ID: 1091021237

View in Genome Browser
Species Human (GRCh38)
Location 11:132101988-132102010
Sequence CTACAGGTCACACTGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 274}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091021225_1091021237 11 Left 1091021225 11:132101954-132101976 CCTCCCTACTTCTCAGCCCCATT 0: 1
1: 0
2: 2
3: 42
4: 377
Right 1091021237 11:132101988-132102010 CTACAGGTCACACTGCTGGAAGG 0: 1
1: 0
2: 3
3: 13
4: 274
1091021230_1091021237 -7 Left 1091021230 11:132101972-132101994 CCATTTCCCACCATTCCTACAGG 0: 1
1: 0
2: 2
3: 23
4: 284
Right 1091021237 11:132101988-132102010 CTACAGGTCACACTGCTGGAAGG 0: 1
1: 0
2: 3
3: 13
4: 274
1091021228_1091021237 -5 Left 1091021228 11:132101970-132101992 CCCCATTTCCCACCATTCCTACA 0: 1
1: 0
2: 1
3: 43
4: 379
Right 1091021237 11:132101988-132102010 CTACAGGTCACACTGCTGGAAGG 0: 1
1: 0
2: 3
3: 13
4: 274
1091021224_1091021237 21 Left 1091021224 11:132101944-132101966 CCTGATCTCTCCTCCCTACTTCT 0: 1
1: 0
2: 2
3: 53
4: 567
Right 1091021237 11:132101988-132102010 CTACAGGTCACACTGCTGGAAGG 0: 1
1: 0
2: 3
3: 13
4: 274
1091021227_1091021237 7 Left 1091021227 11:132101958-132101980 CCTACTTCTCAGCCCCATTTCCC 0: 1
1: 0
2: 6
3: 53
4: 554
Right 1091021237 11:132101988-132102010 CTACAGGTCACACTGCTGGAAGG 0: 1
1: 0
2: 3
3: 13
4: 274
1091021226_1091021237 8 Left 1091021226 11:132101957-132101979 CCCTACTTCTCAGCCCCATTTCC 0: 1
1: 0
2: 5
3: 39
4: 410
Right 1091021237 11:132101988-132102010 CTACAGGTCACACTGCTGGAAGG 0: 1
1: 0
2: 3
3: 13
4: 274
1091021229_1091021237 -6 Left 1091021229 11:132101971-132101993 CCCATTTCCCACCATTCCTACAG 0: 1
1: 0
2: 2
3: 12
4: 229
Right 1091021237 11:132101988-132102010 CTACAGGTCACACTGCTGGAAGG 0: 1
1: 0
2: 3
3: 13
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091021237 Original CRISPR CTACAGGTCACACTGCTGGA AGG Intronic
900484013 1:2912952-2912974 TTAGAGGTCACGCTTCTGGAAGG + Intergenic
903814672 1:26056182-26056204 CTAAAGGTCACACAGCTAAAAGG - Intronic
904277563 1:29394416-29394438 CCACAGGTCACAGAGCAGGAGGG - Intergenic
905190603 1:36230976-36230998 CTACATGTCAGACTGTTGGCAGG - Intronic
906526401 1:46495805-46495827 CTCCAGGTCATGCTGGTGGAGGG + Intergenic
907523714 1:55041185-55041207 CAACAGGTCACACTGCAGACAGG - Intronic
908624720 1:66027806-66027828 ATCCAGGTCACACTGATGCAAGG + Intronic
911703989 1:100989487-100989509 CTTTAAGTCAGACTGCTGGATGG + Intergenic
912068725 1:105780004-105780026 ATCCAGGTCACACTGATGCAAGG - Intergenic
913195083 1:116449591-116449613 TTACAGGTCACATGGATGGAAGG + Intergenic
915075343 1:153303933-153303955 CGACAGGTGACCCTTCTGGATGG + Exonic
915735707 1:158083612-158083634 CTCCATGTCACACTGCTAGCAGG - Intronic
916129095 1:161595334-161595356 CCACGGGCCACACTGGTGGAGGG - Intronic
