ID: 1091021235

View in Genome Browser
Species Human (GRCh38)
Location 11:132101984-132102006
Sequence ATTCCTACAGGTCACACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091021229_1091021235 -10 Left 1091021229 11:132101971-132101993 CCCATTTCCCACCATTCCTACAG 0: 1
1: 0
2: 2
3: 12
4: 229
Right 1091021235 11:132101984-132102006 ATTCCTACAGGTCACACTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 190
1091021224_1091021235 17 Left 1091021224 11:132101944-132101966 CCTGATCTCTCCTCCCTACTTCT 0: 1
1: 0
2: 2
3: 53
4: 567
Right 1091021235 11:132101984-132102006 ATTCCTACAGGTCACACTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 190
1091021227_1091021235 3 Left 1091021227 11:132101958-132101980 CCTACTTCTCAGCCCCATTTCCC 0: 1
1: 0
2: 6
3: 53
4: 554
Right 1091021235 11:132101984-132102006 ATTCCTACAGGTCACACTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 190
1091021228_1091021235 -9 Left 1091021228 11:132101970-132101992 CCCCATTTCCCACCATTCCTACA 0: 1
1: 0
2: 1
3: 43
4: 379
Right 1091021235 11:132101984-132102006 ATTCCTACAGGTCACACTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 190
1091021226_1091021235 4 Left 1091021226 11:132101957-132101979 CCCTACTTCTCAGCCCCATTTCC 0: 1
1: 0
2: 5
3: 39
4: 410
Right 1091021235 11:132101984-132102006 ATTCCTACAGGTCACACTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 190
1091021225_1091021235 7 Left 1091021225 11:132101954-132101976 CCTCCCTACTTCTCAGCCCCATT 0: 1
1: 0
2: 2
3: 42
4: 377
Right 1091021235 11:132101984-132102006 ATTCCTACAGGTCACACTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091021235 Original CRISPR ATTCCTACAGGTCACACTGC TGG Intronic
901008774 1:6185964-6185986 ATTCCTACAGCTCCCTCTGCTGG + Exonic
901904782 1:12398931-12398953 CTTGCTTCAGGTCACACTGCTGG - Intronic
905545169 1:38792075-38792097 CTTGCTAGAGCTCACACTGCTGG + Intergenic
905872536 1:41413285-41413307 CTTCCTTGAGGTCACACAGCAGG - Intergenic
906944802 1:50286536-50286558 CTTGCTAAAGGCCACACTGCTGG - Intergenic
907359657 1:53904251-53904273 TTTGCTCCAGGTCACACAGCAGG - Intronic
907387767 1:54136942-54136964 AATCCTACAGGGCACAGTGTGGG + Intronic
909379560 1:74982814-74982836 ATTCCTTAAGATCACACAGCTGG + Intergenic
910368843 1:86494598-86494620 ATTCCTACATTTCAAAATGCTGG + Intronic
910494997 1:87816852-87816874 ATTCCTACAGCTGATGCTGCTGG - Intergenic
910734830 1:90442056-90442078 ATTCCTACAGGTAAGATTGATGG - Intergenic
910843537 1:91584337-91584359 ATTCTTTCAGGTCACATGGCTGG - Intergenic
915129744 1:153688108-153688130 ACTCCTCCAGGTGACTCTGCAGG - Exonic
915730489 1:158050369-158050391 ATTCCCCAAGGTCACACAGCTGG + Intronic
917193870 1:172446461-172446483 ATGCCTGCAGGTAACACTGCTGG - Intronic
