ID: 1091021602

View in Genome Browser
Species Human (GRCh38)
Location 11:132104995-132105017
Sequence CATGGGAAGCCAAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091021602 Original CRISPR CATGGGAAGCCAAATGAGGA GGG Intronic
901774478 1:11550675-11550697 CAAGAGATTCCAAATGAGGATGG + Intergenic
903038846 1:20513240-20513262 TTTGGGAAGCCAAAGCAGGAGGG + Intergenic
903272327 1:22197427-22197449 CATGGGAAGCCACATATGAATGG - Intergenic
904775947 1:32906629-32906651 CATGTGAAGGCCACTGAGGATGG - Intergenic
906433119 1:45772228-45772250 CTTGGGAAGCCCAAGGTGGATGG - Intergenic
908384269 1:63626130-63626152 CAGGGGAGGCCATTTGAGGATGG + Intronic
910321867 1:85955264-85955286 GATGGGGAGCCAAAAGGGGATGG - Intronic
911096639 1:94060518-94060540 CATGGTAAGCCAAATGGAGAAGG - Exonic
911867458 1:103047149-103047171 CATTGGTAGCCCAATGGGGACGG + Intronic
913594558 1:120360840-120360862 CATGGGAGGACAAATTAGAAAGG + Intergenic
914092706 1:144518146-144518168 CATGGGAGGACAAATTAGAAAGG - Intergenic
914305824 1:146415729-146415751 CATGGGAGGACAAATTAGAAAGG + Intergenic
914596232 1:149157077-149157099 CATGGGAGGACAAATTAGAAAGG - Intergenic
916975783 1:170075893-170075915 AATAGGAAGTCCAATGAGGAAGG - Intronic
917047156 1:170873697-170873719 CATGGTAAGCCAAAAAAGTAAGG - Intergenic
917098435 1:171422921-171422943 CTTGGGAATCTAAAGGAGGAAGG + Intergenic
918198371 1:182243917-182243939 CTTGTGAAGCCAAATGCAGAAGG - Intergenic
919846649 1:201647180-201647202 CTTGGGAGGCCATTTGAGGATGG + Intronic
920459561 1:206128800-206128822 GATGGGAAGATAAATGAAGAAGG - Intergenic
921066182 1:211623627-211623649 AATGGAAAGCCCCATGAGGACGG + Intergenic
922170469 1:223150339-223150361 CTTGGGAAGCTGAGTGAGGAGGG - Intergenic
1063212312 10:3891984-3892006 CATGGGAAGCCAAGGTAGGCAGG + Intergenic
1065238074 10:23674962-23674984 CATTGGAAGCCAGAAGATGATGG - Intergenic
1066492457 10:35906835-35906857 AATGGGAAGCCATGTGAGGTGGG + Intergenic
1067427474 10:46220838-46220860 CATGGGAGGACACAGGAGGAAGG + Intergenic
1067582904 10:47456748-47456770 CATGGGAGGACACAGGAGGAAGG + Intergenic
1067938520 10:50632224-50632246 CATGGGAAGCAAAGTGGGGGTGG - Intergenic
1068617107 10:59130887-59130909 AATTGGAAGGCAAAGGAGGAAGG - Intergenic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1071663208 10:87527088-87527110 CATTGGTAGCTTAATGAGGATGG + Intronic
1072573042 10:96675219-96675241 CCTGGGAAGGAAAATGGGGAGGG + Intronic
1074259508 10:111837887-111837909 CATAGGAAGCCAAAAGTGGGAGG - Intergenic
1074308692 10:112302394-112302416 CAAGGGAAGCCATCTGGGGATGG - Intronic
1075451908 10:122557478-122557500 CCTGGGAAGCCAGAGGAAGACGG - Intergenic
1075518970 10:123132785-123132807 CCTGGGAAGACGAATGAGGCAGG + Intergenic
1075568258 10:123520282-123520304 CATGGGAAGCCACCAGAGGTGGG + Intergenic
1076389098 10:130083808-130083830 CATGGGAACAGAAATGAAGAGGG + Intergenic
1082060733 11:47857923-47857945 CTTGGCAGGCAAAATGAGGAAGG - Intergenic