918800240 1:188961417-188961439 TTCCAGGTCACACTGATGCAAGG - Intergenic
919177146 1:194033309-194033331 TTCCAGGTCACACTGATGTAGGG + Intergenic
924850606 1:247825794-247825816 CTACAGGCCACAGTGCAGGCTGG + Intergenic
1063030050 10:2225507-2225529 TTCCAGGTCACGGTGCTGGAGGG + Intergenic
1063139488 10:3243739-3243761 CTACAGGTTACAGTGATTGACGG + Intergenic
1063987838 10:11525966-11525988 CAGCAGGTCTGACTGCTGGAAGG - Intronic
1064212693 10:13373842-13373864 TTTGAGGTCACACAGCTGGATGG + Intergenic
1067137397 10:43623418-43623440 CTGCAGTTCACAGTTCTGGAAGG + Intergenic
1068083765 10:52348939-52348961 TCACAGCTCACACTGCTGGGAGG - Intergenic
1069907163 10:71738696-71738718 CCACAGCTCTCACAGCTGGAGGG + Intronic
1073401632 10:103262200-103262222 CCCAAGGTCACACTGCTGGTTGG + Intergenic
1074390528 10:113053882-113053904 CTCAAGGTCACACAGCTGGGAGG + Intronic
1074654802 10:115572873-115572895 CTGCAGCTCAAACTGCTTGAGGG + Intronic
1074819311 10:117166808-117166830 CTCAAGGTCACACAGCTAGAGGG - Intergenic
1075261293 10:120965647-120965669 CTTCAGGTCACATTGCTCCAGGG - Intergenic
1075588024 10:123671318-123671340 CCACATGTCATAATGCTGGAGGG + Intronic
1075588044 10:123671445-123671467 GTACCTGTCACAATGCTGGAGGG + Intronic
1076098617 10:127755173-127755195 AGAGAGGTCACACAGCTGGAAGG + Intergenic
1076607975 10:131701693-131701715 CTCCAGCTCACACTGCTGCAGGG - Intergenic
1076794886 10:132793646-132793668 CCACAGGTCACACAGGTGGGAGG - Intergenic
1079024660 11:16936945-16936967 CCCAAGGTCACATTGCTGGAAGG - Intronic
1079346644 11:19658422-19658444 TTCAAGGTCACACAGCTGGAAGG + Intronic
1079470450 11:20773167-20773189 GTAAAGGTCACACTGATGGTTGG - Intronic
1080136140 11:28857328-28857350 ATCCAGGGCACACTGCTGCAAGG + Intergenic
1080694262 11:34587459-34587481 CCCCAGGTCACAGAGCTGGAAGG + Intergenic
1081224238 11:40501118-40501140 ATCCAGGTCACACTGGTGCAAGG + Intronic
1081533108 11:43977819-43977841 CTCAAGGTCACACAGCTGGTAGG - Intergenic
1081712416 11:45225911-45225933 CCACAGGAAACACTCCTGGAAGG - Intronic
1082733069 11:56824314-56824336 ATCCAGGGCACACTGCTGCAAGG + Intergenic
1083146674 11:60765023-60765045 TTACTGCTCACACAGCTGGATGG - Intronic
1083424241 11:62574892-62574914 CTACAGTTCGCACAGCTCGAGGG - Exonic
1083640711 11:64143853-64143875 CTAAAGGTCACACAGCTAAATGG - Intronic
1084230590 11:67749946-67749968 ATCCTGGTTACACTGCTGGATGG + Intergenic
1086869407 11:92018607-92018629 CCACAGCTGACAGTGCTGGAAGG - Intergenic
1088567192 11:111184475-111184497 ATCCAGGGCACACTGCTGCAAGG - Intergenic
1089984770 11:122803047-122803069 CTTCTGCTCACACTGCTGGTGGG - Intronic
1091021237 11:132101988-132102010 CTACAGGTCACACTGCTGGAAGG + Intronic
1091820983 12:3475039-3475061 CTACAGGTCACCATGCTGCTAGG - Intronic
1092268737 12:7004465-7004487 CCTAAGGTCACAGTGCTGGAAGG + Intronic
1092471564 12:8786417-8786439 ATCCAGGGCACACTGCTGGCAGG + Intergenic