917454968 1:175178292-175178314 ATTCCTTCTGCTCACACTGAAGG - Intronic
917539361 1:175898248-175898270 ATTCCTCCATGCCAGACTGCTGG - Intergenic
918216497 1:182396222-182396244 ATTCCTACAGTCCTCACTGAGGG + Intergenic
918581612 1:186137534-186137556 TTTTCCACAGGTGACACTGCAGG - Exonic
919878289 1:201886339-201886361 ATTCCCCCAGCTCACACTGCTGG - Intergenic
920762781 1:208801708-208801730 ATTGCTACACATCACATTGCAGG - Intergenic
924085954 1:240451746-240451768 CTTCCTTCATGTCTCACTGCTGG - Intronic
1065109807 10:22428601-22428623 GTTGCTACAGGTCTCACTGAAGG + Intronic
1067949434 10:50715948-50715970 ATTGTTACAGGTAACACAGCAGG + Intergenic
1071838492 10:89444221-89444243 AATCCTAGAGGTGACATTGCTGG - Intronic
1074001134 10:109374212-109374234 CTTGCTAAAGGTCACACTGCAGG + Intergenic
1074042730 10:109808851-109808873 ATACCTAAAGGTGAAACTGCTGG - Intergenic
1075180699 10:120208065-120208087 AGTTCTACAGGTCAGACTCCAGG - Intergenic
1075258316 10:120942869-120942891 CTTCCTCCAGGCCACACAGCAGG - Intergenic
1075726015 10:124611312-124611334 CTTGCTATAGGTCACACAGCAGG - Intronic
1076044717 10:127282524-127282546 ATTCCTGCAGATCACCCTGATGG - Intronic
1078740733 11:14064109-14064131 TTTCCTACAGGAAACATTGCAGG - Intronic
1078932926 11:15926908-15926930 TTTCCTCAAGGTCACACAGCTGG + Intergenic
1079017552 11:16882041-16882063 AGTTCTACAAGTCACAGTGCAGG + Intronic
1079087986 11:17460900-17460922 ATTGCTCAAGGTCACACAGCTGG + Intronic
1079202021 11:18384513-18384535 ATTGCTCCAGGCCACACAGCGGG - Intergenic
1081293555 11:41356670-41356692 ATTCAGACAGTTCACACTTCTGG + Intronic
1081523344 11:43904562-43904584 ATTCCTTCAGGTCTCACTAACGG + Intronic
1082862030 11:57866274-57866296 ATTCCAACAAGTCACCTTGCAGG + Intergenic
1088749346 11:112830781-112830803 ATTGCTACAGGTCAGTCTTCAGG - Intergenic
1088911395 11:114195276-114195298 GTTCCTACAGGTCACCCTCATGG - Intronic
1090328633 11:125911246-125911268 ACTCCAACAGGTCACAGTTCAGG - Intronic
1091021235 11:132101984-132102006 ATTCCTACAGGTCACACTGCTGG + Intronic
1100478193 12:94953294-94953316 ATTCCCCAAGGTCACACTGCTGG + Intronic
1101427589 12:104600615-104600637 TTTCCTTAAGGTCACACAGCTGG + Intronic
1101479137 12:105080145-105080167 ATACCTACAAGTGAAACTGCAGG + Intronic
1101658819 12:106748149-106748171 ATTCCCCAAGGTCACACAGCTGG + Intronic
1101711031 12:107266860-107266882 ATTCCTAGAAGTGAGACTGCAGG - Intergenic
1102082326 12:110108441-110108463 TTTCCTAAAGGTCATACCGCTGG - Intergenic
1103292225 12:119855801-119855823 AATCCAACAGGCCACACGGCAGG - Intronic
1103596362 12:122026635-122026657 ATTCCTACTGGGCACATGGCAGG + Intronic
1103849453 12:123922435-123922457 CTTCCTAAAGGTCACTCTACAGG - Intronic