1083172678 11:60932199-60932221 CTTGGGGACCCACATGAGGAAGG - Intronic
1083715849 11:64576542-64576564 CCTGAGCAGCCAAATGTGGATGG - Intergenic
1084568534 11:69945241-69945263 CAAGGGAAGGGAAATGAGGGAGG + Intergenic
1084792505 11:71483469-71483491 CAGGGGAAGAGAAAGGAGGAGGG - Intronic
1085835271 11:79949300-79949322 CATGGCAAGGAAAATGATGATGG + Intergenic
1086208192 11:84285444-84285466 CATAGGAACCAAAATGAGAATGG - Intronic
1089037270 11:115407760-115407782 CTTGGGAAGCCAAGGAAGGAGGG + Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090745139 11:129699323-129699345 CACAGGAAGCAAAATGGGGAGGG + Intergenic
1091021602 11:132104995-132105017 CATGGGAAGCCAAATGAGGAGGG + Intronic
1091825803 12:3511853-3511875 CTTAGGAAGCCAAAGAAGGATGG - Intronic
1092215397 12:6678375-6678397 CATGGGAGCCGAAATGGGGAAGG + Exonic
1092669255 12:10843864-10843886 CATTGGAATTTAAATGAGGAAGG + Intronic
1092734970 12:11573266-11573288 TTTGGGAAGCCAAAGCAGGAGGG - Intergenic
1094003455 12:25721792-25721814 CAGGGGAAGGGAAATGAGGGTGG + Intergenic
1094635882 12:32226965-32226987 CAGGGGAAGGCATGTGAGGAGGG + Intronic
1099025879 12:77463856-77463878 CATTGGTAGCTTAATGAGGATGG - Intergenic
1099387600 12:82034930-82034952 CATTGGAGGCCAAATGACAATGG - Intergenic
1099513613 12:83568843-83568865 CATGGGAAGAGAAATCAGAAAGG + Intergenic
1099567230 12:84267755-84267777 CAAGGGAAACCAAAGGAGGAGGG + Intergenic
1101719096 12:107335635-107335657 CATGGGATGCCAGAGCAGGAAGG - Intronic
1102240002 12:111319303-111319325 AAAGGGAAGGGAAATGAGGAAGG + Intronic
1102274951 12:111574663-111574685 TTTGGGAAGCCAAGGGAGGAGGG - Intronic
1103462677 12:121117515-121117537 CATGGTCAGCAGAATGAGGATGG + Intergenic
1105945789 13:25188312-25188334 CATGGGGAGGCCAATTAGGAAGG + Intergenic
1106634944 13:31518612-31518634 GCTGGGAAGCTACATGAGGAAGG + Intergenic
1106794471 13:33190197-33190219 CTTTGGAAGGCCAATGAGGAAGG + Intronic
1107100598 13:36586768-36586790 TTTAGGAAGCCAAATGAAGAAGG - Intergenic
1107763229 13:43704427-43704449 GAAGGGAAACCAAATGAAGAAGG + Intronic
1110310994 13:74048899-74048921 CCTGGAAAGCCGAATGAGGGAGG + Intronic
1110411449 13:75208079-75208101 CATGGGAGGCCAAGGCAGGAGGG + Intergenic
1111281409 13:86029776-86029798 GATTGGAATCCAAGTGAGGAGGG - Intergenic
1112033680 13:95478619-95478641 CCCAGGAAGCCAAATGGGGATGG - Intronic
1112313061 13:98336735-98336757 AATGAAAAGCCAATTGAGGATGG + Intronic
1112641372 13:101279407-101279429 CATTGGAAGAAGAATGAGGAAGG + Intronic
1117484616 14:56181716-56181738 CAGGCTAAGTCAAATGAGGATGG + Intronic
1119164474 14:72480779-72480801 CCAGGGAAGCCAGATCAGGATGG - Intronic
1120024467 14:79567385-79567407 AATGGGAAACAAAATGGGGAAGG + Intronic
1121501225 14:94439962-94439984 CTTGGGAAGCCAGTTGAGGCAGG - Intergenic
1121851954 14:97229435-97229457 CATGGGAAGACACATGGAGAAGG - Intergenic
1122738770 14:103858773-103858795 CCTAGGAAGCGAGATGAGGAGGG - Intergenic