1093062285 12:14619662-14619684 CTGAATTTCACACTGCTGGAGGG + Intronic
1096640919 12:52993754-52993776 CTCCTGGTCACACTGCTGAGGGG + Intergenic
1096815403 12:54198747-54198769 CTACAGCTCTCAATGCTGAAAGG + Intergenic
1097395797 12:59073206-59073228 CTTCAGGTCACACAGTTGGTAGG - Intergenic
1097401565 12:59134443-59134465 GTCCAGGTCACACTGATGCAAGG + Intergenic
1098319898 12:69232497-69232519 ATCCAGGTCACACTGATGCAAGG - Intergenic
1100028771 12:90161499-90161521 ATCCAGGTCACACTGATGAAAGG + Intergenic
1100052106 12:90461390-90461412 ATACAGGCCACACTGATGCAAGG + Intergenic
1101825357 12:108216190-108216212 TTCCAGGTCACACAGCTGGTAGG - Intronic
1102082323 12:110108437-110108459 CTAAAGGTCATACCGCTGGTGGG - Intergenic
1104172568 12:126296412-126296434 CTAAAGGTTACACAGCTGGTGGG + Intergenic
1104311709 12:127659029-127659051 CTCCAGGTCACCCAGCTGGCAGG + Intergenic
1105570190 13:21595460-21595482 CTTCAGGACACACTGGTGGGTGG + Intronic
1105983052 13:25538416-25538438 CTGCAGGACAGACTGCTGGCAGG - Intronic
1107758608 13:43652159-43652181 CTACAGGTCACTTTTTTGGAGGG + Intronic
1110637845 13:77787256-77787278 GTACAGGAGTCACTGCTGGAGGG - Intergenic
1111688165 13:91527409-91527431 GTCCAGGGCACACTGATGGAAGG + Intronic
1112826523 13:103398392-103398414 ATCCAGGTCACACTGATGCAAGG + Intergenic
1113058435 13:106295518-106295540 CTAAGTGTCACACTGGTGGATGG + Intergenic
1113251038 13:108452785-108452807 ATACAGCTCACACTGTGGGAGGG + Intergenic
1115391445 14:32858924-32858946 CTATAGGCCACACTGCTAAAAGG + Intergenic
1116293567 14:43074366-43074388 ATCCAGGTCACACTGATGGAGGG - Intergenic
1117758302 14:58999119-58999141 ATCCAGGGCACACTGATGGAAGG - Intergenic
1117886800 14:60372288-60372310 ATACAGGGCACATTGCTGCATGG - Intergenic
1118506159 14:66414104-66414126 CAGCAGGTGACACTGATGGATGG - Intergenic
1118974290 14:70663956-70663978 CTGAAGGTCACCCAGCTGGAAGG - Intronic
1119729483 14:76941959-76941981 CCACAGGTCAGACTCCTGCAGGG - Intergenic
1119821491 14:77620136-77620158 CACAAGGTCAAACTGCTGGAGGG + Intergenic
1120152768 14:81055599-81055621 ATCCAGGTCACACTGATGCAAGG - Intronic
1120210915 14:81632866-81632888 CTACAGGAAACACAGCTGGGAGG - Intergenic
1120813530 14:88829348-88829370 CTCTAGGTCACAGTGCTGTACGG - Intronic
1121200652 14:92114592-92114614 CTAGAAGGCACACTGCTGGCAGG - Intergenic
1124483548 15:30097775-30097797 ATACAGGTAACACGCCTGGAAGG - Intergenic
1124490000 15:30149837-30149859 ATACAGGTAACACGCCTGGAAGG - Intergenic
1124520030 15:30399451-30399473 ATACAGGTAACACGCCTGGAAGG + Intergenic
1124538624 15:30566773-30566795 ATACAGGTAACACGCCTGGAAGG - Intergenic
1124705551 15:31960854-31960876 CTCCAGGGCACACTGGTGCAAGG - Intergenic
1124753532 15:32388490-32388512 ATACAGGTAACACGCCTGGAAGG + Intergenic
1124760026 15:32440809-32440831 ATACAGGTAACACGCCTGGAAGG + Intergenic
