAGAGG + Intronic
1151500718 17:74486687-74486709 GTGCAGGAATGGTGGGAATGGGG - Intergenic
1153712494 18:7814158-7814180 CTATAGGGATTGTGGGAGATGGG + Intronic
1154213139 18:12396876-12396898 CTGTTGGAGTGGTGGGCGATTGG + Intergenic
1155572115 18:27206320-27206342 CTGGAGGAAAGCAGGGAAATTGG - Intergenic
1156298222 18:35811852-35811874 ATGGAAGAATGGTGAGAAATGGG + Intergenic
1158582258 18:58694051-58694073 TGGTAGGAAAGGTGGAAAATGGG - Intronic
1160893257 19:1390587-1390609 CTGTTGAAATGGTGGGACTTAGG + Intronic
1161340567 19:3739738-3739760 CTCTGGGAAAGGTGGAAAATTGG - Intronic
1164123012 19:22285203-22285225 CTGGAAGAAAGGTGGAAAATGGG + Intergenic
1164307745 19:24019737-24019759 CTGGAGGAATGGGGAGAAAGGGG + Intergenic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG + Intronic
1166239895 19:41483141-41483163 TTGTAGAAATAGTGAGAAATAGG - Intergenic
1167345426 19:48942656-48942678 CTTTAGCAATGATGTGAAATTGG - Intronic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
926178140 2:10615823-10615845 CTTTAGGCATGGTGGGGATTTGG - Intronic
927013361 2:18929651-18929673 GTGTAGGAATGCTGTCAAATAGG - Intergenic
927361008 2:22233661-22233683 CTGTATGAAAGATGTGAAATTGG - Intergenic
927667116 2:25040689-25040711 CTGCAGGACTGTTGGGAAACTGG - Intergenic
927762450 2:25771490-25771512 CTGCTGGAATGGTGGGTGATGGG + Exonic
929134651 2:38611947-38611969 CTGTAGGAGTCTTGGCAAATTGG + Intergenic
930116782 2:47724969-47724991 TTGCAGGAATAGTGGGAGATAGG + Intronic
933381194 2:81548218-81548240 CTTTAAGAATGGTTGGAATTTGG - Intergenic
938327196 2:130417564-130417586 CAGTAAGATTTGTGGGAAATGGG - Intergenic
938362742 2:130703913-130703935 CAGTAAGATTTGTGGGAAATGGG + Intergenic
938721260 2:134069181-134069203 GTGTGGGACTGGTTGGAAATTGG - Intergenic
938779862 2:134575338-134575360 CAGCAGGAATGGTGGGCACTGGG - Intronic
939464871 2:142544368-142544390 CTGTAGGTACGGTGGGAAGCAGG - Intergenic
939881921 2:147640844-147640866 CTGGAGGAAGGGTGGGATGTAGG + Intergenic
940810812 2:158240766-158240788 CTGTAGGAATTGCAGGATATGGG - Intronic
944121810 2:196248542-196248564 CTGTAGGAAAGGTGGGGAAAGGG + Intronic
944894156 2:204146793-204146815 CTTTAGGAAGGAAGGGAAATTGG + Intergenic
946330718 2:219007589-219007611 GTGTAGGAAGGTTGTGAAATTGG + Intronic
1170851365 20:20007514-20007536 TTGTAGAAGTGGTGAGAAATCGG - Intergenic
1171467678 20:25342522-25342544 CTGTTGGAATGTTGGAAAAATGG - Intronic
1172074673 20:32285550-32285572 CTGAAAGGATGGTGGGAACTGGG + Intronic
1173074853 20:39808025-39808047 CTGTAGGAAAGAGGGGAAAATGG - Intergenic
1174213737 20:48900193-48900215 CTGCAGGAATAATGGGAAAAGGG - Intergenic
1178040247 21:28632980-28633002 CCATAGGAATGGGAGGAAATAGG - Intergenic
1178709544 21:34902839-34902861 CACTTGGAATTGTGGGAAATCGG + Intronic
1180459133 22:15543090-15543112 CAGTAAGATTTGTGGGAAATGGG + Intergenic
1181402368 22:22658306-22658328 CTGTAGGTATTTTGGGCAATTGG - Intergenic
1181798819 22:25330537-25330559 CGGTAGGAATTTTGGGCAATGGG - Intergenic
1182654637 22:31880266-31880288 CTGCAGGAATGGTGGAAAGGAGG - Intronic