1104172565 12:126296408-126296430 CTTCCTAAAGGTTACACAGCTGG + Intergenic
1104771919 12:131369046-131369068 ATGCCTGCAGGTCCCACGGCAGG + Intergenic
1105295587 13:19085884-19085906 ACTCCCACAGGCCACACTGCTGG - Intergenic
1105724457 13:23147879-23147901 ACGCCTGCAGGTCACACTGATGG - Intergenic
1106547830 13:30745534-30745556 TTTCCTTGAGGTCAGACTGCTGG - Intronic
1108749546 13:53433834-53433856 TTTCCTACAAGTCACACAGCTGG - Intergenic
1110914334 13:81002628-81002650 ATTCCTACAGATAAAACTGCAGG + Intergenic
1112495485 13:99900609-99900631 CTTGCTCAAGGTCACACTGCTGG + Intergenic
1113078370 13:106491125-106491147 AATCCAGCAGGTCACACTGGGGG - Exonic
1114390817 14:22306550-22306572 ATTCCTAAAGGTCCTACTGGGGG - Intergenic
1114716049 14:24826227-24826249 ATTTGTTCAGGTCACACAGCTGG - Intronic
1115316844 14:32033695-32033717 AGTCTTACAGGTCACATTGGTGG + Intergenic
1117256407 14:53982531-53982553 ATTCCTACAAGTTACAAGGCTGG + Intergenic
1117746091 14:58870644-58870666 ATTCCTAAAAGTCAAATTGCTGG - Intergenic
1118345728 14:64939401-64939423 ATGCCTTCAGGAGACACTGCTGG - Exonic
1118729530 14:68656660-68656682 AGGCCCAAAGGTCACACTGCCGG - Intronic
1120740009 14:88097574-88097596 ATTTCTACAGGTCAGAATTCTGG - Intergenic
1122413706 14:101538641-101538663 CTCCCTCCAGGTCACACAGCAGG + Intergenic
1122519688 14:102334559-102334581 GATCCTCCCGGTCACACTGCTGG - Exonic
1124432374 15:29618733-29618755 TCTCCTTCAGGGCACACTGCTGG - Intergenic
1125318992 15:38461923-38461945 ATTCCTAGAGGTGAGACTGTTGG - Intronic
1126033561 15:44524466-44524488 GTGACTACAGGTCAAACTGCTGG - Exonic
1127510154 15:59632904-59632926 ATTCCCAAAGCTCACACTGGGGG - Intronic
1128085365 15:64882742-64882764 ATTCTGGCAGGTCACACTCCAGG + Intronic
1128666842 15:69544594-69544616 CTTGCTCAAGGTCACACTGCTGG - Intergenic
1129392781 15:75228902-75228924 TTTCCCACAGGTCACACCGGTGG - Intergenic
1130156807 15:81357552-81357574 GTTCCTACAGGTCTCACAGTCGG + Intronic
1131047789 15:89327014-89327036 ATTCTTGCAGGTCCCACTCCAGG + Exonic
1131681016 15:94723523-94723545 TTTCCCAGAGGTAACACTGCTGG + Intergenic
1132562981 16:606942-606964 GTTCCTGCAGGGCACAGTGCAGG - Intronic
1132918765 16:2370951-2370973 ATCCCTACAGGTCAGCCTTCAGG - Intergenic
1133880543 16:9777668-9777690 ATTGCTACTTGTCACATTGCAGG + Intronic
1134035686 16:11029266-11029288 ATTCCTGGAGCTCACACTGGGGG - Intronic
1134428298 16:14174849-14174871 ATTTCTACAGTGCACACTGATGG - Intronic
1135051701 16:19198422-19198444 ATTACCCAAGGTCACACTGCTGG - Intronic
1136621122 16:31429083-31429105 ACCCCCACAGCTCACACTGCTGG + Intergenic
1137434805 16:48446567-48446589 ATTCCTTCAGCTGTCACTGCAGG - Intronic
1137788997 16:51158662-51158684 ACATATACAGGTCACACTGCTGG - Intergenic
1138874012 16:60927458-60927480 ATTCCTATAAGTGAGACTGCTGG + Intergenic