1124975277 15:34524192-34524214 ATACAGGTAACACGCCTGGAAGG + Intergenic
1125847622 15:42872191-42872213 CTTCAAATCACACTGCAGGATGG - Intronic
1128159077 15:65411223-65411245 CTCCAGGTCACCCTGGTGGGGGG + Exonic
1129439359 15:75568941-75568963 CTACACTTCTCAGTGCTGGAGGG - Intronic
1130914258 15:88292186-88292208 CTACAGGGCATCCTGCAGGAGGG + Intergenic
1131824099 15:96303523-96303545 CTACAGTTCTCAATGCTCGAGGG + Intergenic
1131977820 15:97963068-97963090 CATAAGGTCACACTGCTGGTGGG - Intronic
1131987531 15:98060301-98060323 ATCCAGGTCACACTGATGCAAGG + Intergenic
1132186195 15:99803986-99804008 TCAAAGGTCACACAGCTGGAGGG + Intergenic
1132429478 15:101748717-101748739 TCAAAGGTCACACAGCTGGAGGG - Intergenic
1133336704 16:5011152-5011174 CTGCAGGCCACGCTGCTGGGGGG - Exonic
1134045645 16:11098944-11098966 CCACAGGTCTCACTGCTGGAAGG - Intronic
1134640344 16:15824927-15824949 CACCAGGTTACACAGCTGGAGGG + Intronic
1135155311 16:20047797-20047819 CTCAAGGTCACACAGCTAGAAGG - Intronic
1135924165 16:26677576-26677598 CTCCAGGACACACTGCTAGTAGG + Intergenic
1137788996 16:51158658-51158680 ATACAGGTCACACTGCTGGTAGG - Intergenic
1140946487 16:79772866-79772888 CTACAGGTTACACAGCTAGGTGG + Intergenic
1141608071 16:85166888-85166910 CTGCAGGGCACACTGCAGGGCGG - Intergenic
1142823078 17:2487573-2487595 CAGCAGGTCACTCTGCTGGTTGG - Intronic
1144063997 17:11608006-11608028 TTGCAGGTCACTGTGCTGGAAGG - Intronic
1144261751 17:13528336-13528358 CCACACGTCACACAGCTGGATGG - Intronic
1144732712 17:17537743-17537765 GCACAGGTCATACTGCTGGAAGG - Intronic
1144749957 17:17641742-17641764 CTCAATGTCACACAGCTGGAAGG + Intergenic
1145001791 17:19310393-19310415 CTACAGGTCAAAGTGCTTGGCGG - Intronic
1146224425 17:31053236-31053258 CAAGAGGTCACAGTTCTGGAAGG + Intergenic
1147183066 17:38698981-38699003 CCCAAGGTCACACTGCTGGCTGG + Intergenic
1148859871 17:50599245-50599267 CCCCAGGTCACACAGCTGGTTGG + Intronic
1148983466 17:51599605-51599627 GTCCAGGACACACTGGTGGAAGG - Intergenic
1149650050 17:58271100-58271122 CTCCAGGGCACCATGCTGGAGGG + Intronic
1157388894 18:47284488-47284510 CCTGAGGTCACACAGCTGGAAGG + Intergenic
1160104881 18:75964758-75964780 CGGCAGGTCACACTGCTGTCCGG - Intergenic
1160834236 19:1117066-1117088 CTACAACACACACTGCTGGGTGG + Intronic
1160897384 19:1409020-1409042 CTACAGGTCACACTTGTGGATGG + Intronic
1163573693 19:18098414-18098436 CCCCAGGTCACACTGCTGGTTGG - Intronic
1166225302 19:41391458-41391480 CCCAAGGTCACACAGCTGGAAGG - Intronic
1166738092 19:45097880-45097902 CTACATGTCACTCTGCTAGGTGG - Intronic
1167775065 19:51549374-51549396 GAACAGTGCACACTGCTGGAGGG + Intergenic
1168655305 19:58123257-58123279 ATCCAGGTCACACTGATGCAAGG + Intergenic
927202370 2:20585947-20585969 CTAGAAGTCACACAGCTGGGAGG + Intronic