1123587885 15:21775137-21775159 TTTGGGAGGCCAAATGGGGAGGG - Intergenic
1123624523 15:22217702-22217724 TTTGGGAGGCCAAATGGGGAGGG - Intergenic
1123696416 15:22882103-22882125 CATGGGAAGCCACCTGGTGATGG - Intronic
1124142936 15:27093313-27093335 GATGGGAAAACCAATGAGGAGGG - Intronic
1126969249 15:54091103-54091125 CAGGGGAACCCCACTGAGGAAGG - Intronic
1128984011 15:72206285-72206307 AATTGGAAGCCAAAGGAAGAGGG + Intronic
1129223556 15:74150621-74150643 CTTGGGAGGCCGAATGAGGCAGG - Intergenic
1129824928 15:78628668-78628690 CCTGGGAAGCACAGTGAGGAAGG - Intronic
1129978594 15:79845928-79845950 AATGGGAGGGGAAATGAGGAGGG - Intronic
1130393893 15:83485012-83485034 CAAGGGAATACAAATCAGGATGG - Intronic
1130751392 15:86716813-86716835 ATTGGGAATCCAAATGAGGTGGG + Intronic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1133273518 16:4623397-4623419 CTTGGGAAGCCAAATGAGTACGG - Intronic
1133825585 16:9275393-9275415 GACTGGAACCCAAATGAGGAGGG - Intergenic
1134519014 16:14910011-14910033 CCTTGGAAGCCACATGGGGAAGG - Intronic
1134554914 16:15156213-15156235 CCTTGGAAGCCACATGGGGAAGG + Intergenic
1134706684 16:16308666-16308688 CCTTGGAAGCCACATGGGGAAGG - Intergenic
1134960856 16:18403458-18403480 CCTTGGAAGCCACATGGGGAAGG + Intergenic
1138849120 16:60605297-60605319 TAGGGGAAGCCAGATGGGGATGG + Intergenic
1141979974 16:87544136-87544158 CTTGGGAACGCAAATGAGGTTGG - Intergenic
1143389440 17:6551630-6551652 TTTGGGAAGCCAAAGCAGGAAGG + Intronic
1143527724 17:7482152-7482174 CCTGGTAAGCCATATGAGAAAGG - Exonic
1143603000 17:7961404-7961426 CTTGGAAAGGTAAATGAGGAAGG + Intergenic
1143733892 17:8897052-8897074 CATGGGACCCCCAGTGAGGAGGG - Intronic
1144032715 17:11336589-11336611 CTTGCGAAGGCAGATGAGGAGGG + Intronic
1145359287 17:22198932-22198954 TTTGGGATGCCACATGAGGAAGG - Intergenic
1145684049 17:26637435-26637457 GATGGGAAGGCTGATGAGGATGG + Intergenic
1146789901 17:35745342-35745364 CAAGGGCACCCACATGAGGAAGG - Exonic
1147354841 17:39886726-39886748 CATGGGAAGGCAATTGTGGGGGG + Intergenic
1148494821 17:48047555-48047577 CGTGGGAGGCCAAACGAGGGGGG + Intergenic
1149534466 17:57421747-57421769 CATGGGAGGCTAAAGCAGGAGGG + Intronic
1150535520 17:66035393-66035415 CAGGTGAAGACAAATAAGGATGG - Intronic
1151228710 17:72666377-72666399 CAGTGGAGGCCAAATGAGAAAGG + Intronic
1152209976 17:78997908-78997930 CGTGGGAAGCTGAGTGAGGAAGG + Exonic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152727355 17:81954170-81954192 CATGGGAGGCCAAGTGCGGTTGG + Intronic
1153229126 18:2920142-2920164 CCTGGGAAGGCAAAGGAGGATGG + Exonic
1153490655 18:5644536-5644558 CATGGGAATTCAAATGAAAATGG - Intergenic
1154173583 18:12067724-12067746 CATGGGCGGCCCAATGCGGAGGG - Intergenic
1155281632 18:24246386-24246408 AATGGGAAGCCAGTGGAGGAGGG + Intronic
1155854828 18:30820096-30820118 CAGAAGAAGCCAAATCAGGACGG - Intergenic
1156585363 18:38425820-38425842 CAGGGGAGGACAACTGAGGAAGG - Intergenic
