ID: 1091022875

View in Genome Browser
Species Human (GRCh38)
Location 11:132116559-132116581
Sequence TATAGTTACTACTATGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091022875_1091022880 5 Left 1091022875 11:132116559-132116581 CCACCCTCATAGTAGTAACTATA 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1091022880 11:132116587-132116609 TCCTTAACATCATTCAGAGCAGG 0: 1
1: 0
2: 1
3: 22
4: 136
1091022875_1091022882 26 Left 1091022875 11:132116559-132116581 CCACCCTCATAGTAGTAACTATA 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1091022882 11:132116608-132116630 GGAGTGTTCCTTCTACCTCAAGG 0: 1
1: 0
2: 2
3: 11
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091022875 Original CRISPR TATAGTTACTACTATGAGGG TGG (reversed) Intronic
904174860 1:28619826-28619848 TATAATTCCAACTATTAGGGAGG + Intronic
905586775 1:39126083-39126105 TATTGTTATTACTATGAGACAGG - Intronic
906887558 1:49667334-49667356 TATAGTTACTGCTATTTGGGAGG + Intronic
908061107 1:60350427-60350449 TATAGATACTACTATGTAGCAGG + Intergenic
910235054 1:85026875-85026897 TATAGTTCCAGCTACGAGGGAGG - Intronic
915715963 1:157945411-157945433 TACATTTACTACTATGATGGAGG + Intergenic
917510245 1:175663625-175663647 TATAGTGACTAAAAGGAGGGAGG + Intronic
919279198 1:195465061-195465083 TATTGTTACTAATATTTGGGGGG - Intergenic
919375947 1:196795216-196795238 TGTATTTACTACCATGAGTGGGG - Intronic
919969144 1:202561438-202561460 TATACTTACCACTATGACCGTGG - Intronic
1064048491 10:12040818-12040840 CATAGTAACTAGCATGAGGGAGG + Intronic
1064219067 10:13424358-13424380 TATAATTATTACTATGAGACTGG - Intergenic
1072145187 10:92629585-92629607 TAAAGGTATTAATATGAGGGTGG - Intronic
1074089193 10:110231368-110231390 TAAAGTTACTTTTTTGAGGGGGG - Intronic
1077723363 11:4649184-4649206 TATAGTTACTATTATCAAGAGGG + Intronic
1079955010 11:26851461-26851483 TATAGGAGCTACTATGCGGGAGG + Intergenic
1080245180 11:30172063-30172085 TATAGTAGCTACTATGAGCAAGG + Intergenic
1080591842 11:33731415-33731437 TATACTTACTACTGTGAAGTAGG + Intronic
1083108719 11:60383989-60384011 TATAGTTACTCATATGAACGGGG - Intronic
1086184209 11:83994305-83994327 GATAGTTACCACTTTGAAGGTGG + Intronic
1087534818 11:99429843-99429865 AATAGTTGTTACTATGGGGGCGG - Intronic
1088794658 11:113257500-113257522 TATGGTTACTGCTAAGAGGCAGG + Intronic
1089288227 11:117421222-117421244 TAGAGTTCCTACTATGTGGCGGG - Intergenic
1091022875 11:132116559-132116581 TATAGTTACTACTATGAGGGTGG - Intronic
1095378936 12:41565899-41565921 GATTGTTACTACTAAGAGTGGGG - Intronic
1098549755 12:71750386-71750408 TATAGTTCCAGCTATGTGGGAGG - Intergenic
1107336083 13:39357048-39357070 TATAGTTCCAACTACTAGGGAGG + Intronic
1108487255 13:50939396-50939418 TATAGTTCCAACTATTTGGGAGG + Intronic
1110104689 13:71657368-71657390 TATAGTTCCAACTACTAGGGAGG + Intronic
1110401922 13:75102019-75102041 AATAATTACTTCTTTGAGGGAGG - Intergenic
1110986021 13:81969500-81969522 TACAGTTACTACTATCACAGTGG + Intergenic
1111662984 13:91234540-91234562 AATAATTACAACTATGATGGGGG + Intergenic
1116141386 14:40999516-40999538 TATGGCTACTACTATGAGCTAGG - Intergenic
1117027585 14:51637098-51637120 TATAGTTCCAACTACGTGGGAGG + Intronic
1117511948 14:56460805-56460827 TATAATTACAGCTATGAGAGGGG - Intergenic
1119657041 14:76424643-76424665 TATAGTGTCTAGGATGAGGGAGG + Intronic
1125954426 15:43779611-43779633 TGTAGTTACAGCTATGAAGGAGG - Intronic