928405905 2:31014674-31014696 CTCAAGGTCACACTGCTAGTGGG - Intronic
929358186 2:41051155-41051177 ATCCAGGTCACACTGATGCAAGG - Intergenic
929813165 2:45208909-45208931 CAACAGATCACACTGCTGCTTGG + Intergenic
930642594 2:53869359-53869381 CTGCAGGTAACATTGCTGGTAGG - Exonic
932631793 2:73350946-73350968 TTCCTGGTCACACAGCTGGATGG + Intergenic
934536596 2:95139401-95139423 ATCCAGGGCACACTGCTGCAAGG - Intronic
934891861 2:98077834-98077856 ATCCAGGTCACACTGGTGCAAGG + Intergenic
935112868 2:100108003-100108025 CTGCAGGTGGTACTGCTGGAAGG + Intronic
936475489 2:112835998-112836020 CTCCAGGTCCCAAGGCTGGAGGG + Intronic
936734703 2:115427105-115427127 ATACAGGGCACACAGCTGCAAGG + Intronic
936814601 2:116444686-116444708 ATCCAGGTCACACTGGTGCAAGG + Intergenic
939585742 2:144003304-144003326 ATAAAAGACACACTGCTGGAAGG - Intronic
939835633 2:147125944-147125966 ATTCAGGTCACACTGTTGCAAGG - Intergenic
941484591 2:166064189-166064211 TTCCGGATCACACTGCTGGAAGG - Intronic
942736968 2:179125406-179125428 CAACAGGTCATTCTGATGGAAGG - Intronic
945515815 2:210762451-210762473 ATACAGGGCACACTGCTGCAAGG + Intergenic
946005020 2:216517540-216517562 CAAAAGGTTACACTGATGGAGGG + Intronic
946805110 2:223463742-223463764 ATACAGGGCACACTGGTGTAAGG - Intergenic
946893770 2:224302383-224302405 CTTCAGGTTACCCTGCTGGTTGG + Intergenic
1168930908 20:1623213-1623235 ATCCAGGGCACACTGGTGGAAGG + Intergenic
1170243334 20:14194051-14194073 CTCCAGGTCAGTCTACTGGAGGG + Intronic
1170540767 20:17385311-17385333 CCAGATGTCACACTGCTAGAAGG - Intronic
1171061459 20:21966845-21966867 CTACAGTTGACACTGCTCCATGG - Intergenic
1171186711 20:23128213-23128235 CTGCAGGTCACCCTGCTGCATGG + Intergenic
1173491563 20:43486949-43486971 ATCCAGGTCACACTGATGGTGGG + Intergenic
1175779477 20:61673184-61673206 CTAGAGGTCACTGTGCAGGAGGG - Intronic
1175991939 20:62794135-62794157 CGCCCGGTCACACAGCTGGAAGG + Intergenic
1177594071 21:23212855-23212877 ATCCAGGGCACACTGCTGCAAGG + Intergenic
1178429069 21:32503103-32503125 ATCCTGGTTACACTGCTGGATGG - Intronic
1178697780 21:34808932-34808954 CTTCAGTGCACACAGCTGGAGGG + Intronic
1178891438 21:36524071-36524093 CTGCAGCTCACACTGCTGATGGG - Intronic
1179178651 21:39026912-39026934 TTAAAGGTGACACTGCTGGTTGG - Intergenic
1180003921 21:45011065-45011087 TTCCAGGTCACAGTGCTGGGAGG - Intergenic
1181804621 22:25367282-25367304 GCACAGCTCACACTGCTGGCAGG - Intronic
1183341918 22:37286301-37286323 CCAAAGGTGACACAGCTGGAGGG - Intronic
1183408589 22:37642218-37642240 CCCCAGGTCACACAGGTGGAGGG - Intronic
1183434178 22:37783723-37783745 ATCCATGTCACACTGCTGGTGGG - Intergenic
1185000181 22:48240766-48240788 ATACAGGACACATTGTTGGATGG + Intergenic
950101309 3:10358619-10358641 CTCCAGGTCACCCTGGTGGCTGG + Intronic
950445456 3:13034933-13034955 CGACAGGGCACAGTGCTGGTGGG + Intronic