1141913438 16:87076654-87076676 ATTCCTCCACATCAGACTGCAGG + Intergenic
1142549490 17:729480-729502 ATCGCCCCAGGTCACACTGCTGG - Intergenic
1145106761 17:20124195-20124217 ATTTCTGCAGTTCACACAGCAGG - Intronic
1147041436 17:37722406-37722428 ATAACTTAAGGTCACACTGCCGG + Intronic
1148137032 17:45300116-45300138 AATCCCACAGGTCAAACTGCAGG + Intronic
1148906120 17:50913302-50913324 CTTGCTCCAGGTCACACAGCAGG - Intergenic
1151444193 17:74152603-74152625 AGTCCTACAGGGCACAGTTCTGG - Intergenic
1154301919 18:13201666-13201688 CTTGCTTCAGGTCACACAGCTGG - Intergenic
1155093790 18:22536389-22536411 ATTCTCACAGGTCACAGTTCAGG + Intergenic
1155521342 18:26671977-26671999 AATCCTACAGGTGAGACTGGGGG - Intergenic
1155560745 18:27073544-27073566 CTTCCCTCTGGTCACACTGCAGG - Intronic
1157475881 18:48023361-48023383 TTCCCCACAGGTCACCCTGCTGG - Intergenic
1159896754 18:74004190-74004212 TTTCCCACAGGTCAACCTGCAGG + Intergenic
1160021597 18:75185692-75185714 ATTCCTCAATGTCACACAGCTGG - Intergenic
1161052204 19:2170404-2170426 CTTCCTACACCTCACACTGCTGG - Intronic
1161831026 19:6604531-6604553 CTTGCTGCAGGTCACACAGCTGG - Intergenic
1163137142 19:15320223-15320245 TTTCCTACAGTTCTCACTGTTGG - Intronic
1163166155 19:15499593-15499615 AATCCTAGTGGTCACTCTGCAGG - Intergenic
1163573697 19:18098418-18098440 CTCCCCCCAGGTCACACTGCTGG - Intronic
1166311067 19:41962918-41962940 TTTCCTTGAGGTCACACAGCAGG - Intergenic
1166972701 19:46580464-46580486 ATTGCCCCAGGTCACACAGCTGG + Intronic
1167094134 19:47364817-47364839 ATTGCCCCAGGTCACACAGCTGG + Intronic
1167747748 19:51362717-51362739 TTTCCTCAAGGTCACACAGCAGG + Intronic
925206821 2:2014170-2014192 ATTCCTGCATATCCCACTGCAGG - Intronic
926378102 2:12254614-12254636 ATTCCTCAAGGCCACACAGCTGG - Intergenic
926922819 2:17956185-17956207 ATTCCTAGAAGTGAGACTGCTGG - Intronic
927885991 2:26719199-26719221 ATTCCTAGAAGTGCCACTGCAGG + Intronic
931286408 2:60835578-60835600 CTTCCTCCAAGTCACAATGCAGG - Intergenic
932459912 2:71875521-71875543 GTGCCTACAGGTGAGACTGCAGG + Intergenic
933986454 2:87595906-87595928 ATGACGACTGGTCACACTGCTGG + Intergenic
935671986 2:105563696-105563718 CTTGCTAAAGGTCACACCGCAGG - Intergenic
935752471 2:106248748-106248770 ATTCCTCCAGCTCCCTCTGCTGG - Intergenic
935912885 2:107916291-107916313 ATTCCTCCAGCTCCCTCTGCTGG - Intergenic
936044620 2:109177033-109177055 CTTCCACCAGGTCACACAGCAGG - Intronic
936120279 2:109736408-109736430 ATTCCTCCAGCTCCCTCTGCTGG + Intergenic
936307384 2:111354895-111354917 ATGACGACTGGTCACACTGCTGG - Intergenic
937879537 2:126855057-126855079 ATGTCTACAGGGCACACTGGTGG - Intergenic
939332505 2:140782914-140782936 CTTCCTGAAGGTCACACAGCAGG + Intronic