950868927 3:16212507-16212529 CTTTAAGAACGGCGGGAAATAGG - Intronic
951722373 3:25713786-25713808 CGGTAAGAATGGGAGGAAATCGG + Intergenic
953707336 3:45241141-45241163 CTATAGTATTGGTGGGAATTTGG + Intergenic
955373356 3:58372967-58372989 CTGTTGAAATGTTGGGAACTGGG + Intronic
955452476 3:59084641-59084663 CTGTAAGATGGGTGGGAATTGGG - Intergenic
955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG + Intronic
955979844 3:64513869-64513891 CTGTAGGAGTAGTGGGGAAATGG - Intergenic
958972657 3:100629635-100629657 CTGCAGGAATGGTGGAACCTGGG + Exonic
960981828 3:123236037-123236059 CTAGAGGAATGGAGGGAAATAGG + Intronic
961552946 3:127679550-127679572 CTGTCAGAATGGTGGGACAGAGG - Intronic
963083130 3:141413079-141413101 GAGGAGGAATTGTGGGAAATGGG + Intronic
964411027 3:156398228-156398250 CTGTCGGGGTGGTGGGAAAAGGG + Intronic
965062672 3:163803632-163803654 CTGTAGGAAGGCTAGGATATGGG - Intergenic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
969910710 4:10442960-10442982 CTGTAGGAATATTGGGAGCTAGG - Exonic
970147389 4:13051215-13051237 CTGAAGGAGAGGTGGGAAGTGGG + Intergenic
972145482 4:36019741-36019763 AGGTAGGAGTGGTGAGAAATAGG + Intronic
972277149 4:37568095-37568117 CTGTAGGAATGCTGAGGAACAGG - Intronic
972351279 4:38238304-38238326 CTGTAGAAATGTAGGGAATTTGG - Intergenic
972371717 4:38430512-38430534 CTGAAGAAATGGTGCCAAATTGG + Intergenic
974991645 4:69098779-69098801 CTGAAAGAAAGATGGGAAATGGG + Intronic
975104004 4:70548226-70548248 CTTTAAGAATGTTGGGGAATTGG - Intergenic
976077675 4:81317991-81318013 CTGGACGAATGGTATGAAATAGG - Intergenic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
976989959 4:91353856-91353878 CTGTAGCCATGTTTGGAAATTGG - Intronic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
979791073 4:124781562-124781584 CTGTGGTAGGGGTGGGAAATGGG + Intergenic
979920023 4:126484846-126484868 GTGTAGGAATGGTGGTAAAGAGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980720211 4:136685983-136686005 CTGCAGGAATTATGGGGAATGGG + Intergenic
981756655 4:148147202-148147224 ATGGAGGAAAGGTGGGAAATAGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985501476 5:250352-250374 CTGTAGGTATGCTGGGAACTAGG - Intronic
985930091 5:3050320-3050342 CTGTATGATTCCTGGGAAATGGG + Intergenic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
994222443 5:97211482-97211504 CTGTAGGAGTGGGGGGAATGGGG - Intergenic
994738234 5:103584995-103585017 CTGCAGGATTGTTGTGAAATTGG - Intergenic
994751903 5:103748395-103748417 CTGTAGGAATAAAGGAAAATTGG - Intergenic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
996470636 5:123856077-123856099 CTGGAAGAATGGTGGGAATAAGG - Intergenic
996865162 5:128112428-128112450 ATGTAGGACTGGTGGCAACTAGG + Intronic
997368135 5:133338873-133338895 TGGTAGGAGTGGTGGGAAACTGG - Intronic
997419500 5:133754967-133754989 TTGAAGGAAGGGTGGGAAGTGGG - Intergenic
998479735 5:142452842-142452864 ATGGAGGAATGGTGAGAAACTGG - Intergenic
1001722224 5:173866402-173866424 CTGTAGAAATGGTTGGAAGGCGG + Intergenic
1003146134 6:3512104-3512126 CTCTAGGAATGGAGGCAAAGTGG - Intergenic