953799491 3:46011435-46011457 CTCCAAGCCACACTGATGGAAGG + Intergenic
954285895 3:49618804-49618826 CTGCAAGACACACTGCTGCATGG - Intronic
955866319 3:63388224-63388246 CTTCTGGTCACACTGCTTGCTGG - Intronic
955940523 3:64143110-64143132 CTAGAGGTGACCCTGCTAGAAGG - Intronic
956249360 3:67219547-67219569 TTTCAGGTCTCATTGCTGGAAGG + Intergenic
956514741 3:70034481-70034503 CCACAGATCAAACTGCTGGAGGG - Intergenic
956599513 3:71004816-71004838 CTTTTGGTCACACTGCTTGATGG + Intronic
957047153 3:75384966-75384988 ATCCTGGTTACACTGCTGGATGG + Intergenic
957710994 3:83859675-83859697 ATCCAGGTCACACTGATGCAAGG + Intergenic
957820936 3:85373353-85373375 ATCCAGGTCACACTGATGCAAGG + Intronic
959769269 3:110072763-110072785 ATAGAGGACACACTGCTGCAAGG - Intergenic
962847329 3:139283898-139283920 CTACAGCTGCCAGTGCTGGAGGG + Intronic
963592925 3:147286174-147286196 ATCCAGGTCACACTGATGCAAGG + Intergenic
964287128 3:155130430-155130452 CTACAGGGTATACTGCTGCAGGG + Intronic
965897366 3:173594417-173594439 ATCCAGGTCACACTGATGCAAGG + Intronic
966555153 3:181250857-181250879 CTACAGAGCACACTGCTGTAAGG - Intergenic
969051122 4:4373694-4373716 CTCAAGGTCACACAGCTGGGAGG - Intronic
969373864 4:6750406-6750428 CCCAAGGTCACACTGCTGGTCGG + Intergenic
969578177 4:8048518-8048540 CACCAGGTCACACAGCTGGGAGG + Intronic
969823896 4:9741435-9741457 ATCCTGGTTACACTGCTGGATGG - Intergenic
971733607 4:30417278-30417300 CTCCAGGTCACACTGATGCAAGG - Intergenic
971875394 4:32301387-32301409 ATCCAGGTCACACTGATGCAAGG - Intergenic
973542323 4:51946772-51946794 CTCCAGGGCACACTGGTGCAAGG - Intergenic
975181959 4:71356211-71356233 TCATAGGTCACTCTGCTGGAAGG - Intronic
975637532 4:76464857-76464879 CTACAGGAAGCACAGCTGGAAGG - Intronic
977706530 4:100077035-100077057 TCACTGCTCACACTGCTGGATGG + Intergenic
979578753 4:122329788-122329810 CTACAGATAACACTGTTGTATGG - Intronic
983455133 4:167953561-167953583 ATCCAGGTCACACTGATGCAAGG - Intergenic
984116111 4:175683134-175683156 ATCCAGGCCACACTGATGGAAGG - Intronic
985608576 5:872873-872895 CTACAGGGAACAGTGCTGGGAGG - Intronic
986199777 5:5570274-5570296 CTAGAGGGCATACTGCTGGTGGG + Intergenic
986916408 5:12625533-12625555 ATCCAGGCCACACTGATGGAAGG - Intergenic
987456378 5:18151968-18151990 CTGCAGGTCAGACTTCTGGGTGG - Intergenic
987560934 5:19519082-19519104 CTGTTGCTCACACTGCTGGATGG + Intronic
987658480 5:20839775-20839797 ATTCAGGTCCCACTGATGGAAGG - Intergenic
988765205 5:34366169-34366191 ATTCAGGTCCCACTGATGGAAGG + Intergenic
988855935 5:35228546-35228568 CTTCAGGTCACCTAGCTGGATGG - Intronic
990489324 5:56288598-56288620 CTTCAGGTCTCACTTCTCGATGG - Intergenic
990784954 5:59408711-59408733 ATCCAGGTCACACTGATGTAAGG - Intronic
990983043 5:61618770-61618792 TTACTGGTCACTTTGCTGGACGG + Intergenic
992023786 5:72651188-72651210 CTCCAGGGCACACTGCTTCAAGG + Intergenic