940468319 2:154060846-154060868 GTTCCTACAGGTCAGCCTCCAGG + Intronic
945265934 2:207891442-207891464 ATTTCTTAAGGTCACACAGCAGG + Intronic
948753082 2:240143724-240143746 ATTTCTCCAGGTGACTCTGCAGG + Intronic
1168972358 20:1939297-1939319 GGTCCTACAGGTGAAACTGCAGG + Exonic
1172038044 20:32024083-32024105 ATTACTCAAGGTCACACAGCTGG + Intronic
1174299268 20:49569605-49569627 TTCCCTAGAGGTCCCACTGCAGG + Intergenic
1174664848 20:52248376-52248398 ATTCCTACAAGTGAAATTGCTGG - Intergenic
1179585696 21:42372854-42372876 ATTCCCACAGGGCAAAATGCAGG - Intronic
1181631065 22:24151646-24151668 ATTCCATCAGATCACACTTCAGG + Intronic
1183014117 22:34971922-34971944 ATTTGTGCAGGTCACACAGCTGG - Intergenic
950080288 3:10217021-10217043 TTCCCTACAGGACAGACTGCAGG + Exonic
950747456 3:15101888-15101910 ATTCCTGCAGGGGACTCTGCTGG - Intergenic
951625134 3:24652626-24652648 ACAGCTACAGGTCACAGTGCAGG + Intergenic
953490882 3:43349373-43349395 CTTCCTGTAGGGCACACTGCAGG + Exonic
955422573 3:58753444-58753466 ATTCATAAAGGTCACACAGTGGG + Intronic
956483340 3:69695242-69695264 ATTCCCACAGCTAAAACTGCCGG + Intergenic
959951842 3:112188184-112188206 ATTCCTACAGGTGTAATTGCTGG + Intronic
963132999 3:141876037-141876059 GTTCCTACAGGACGCTCTGCGGG - Intergenic
963310426 3:143704554-143704576 ATTCCTAGAGGTGAAATTGCTGG - Intronic
963848788 3:150186578-150186600 ATACCTATAGGTGACATTGCTGG - Intergenic
965216051 3:165866143-165866165 ATTCCAGCAGGTGATACTGCTGG + Intergenic
965313681 3:167163718-167163740 ATTGCTCAAGGTCAGACTGCTGG + Intergenic
966126466 3:176582464-176582486 TTTCCTAAAAGTCACACTTCTGG + Intergenic
968143551 3:196278543-196278565 ATTCCTAAGGGTCAGTCTGCAGG - Intronic
968509258 4:988149-988171 CTTCCTGCAGGTCTCCCTGCAGG + Exonic
968962588 4:3753005-3753027 AGTCCCCCAGGTCAAACTGCAGG - Intergenic
969625879 4:8305433-8305455 ACTCTTCCAGGTCACACAGCTGG + Intronic
969901089 4:10350051-10350073 CTTCTGACAAGTCACACTGCAGG + Intergenic
972978514 4:44666832-44666854 ATTGCCATAGGTCACACAGCAGG - Intronic
975940640 4:79640998-79641020 ATTCCTAGAGGTTAAACTGTAGG + Intergenic
978900921 4:113948750-113948772 ACTCCTCCATGTCACAGTGCTGG - Intronic
982350823 4:154413565-154413587 ATCCCTACAGGTCAGCCTTCTGG - Intronic
984312182 4:178075877-178075899 ATTCCTAGAAATCACATTGCTGG - Intergenic
988866261 5:35338612-35338634 ATTCCTACAGTCCACAGTGCAGG + Intergenic
991093659 5:62717390-62717412 ATTCCTCCAGTACACACTACCGG - Intergenic
992949402 5:81842849-81842871 ATTCCTAGAGGTGAAACTTCTGG - Intergenic
996306581 5:122054041-122054063 ATTGCTCCATCTCACACTGCTGG - Intronic
998416994 5:141953222-141953244 ATTCCTCAAGGCCACACTGATGG - Intronic
999661489 5:153868024-153868046 ATTCCTAATGGTGACATTGCTGG + Intergenic