1003823715 6:9928812-9928834 CAGTAGGAATGGTGGAATAATGG - Intronic
1003860741 6:10319629-10319651 CCGTAGGGATGGTGGGACGTGGG + Intergenic
1004285985 6:14321404-14321426 CAGGAGGAAAGGGGGGAAATTGG - Intergenic
1004700900 6:18078540-18078562 CTGTTTAAAGGGTGGGAAATGGG + Intergenic
1007218469 6:40259919-40259941 ATTGAGGAATGGTGGCAAATGGG - Intergenic
1007713243 6:43838202-43838224 CTGTAGGACAGGTGGGGGATGGG + Intergenic
1008536137 6:52507745-52507767 CTGTGGGACTCGTGGGACATGGG - Intronic
1010385895 6:75279162-75279184 CTCTGGGAATAGTGGGAGATAGG - Intronic
1011383061 6:86763526-86763548 CTGTAGGAATGGTGTGGGACAGG + Intergenic
1012035933 6:94139419-94139441 CTATAGAAGTGGTGGGGAATTGG - Intergenic
1014189483 6:118476580-118476602 CAGTAGAAATAGTGGGAAAATGG - Intronic
1016010218 6:139131725-139131747 CTTCAGAAATGGTGGGAAAACGG + Intergenic
1020419326 7:7983237-7983259 ATGTAGGAATTTTAGGAAATAGG + Intronic
1020430128 7:8110124-8110146 TAGTAGTCATGGTGGGAAATGGG - Intergenic
1021243493 7:18233887-18233909 CTGTAGGAAACTTGGCAAATAGG + Intronic
1021862280 7:24917956-24917978 CTGAAGGAATCTTGGTAAATGGG - Intronic
1026446198 7:70486988-70487010 CTGTAGGCATGGTGGTAAACTGG + Intronic
1030983900 7:116218025-116218047 CTGTTAGAATGGTGGGGAGTCGG + Intronic
1032322199 7:130895652-130895674 CTGTAGGACTGCTCGGAATTGGG + Intergenic
1040807926 8:51415205-51415227 CAGTAGGAATTGTAGAAAATTGG + Intronic
1044713857 8:95082340-95082362 GTGCAGCAATGGTAGGAAATGGG + Intronic
1045409881 8:101906215-101906237 CTGTAAGAAGTGAGGGAAATGGG - Intronic
1047362832 8:124184678-124184700 TTTTAATAATGGTGGGAAATGGG + Intergenic
1047399975 8:124538290-124538312 ATGTAGGTTTTGTGGGAAATAGG - Intronic
1048292685 8:133192560-133192582 AAGTAGGAATGGTTAGAAATTGG - Intronic
1048681527 8:136847113-136847135 CTTTAAGAATGCTGAGAAATAGG - Intergenic
1050033675 9:1412872-1412894 CGGGAGGGATGGTGGGAGATCGG + Intergenic
1050193362 9:3053690-3053712 ATGTAAGAATTGTGGGCAATGGG - Intergenic
1050802306 9:9630407-9630429 GTGTAGGAAAAGTGGGACATTGG - Intronic
1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG + Intergenic
1052120221 9:24705612-24705634 CTGGAGAATTGGGGGGAAATGGG + Intergenic
1055429489 9:76229236-76229258 TTGTTGGTATGGTGGGGAATTGG - Intronic
1056319049 9:85419502-85419524 ATGAAAGATTGGTGGGAAATTGG - Intergenic
1056555658 9:87685163-87685185 CTGTAGGAAAGTTGGCAGATAGG - Intronic
1062086659 9:134652657-134652679 CTGCAGGAATCGTGGGATAGAGG + Intronic
1062447782 9:136602830-136602852 GTGTAGGAATGGTGGGATGCTGG - Intergenic
1186687895 X:11944720-11944742 CTCGAGCAATGGTGGCAAATAGG + Intergenic
1190787828 X:53669798-53669820 CTGAAGTAATGGTGTGAAGTAGG - Intronic
1194179188 X:90692166-90692188 CTGTAGGAATGGTTTGTAATTGG - Intergenic
1195611315 X:106870488-106870510 CTTTAGGAAAGTTGGGAACTAGG - Intronic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1200072360 X:153535524-153535546 CCGGAGGAAGGGTGGGAAACAGG - Intronic
1200525854 Y:4274332-4274354 CTGTAGGAATGGTTTGTATTGGG - Intergenic
1201458958 Y:14201452-14201474 CTGGAGGAGAGGAGGGAAATGGG + Intergenic