992952983 5:81878833-81878855 CCACAGGGCACACAGCGGGATGG + Intergenic
993205730 5:84875842-84875864 CTGCAGCTCACACTTCAGGAAGG + Intergenic
993275306 5:85849966-85849988 ATCCAGGCCACACTGATGGAAGG + Intergenic
995683512 5:114745951-114745973 ATCCAGGGCACACTGGTGGAAGG - Intergenic
996238971 5:121171064-121171086 ATCCAGGGCACACTGATGGAAGG + Intergenic
996306580 5:122054037-122054059 CTCCATCTCACACTGCTGGATGG - Intronic
996644464 5:125797183-125797205 CTACATATCACACTGCAGTAAGG - Intergenic
997356660 5:133266991-133267013 CCACAAGTCACACAGGTGGAGGG + Intronic
997714368 5:136030828-136030850 TTACAGGTGACACTGTTGCAGGG - Intronic
997826479 5:137111274-137111296 CTCCTGGCCACACTGCTGCATGG - Intronic
999175526 5:149629119-149629141 CTTCAGGTCCCACTCCTGGCTGG - Intronic
999473763 5:151879131-151879153 ATGCAGGTCACACTGATGCAAGG - Intronic
999789910 5:154929655-154929677 CTAGAGGTTACCCTCCTGGAGGG + Intronic
1000830241 5:166093453-166093475 ATTCAGGGCACACTGCTGCAAGG + Intergenic
1000947794 5:167443048-167443070 CAAAAGGTCACACTGATTGATGG + Intronic
1001558782 5:172655525-172655547 GTACAAGTCCTACTGCTGGACGG - Intronic
1003484351 6:6562981-6563003 ATCCAGGTCACACTGATGAAAGG + Intergenic
1005228450 6:23671319-23671341 ATCCAGGTCACACTGGTGCATGG + Intergenic
1006609966 6:35288561-35288583 CTTCGGGTAAAACTGCTGGAAGG - Intronic
1009481064 6:64158085-64158107 ATCCAGGTCACACTGATGCAAGG - Intronic
1010341082 6:74753568-74753590 ATACAGGGCACAGTGATGGAGGG - Intergenic
1010498556 6:76566726-76566748 ATCCAGGGCACACTGCTGCAAGG + Intergenic
1010660888 6:78569635-78569657 ATACAGGGCACACTGGTGCAAGG + Intergenic
1011772993 6:90695563-90695585 CTTCAGGTCACAGTGGAGGAGGG + Intergenic
1015053858 6:128875649-128875671 ATCCAGGTCACACTGATGGAAGG - Intergenic
1016936563 6:149452474-149452496 CTCCAGGTAGCACAGCTGGAGGG + Intronic
1016939205 6:149470686-149470708 CCTAAGGTCACACAGCTGGATGG + Intronic
1018841805 6:167522755-167522777 CGCAAGGTCACACTGCTGGTTGG + Intergenic
1019122530 6:169814344-169814366 CTGCAGACCACACTGATGGATGG + Intergenic
1019151861 6:170011609-170011631 CTACAGGCCACACTGCAAGGTGG + Intergenic
1019263210 7:93983-94005 CTCCAGGTCACACTGAGTGAAGG - Intergenic
1019398022 7:833981-834003 CCACAGGTCTCACTGAAGGAAGG - Intronic
1020314284 7:6893975-6893997 ATCCTGGTTACACTGCTGGATGG + Intergenic
1021666016 7:22980976-22980998 CTACAGTTCCCTCTCCTGGAAGG + Intronic
1022518890 7:30993162-30993184 CTACAGGTCACGCTGTAGGCAGG - Intronic
1023131380 7:37006452-37006474 CTCAAGGTCACACTGCTGTGAGG + Intronic
1023627292 7:42128894-42128916 CTCAAGGTCACACTGCCAGAAGG + Intronic
1024083067 7:45872298-45872320 CTACAGCTCCGCCTGCTGGATGG - Intergenic
1027265901 7:76495159-76495181 CCACAGCTCACACTGCTGCCTGG + Intronic