1156991595 18:43415194-43415216 CATGGGAAGCCTATGGAGGTGGG + Intergenic
1157725273 18:49959136-49959158 CAAGCGAAGTCAGATGAGGAGGG - Intronic
1158341111 18:56467462-56467484 AATGGTAAGCTAAATGAGGGTGG + Intergenic
1159686827 18:71432245-71432267 CATAGGAAAACAAATGAAGATGG - Intergenic
1164560618 19:29289525-29289547 CATGGGAAGCCATGTGGGGTAGG + Intergenic
1165134906 19:33661654-33661676 CAGGGGGAGCCAAAGGAGCAAGG - Intronic
1165723245 19:38094491-38094513 TTTGGGAAGCCAAAGGAGGAGGG - Intronic
1166239176 19:41478249-41478271 CATGTGAAGAAAACTGAGGAGGG + Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
927640235 2:24841273-24841295 CATGGCCAGCCCCATGAGGATGG + Exonic
929078180 2:38095822-38095844 CATGGGAAGAAACATGAAGACGG + Intronic
929687231 2:44045282-44045304 CAGGGGCAGCCAAAAGAAGAAGG - Intergenic
929692476 2:44086398-44086420 TTTGGGAAGCCAAAGGTGGAAGG - Intergenic
929862517 2:45691860-45691882 CATGGGAAGCCAGGTGAAGAGGG + Intronic
931365085 2:61612275-61612297 CCTGGGAAGCCAAATAGAGAAGG - Intergenic
934616343 2:95773573-95773595 GATGGGAACCCAAAGGAGAATGG + Intergenic
934644553 2:96050987-96051009 GATGGGAACCCAAAGGAGAATGG - Intergenic
934837968 2:97607077-97607099 GATGGGAACCCAAAGGAGAATGG - Intergenic
938556210 2:132426535-132426557 CATCTGAAGCCAAATGATGAGGG - Intronic
939164787 2:138628763-138628785 TTTGGGAAGACAAATGAGAAGGG - Intergenic
940847383 2:158656580-158656602 CAAGGGAAACCAAATCAGCAAGG + Intronic
942086501 2:172449065-172449087 CCTGGGAAGTGAAAGGAGGAGGG + Intronic
942937701 2:181577697-181577719 CATGGGAGGCCAGGTGATGAAGG + Intronic
943463598 2:188200236-188200258 CATAGTATGCCAAATGATGAGGG - Intergenic
943764721 2:191648388-191648410 CATGGGAAGCCGAAGCAGAAGGG - Intergenic
944103745 2:196056524-196056546 CATGAGCAGCCAGAAGAGGATGG + Intronic
945020668 2:205567816-205567838 CATTGGAAGCGGAGTGAGGAAGG + Intronic
945489183 2:210434775-210434797 CATAGGATGCCGAAGGAGGAGGG - Intronic
945654525 2:212606905-212606927 CATGGGAAGTCAAATGAAGGAGG + Intergenic
945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG + Intergenic
945968456 2:216212828-216212850 CATTGGAGGCCAGATGAAGATGG + Intergenic
946068979 2:217014888-217014910 CATGAGAAGCTAAAGGAGGCTGG + Intergenic
946119578 2:217498086-217498108 AGTGGGATGCCAAATGAGGGTGG + Intronic
1170102717 20:12720132-12720154 CAGGGGCAGGCAAATGGGGAGGG - Intergenic
1171325211 20:24285109-24285131 CTTAGGAATCCAAATGAGGGAGG - Intergenic
1171957692 20:31472511-31472533 GATGGGAAGGCTGATGAGGATGG - Intronic
1172025689 20:31946696-31946718 CATCAGAGGCCAACTGAGGAAGG + Intronic
1172975410 20:38902589-38902611 CAGGGGAAGGCAGATGAGGGAGG - Intronic
1173334609 20:42102326-42102348 CAGGGGCAGCCAAATGAGCAGGG - Intronic
1175538706 20:59734498-59734520 CTTGGGAAGCCAATGCAGGAGGG - Intronic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181636830 22:24178379-24178401 CATGGGAGCCCAGAGGAGGAGGG + Exonic