999668562 5:153937704-153937726 TCTCCTGCAGGTCTCACTGCAGG + Intergenic
1000919895 5:167125874-167125896 CTTGCTGCAGGTCACACAGCTGG + Intergenic
1002986213 6:2191896-2191918 AGTCCCACAGACCACACTGCAGG + Intronic
1006594081 6:35179859-35179881 CTTTCTACAGCTCACACTGGGGG - Intergenic
1013586963 6:111587952-111587974 ATTCCTATAAGTGAAACTGCTGG + Intronic
1013900125 6:115145378-115145400 ATTTCTTTAGGTCACACAGCTGG - Intergenic
1014014654 6:116516388-116516410 ACTCCTGCTGATCACACTGCAGG - Exonic
1017153154 6:151299237-151299259 AGGCCAACAGGCCACACTGCTGG - Intronic
1021408220 7:20298740-20298762 ATTCCCACAGGTCCCACTGAGGG + Intergenic
1021918301 7:25457224-25457246 ATTGCTGAAGGTCACACAGCTGG - Intergenic
1023254006 7:38294958-38294980 ACTCATCCAGGTCACACAGCTGG - Intergenic
1023429766 7:40078027-40078049 ATTACATCAGGCCACACTGCAGG - Exonic
1028422086 7:90644422-90644444 CTTCCTTCAGGTCTCAGTGCCGG + Intronic
1028906089 7:96155648-96155670 CTTCTTTCTGGTCACACTGCTGG - Intronic
1030156294 7:106459496-106459518 TTTCTTACCGGTCACACTGCTGG - Intergenic
1035548825 8:504186-504208 ACTCCTGGAGGTCACACAGCTGG - Intronic
1041707207 8:60859275-60859297 TTTCATCCAGGTAACACTGCTGG - Intronic
1045256268 8:100525751-100525773 ATTCCTAGAAGTGGCACTGCTGG + Intronic
1046605991 8:116373106-116373128 ATACATCCAGGTCACACTGATGG + Intergenic
1048939313 8:139384585-139384607 CTTCCTGCAGGAAACACTGCAGG + Intergenic
1049477467 8:142803458-142803480 CTCCCTACAGGACACTCTGCAGG - Intergenic
1053504245 9:38627614-38627636 ATTCTTACAGATCACACAGCAGG - Intergenic
1056938240 9:90934226-90934248 ATTCCAAGTGGTCACACTGAAGG + Intergenic
1057152132 9:92806002-92806024 ATTCTTACAGATCACACAGTAGG + Intergenic
1057264220 9:93603461-93603483 ACTCCTGTAGGACACACTGCTGG + Intronic
1057305632 9:93910582-93910604 ATAGACACAGGTCACACTGCAGG + Intergenic
1059156799 9:111997019-111997041 ATTCCTGAAAGTCACATTGCTGG - Intergenic
1060661182 9:125406100-125406122 CTTCCTGGAGGTCACACAGCAGG + Intergenic
1061234874 9:129336539-129336561 TTTACTACAGGGCACACAGCCGG + Intergenic
1062052069 9:134452707-134452729 ATTTGTACAGGTCACATTTCAGG + Intergenic
1062469985 9:136698089-136698111 ATTCCTGCAGGTGACATTTCTGG - Intergenic
1185668695 X:1788424-1788446 ATTCCCTCAGGTCACATTCCTGG + Intergenic
1189600070 X:42615044-42615066 ATTACTACAGTTCACCTTGCAGG - Intergenic
1191840389 X:65509573-65509595 ATTCCTACAAGGCCCACTGTTGG - Intergenic
1192366133 X:70474989-70475011 ATTCCTAGAAGTGAAACTGCAGG - Intronic
1193486399 X:82089521-82089543 ATTCTTACCTGTCACACTCCTGG + Intergenic
1196772062 X:119304104-119304126 ATTTCTACAGGTAACCTTGCAGG - Intergenic
1199574103 X:149296890-149296912 CTTGCTTAAGGTCACACTGCAGG - Intergenic