1027317275 7:76993276-76993298 CCACAGCTCACACTGCTGCCTGG + Intergenic
1028412116 7:90541099-90541121 CTATAGGTCATTCTGATGGAAGG - Intronic
1028517030 7:91689359-91689381 CTAAAGGCCACACAGCTGGTAGG - Intergenic
1029444754 7:100605689-100605711 CTCCAGGTCAAACTTCTCGAAGG - Exonic
1032558469 7:132862508-132862530 CAGCAAGTCACACTGGTGGAGGG + Intronic
1032668300 7:134060294-134060316 TTTCAAGTCACCCTGCTGGATGG - Intronic
1034346310 7:150387436-150387458 GGACAGGTCACACTGCTGTGTGG - Intronic
1036021720 8:4853836-4853858 ATCCAGGTCACACTACTGCAAGG - Intronic
1041013901 8:53571615-53571637 ATACAGGCCACACTGATGCAAGG - Intergenic
1045791398 8:105988419-105988441 ATTCAGGACACACTGCTGCAAGG - Intergenic
1046826119 8:118694310-118694332 ATCCAGGTCACACTGATGCAAGG + Intergenic
1048137477 8:131760117-131760139 ATCCAGGCCACACTGATGGAAGG - Intergenic
1048513299 8:135081290-135081312 AAACATGGCACACTGCTGGAAGG + Intergenic
1049543395 8:143218544-143218566 CTCAAGGTCACACAGCTGGGCGG + Intergenic
1050643464 9:7693466-7693488 ATACAGGCCACACTGATGCAAGG - Intergenic
1053055700 9:34991926-34991948 TTACAGGCCTCACTCCTGGAAGG + Intronic
1055886570 9:81070082-81070104 CTCCAGTTCTCACTGCAGGACGG + Intergenic
1056566378 9:87776416-87776438 CAACAGATAAAACTGCTGGAAGG - Intergenic
1058817352 9:108696647-108696669 CCAGTTGTCACACTGCTGGAAGG - Intergenic
1061009378 9:127946131-127946153 CTCCAGGACACATTGCTGGAGGG + Intronic
1062110434 9:134779227-134779249 CTAAAAGTCACCCTGCTGGGAGG + Intronic
1062166752 9:135111690-135111712 CTAAAGGTCACAGAGCTGGGAGG - Intronic
1062669927 9:137702501-137702523 TTCCAGGCCACACTGGTGGAAGG + Intronic
1185813302 X:3130388-3130410 CTACAGATCCCACTGCTGATTGG + Intergenic
1186504850 X:10083002-10083024 CTACAGCTGACACTGCTATATGG - Intronic
1189028765 X:37428527-37428549 GTCCAGGTCACACTGATGCAAGG + Intronic
1189203470 X:39217729-39217751 TTCCAAGTTACACTGCTGGAGGG - Intergenic
1190425164 X:50328999-50329021 ATGCAGGGCACACTGCTGCAAGG + Intronic
1192140229 X:68640658-68640680 CTCAAGGTCACACAGCTGGTAGG - Intergenic
1192551748 X:72060134-72060156 CTCAAGGTCACACAGCTAGATGG - Intergenic
1192600409 X:72457796-72457818 CTACAGGTTACAGTGCAAGAAGG + Intronic
1193998789 X:88400670-88400692 ATCCAGGGCACACTGCTGCAAGG - Intergenic
1194856297 X:98933232-98933254 ATCCAGGTCACACTGGTGCAAGG - Intergenic
1195496200 X:105537627-105537649 CTAAAGGTCCTACTGCTGGTAGG - Intronic
1195598573 X:106720725-106720747 CTGAAGGTCACACAGCTGGTAGG - Intronic
1197640212 X:128959327-128959349 ATCCAGGTCACACTGATGCAAGG + Intergenic
1198558762 X:137825328-137825350 TTACAGTTGACACTGATGGAGGG - Intergenic
1199384647 X:147209031-147209053 ATCCAGGGCACACTGCTGCAAGG - Intergenic
1201017727 Y:9623248-9623270 CTACAGGGCCAACTGCAGGAAGG + Intergenic
1201308870 Y:12576485-12576507 CTACAGCTCACGATTCTGGAGGG - Intergenic