1183590499 22:38776800-38776822 TCTGGGAAGGCAAGTGAGGAGGG + Intronic
1184488554 22:44796017-44796039 CCTGGGAAGCCAGGTGAGGAGGG - Intronic
1184642551 22:45880155-45880177 CATGTGCAGCCATATAAGGAGGG + Intergenic
949361352 3:3235462-3235484 AGTGGGATTCCAAATGAGGAGGG - Intergenic
949639797 3:6023170-6023192 CATGGGAAGCTAACTGTGGATGG + Intergenic
950718740 3:14867733-14867755 CAGTGGAAGACAAATGAGGATGG - Intronic
952019215 3:28996950-28996972 CACTGGAAGCCAGATGGGGATGG + Intergenic
952171603 3:30813032-30813054 CATGAGAAGGCACATGAGAAGGG + Intronic
952409178 3:33032193-33032215 CATGGGGAGCTGACTGAGGAGGG - Intronic
952431727 3:33230182-33230204 GATGGGAAGCTAAGGGAGGAAGG + Intergenic
953023830 3:39133461-39133483 CATGGATAGCCAAATGTGAAGGG + Intronic
955997463 3:64691839-64691861 CATTGTAAGTAAAATGAGGAGGG - Intergenic
956378975 3:68645877-68645899 CATGGGAGGCCTAATGGAGAAGG + Intergenic
956749326 3:72333714-72333736 CAGGGGACTCCAAAGGAGGAGGG + Intergenic
957600471 3:82327686-82327708 CATGGGCAGCCAAAAGAAGGAGG - Intergenic
960147471 3:114218480-114218502 CATTGGAAGTCAAATGGGAACGG + Intergenic
960508494 3:118521351-118521373 CATTGGAAGCTTGATGAGGATGG - Intergenic
962197849 3:133379293-133379315 CACCCCAAGCCAAATGAGGAAGG - Intronic
962711528 3:138090610-138090632 GATGGAAAGCCAAAGGTGGAAGG - Intronic
963754973 3:149225522-149225544 AATGGGCAGCCAAAGGGGGATGG - Intergenic
964278827 3:155039094-155039116 CATGCAGAGACAAATGAGGAAGG + Intronic
965462015 3:168977659-168977681 AAGGGAAAGTCAAATGAGGAAGG + Intergenic
965881138 3:173389630-173389652 CATGGGGAGTGAAATAAGGAAGG - Intergenic
967232366 3:187352317-187352339 CATGGAAAACCAAAGCAGGAGGG - Intergenic
969130745 4:4989574-4989596 CTTGTGAAGCCAAAAGAGGTGGG + Intergenic
970057604 4:11993571-11993593 CATGAGGAGCCAAATGACAATGG + Intergenic
971136443 4:23873402-23873424 CATTGGAAGAAAGATGAGGAAGG + Intronic
972913662 4:43849327-43849349 CATGGCAAGCCAAAGGGTGAAGG - Intergenic
973013477 4:45106793-45106815 CATTGGTAGCTTAATGAGGATGG + Intergenic
973901490 4:55477863-55477885 TAAGGGAAGCCAAGGGAGGAGGG + Intronic
974148241 4:57972568-57972590 CATGGGAAGTGAATTGTGGATGG + Intergenic
974356450 4:60818946-60818968 CATGGAAAAATAAATGAGGAAGG - Intergenic
974551990 4:63387893-63387915 CATTGGAAACCAAATGCAGATGG - Intergenic
976959418 4:90950081-90950103 CATTGCCAGGCAAATGAGGATGG + Intronic
979483836 4:121248331-121248353 CCCTGGAAGCCAAGTGAGGAGGG + Intergenic
979931388 4:126636026-126636048 CATGAGAAGCTGAAAGAGGAAGG - Intergenic
981390407 4:144183541-144183563 CATGGGAAGTGAAAGAAGGATGG - Intergenic
982081904 4:151798487-151798509 CATGGGAGGCCTAAGGATGATGG + Intergenic
982110882 4:152052538-152052560 TGTGGGAAGCAAAATAAGGATGG - Intergenic
982988289 4:162238386-162238408 CATGAGAAGCCAAATGAGGGAGG - Intergenic
983108543 4:163720570-163720592 CATTGGTAGCCTGATGAGGATGG + Intronic
984605505 4:181781164-181781186 CATTGGTAGCTTAATGAGGATGG + Intergenic
987182682 5:15384620-15384642 CATCGGAAGCCTAATGAGTGTGG - Intergenic
987807906 5:22794079-22794101 CATGGCAAGCCAGATGTGGGGGG - Intronic
988373656 5:30405325-30405347 AATGGGAAACCAAAAGAGTATGG + Intergenic
989364795 5:40643621-40643643 CATTGGTAGCCTAATGGGGATGG + Intergenic
990153877 5:52852111-52852133 CTTGGGAAGCCACAAGAGCAAGG + Intronic
990519646 5:56566498-56566520 GATGGGAAGCCATTTGAGCATGG + Intronic
990980876 5:61601603-61601625 CATGAGAAGCCAGGTGGGGAGGG - Intergenic
991638791 5:68733117-68733139 TAGGGGAAGCCAAATCAGAATGG + Intergenic
994153424 5:96475258-96475280 CATGGGAAGCAAAGCCAGGAAGG - Intergenic
995251379 5:109996986-109997008 GAAGGGAATGCAAATGAGGAAGG - Intergenic
996755195 5:126927668-126927690 CCTGGGAAGCCAAGTGTGTAAGG + Intronic
999791856 5:154947375-154947397 CATTGGAACCTAAATGTGGATGG + Intronic
1000431649 5:161159656-161159678 CATGGTAACCAAAATGGGGATGG + Intergenic
1000434891 5:161196274-161196296 CATGGGAAGCCATTGGAGGATGG - Intergenic
1004608726 6:17218561-17218583 CATGGGAAGCCACATATGGCAGG - Intergenic
1005205378 6:23397119-23397141 CATTGGAGACAAAATGAGGAGGG - Intergenic
1005303422 6:24492605-24492627 CAAGGGCAGCCAAAGGAGAAAGG + Intronic
1007290950 6:40786260-40786282 CTTGGGGGCCCAAATGAGGATGG + Intergenic
1007505992 6:42335827-42335849 CATGGGAAGCAACAGGAAGATGG - Intronic
1008928744 6:56914911-56914933 CTAAGGAAGGCAAATGAGGAAGG + Intronic
1009415181 6:63408128-63408150 CATGGGTAGCTTGATGAGGATGG - Intergenic
1010047982 6:71469801-71469823 GAAGAGAAGGCAAATGAGGAGGG - Intergenic
1011745502 6:90403925-90403947 GAGAGGAAGCCAAATGAGCATGG - Intergenic
1014316738 6:119876269-119876291 CAAGAACAGCCAAATGAGGAAGG - Intergenic
1014489567 6:122045497-122045519 CAAGGGAAGGCAAATGAAAAAGG - Intergenic
1015421629 6:133017168-133017190 CATCAGAAGCCCAATTAGGAAGG + Intergenic
1015479187 6:133689540-133689562 CATGGGAAGCCCAAAGTGGCCGG + Intergenic
1015943929 6:138480279-138480301 CATCTGAAACCAAATGAGAATGG - Intronic
1018743383 6:166746928-166746950 GATGGGCAGCCAAATGGAGATGG + Intronic
1019929415 7:4213766-4213788 CAAGGGAAGCCAGATGTGCAGGG - Intronic
1019984375 7:4644581-4644603 TATGGGAAGCCAAGGCAGGAGGG + Intergenic
1020458065 7:8396763-8396785 CATGTGAGGCCACAGGAGGAAGG - Intergenic
1023925526 7:44666696-44666718 CAGGACAAGCCAGATGAGGAGGG - Intronic
1026569919 7:71520577-71520599 CATGGGCAGGCAAAGGAGGTAGG + Intronic
1027138360 7:75639755-75639777 CCAGGGAAGCCAAGTGGGGAGGG - Intronic
1027810578 7:82892025-82892047 CATTGGAAGCTTAATGGGGATGG - Intronic
1029516539 7:101026956-101026978 TTTGGGAAGCCAAGTGGGGAGGG - Intronic
1029577595 7:101413675-101413697 GAAGGGAAGGGAAATGAGGAAGG + Intronic
1029972097 7:104799830-104799852 CATGGGAAGGCAAGTCATGAAGG - Intronic
1030799535 7:113832221-113832243 CCTGGAAAGACAAAGGAGGAAGG + Intergenic
1034348185 7:150399675-150399697 CACGGGAAACCAAACCAGGAGGG + Intronic
1039351613 8:36769878-36769900 GAGGAGCAGCCAAATGAGGAGGG - Intergenic
1040647410 8:49415369-49415391 CATGGGCACCCTCATGAGGATGG - Intergenic
1040773194 8:51004743-51004765 AATTGAAAGCCAAATGAAGAAGG + Intergenic
1041816069 8:61972790-61972812 CCTTGTAAGCCAGATGAGGACGG + Intergenic
1043756667 8:84012083-84012105 CATGTGAAGACACAGGAGGAAGG + Intergenic
1044942601 8:97358612-97358634 CATGGGAAGCCAAGGCATGAAGG - Intergenic
1046940927 8:119930810-119930832 CCTGGAAAACTAAATGAGGAAGG - Intronic
1047959794 8:130002853-130002875 TTTGGGAAGCCAAGCGAGGAGGG + Intronic
1050218444 9:3357583-3357605 GCTGGGAAGGGAAATGAGGAAGG + Intronic
1051138233 9:13948888-13948910 CATTGGAAGCTAAATGATAAAGG + Intergenic
1051919094 9:22243219-22243241 GATGGGAAGGATAATGAGGAAGG + Intergenic
1053023541 9:34712136-34712158 CATGGGAGGCCAAAAGACAATGG - Intergenic
1056166132 9:83942536-83942558 CATTGGAAGCCAGTTAAGGAAGG + Intronic
1056292337 9:85156532-85156554 CTTAGGAATCCAAGTGAGGAAGG - Intergenic
1056739976 9:89246082-89246104 CATAAGAAGGCAAATGAGGCTGG + Intergenic
1056969682 9:91191813-91191835 TATGGGAAACCGAATGAGGATGG - Intergenic
1057430363 9:94988382-94988404 CAGAGGAAGGCATATGAGGATGG + Intronic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1058794503 9:108484685-108484707 AATGGGAAGCCAGGTGAGGTTGG - Intergenic
1059571596 9:115443363-115443385 CATGGCAGGCCATATGAAGATGG + Intergenic
1059665692 9:116444578-116444600 CATGGGAAGTCAAAGCTGGAAGG - Intronic
1060535868 9:124387541-124387563 CATGGGAAGCAGAATCAGGTTGG - Intronic
1061056381 9:128224964-128224986 CCTGGAAAGCCAGATGTGGATGG - Intronic
1061644393 9:131988718-131988740 CTTGGGAGGCCAAAGGGGGAAGG - Intronic
1062306333 9:135908725-135908747 CAAGGAAAGCCATAGGAGGAGGG + Intergenic
1186140883 X:6572299-6572321 CTTGGGAAGCCAAAGTGGGAGGG + Intergenic
1186348233 X:8716615-8716637 GATGGGAGGCCACAAGAGGAGGG - Intronic
1186955144 X:14673515-14673537 GATGAGGAGCCAAATCAGGAAGG - Intronic
1188592805 X:31859887-31859909 CAATGGAAGTTAAATGAGGAAGG - Intronic
1189165540 X:38857419-38857441 TTTGGGAAACAAAATGAGGAGGG - Intergenic
1192044801 X:67660756-67660778 CATGGGTAGCTTGATGAGGATGG + Intronic
1192073509 X:67965723-67965745 CATGGGTAGCTTGATGAGGATGG - Intergenic
1192435247 X:71139358-71139380 CATGGGGACCAGAATGAGGATGG + Intronic
1194754695 X:97724539-97724561 CATGGGAATGCAAATTAGGATGG - Intergenic
1195596104 X:106691565-106691587 CATGGGAGGAGAAATGAGGCAGG + Intergenic
1196421873 X:115530891-115530913 CATAGTAAGAAAAATGAGGAAGG + Intergenic
1196756428 X:119161330-119161352 AAAGAGAGGCCAAATGAGGAAGG + Intergenic
1197838822 X:130723715-130723737 CCTGGGAAACAAAATGGGGAGGG - Intronic
1197867484 X:131034648-131034670 CAAAGGAAGCCAAAACAGGAGGG + Intergenic
1199850429 X:151721969-151721991 CATGAGAAGACAGGTGAGGAGGG + Exonic
1201353867 Y:13076345-13076367 CATTGGTAGCTTAATGAGGATGG - Intergenic