1127512207 15:59654083-59654105 TAGTGTGGCTACTATGAGGGTGG - Intronic
1140495591 16:75384425-75384447 TACAGTTACTACAATGATCGTGG + Intronic
1141502344 16:84452801-84452823 TCTAGTTACTATTATATGGGTGG + Intronic
1153494123 18:5680344-5680366 TATTGTTACTATCATGAGGCTGG + Intergenic
1154370865 18:13762043-13762065 TACGGTAACTATTATGAGGGAGG + Exonic
1158848546 18:61470427-61470449 CAAAGTTCCTACTGTGAGGGAGG + Intronic
1166243901 19:41512248-41512270 TATAGTTTCTAATATCTGGGGGG - Intergenic
1202643917 1_KI270706v1_random:123711-123733 TATTGTTACTAATATCTGGGGGG + Intergenic
925613701 2:5725316-5725338 TGTAGTTCCAGCTATGAGGGAGG - Intergenic
926208575 2:10851609-10851631 TATCCTTACTGCTATAAGGGAGG - Intronic
926852821 2:17219681-17219703 TATAGTTTGTACAATGAAGGTGG + Intergenic
928015235 2:27649895-27649917 TATTTTAGCTACTATGAGGGAGG + Intronic
931103371 2:59027792-59027814 CATAGATACTAATATGAGGAGGG + Intergenic
931757666 2:65388524-65388546 TATAGTGAGTACAGTGAGGGTGG + Intronic
933271822 2:80240916-80240938 TATAGTTAGAACTCTGAGGCTGG + Intronic
933378892 2:81517610-81517632 AGTAGTTACTCCTCTGAGGGTGG + Intergenic
934507504 2:94905631-94905653 TATTGTTTCTACTATGCAGGGGG + Intergenic
935077292 2:99757436-99757458 TATTGTTATTATTATGAGAGAGG - Intronic
935924863 2:108056334-108056356 TATAGTTCCAGCTATGTGGGAGG - Intergenic
936454446 2:112661475-112661497 TAAAGAGACTACAATGAGGGAGG - Intronic
938059667 2:128242507-128242529 TGTAGTCACAGCTATGAGGGAGG - Intronic
940827131 2:158425091-158425113 TCTAGTGACTACTATGATCGCGG + Intronic
941532126 2:166683172-166683194 TGTAATTACTACTCTTAGGGTGG + Intergenic
943748344 2:191485654-191485676 TATTATTATTACTATGAGGTGGG - Intergenic
944806574 2:203287582-203287604 TATGGTTACAACTACTAGGGAGG + Intronic
1171352072 20:24510637-24510659 TATAGTTACTACATTTAGTGTGG + Intronic
1172079312 20:32326907-32326929 TATATTTTCAAGTATGAGGGAGG + Intronic
1174903695 20:54527518-54527540 TTCAGTTCCCACTATGAGGGAGG + Intronic
1175086084 20:56460346-56460368 TATATTTAATATTATTAGGGTGG - Intronic
1177781714 21:25629276-25629298 TGTAGTTACAGCTATTAGGGAGG - Intergenic
1180358054 22:11858722-11858744 TATTGTTACTAATATCTGGGGGG - Intergenic
1181184391 22:21092260-21092282 TATAGTAACTACGAGGAAGGAGG + Intergenic
1184154654 22:42659421-42659443 TATAGTTTCAGCTATGGGGGAGG - Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
958128837 3:89391338-89391360 AATAGTTAAGACTAAGAGGGAGG - Intronic
958749000 3:98172720-98172742 CATACTTACTAGTATGAGGATGG - Intronic
960197135 3:114782326-114782348 AACAGTTACTACAATGGGGGAGG + Intronic
964470677 3:157051279-157051301 AATAGTTCATTCTATGAGGGTGG - Intergenic
965858832 3:173122661-173122683 TAGAGTTCCTACTATGAGCAAGG + Intronic
966634976 3:182122745-182122767 TATAGTAAGTATTATGAGAGAGG - Intergenic
967599596 3:191370012-191370034 GATAGTTACTATTATGAAGATGG + Exonic
968207723 3:196819139-196819161 TATAGTTTTTAAGATGAGGGAGG + Intronic
972106953 4:35500416-35500438 TATAGTTTCTACTATGTGTCAGG - Intergenic
972371296 4:38425690-38425712 TCTTGCTACTACTGTGAGGGAGG - Intergenic
972873933 4:43334669-43334691 TATAGTTAGTGCTATGAGTGAGG - Intergenic
974819241 4:67045229-67045251 TATTGTTACTTAAATGAGGGTGG + Intergenic
975975353 4:80089353-80089375 TACAGGTAATACTATGAGAGAGG - Intronic
976731208 4:88263790-88263812 TATAGTCCCAGCTATGAGGGAGG - Intronic
977563285 4:98555456-98555478 TGTGGTTAGTAATATGAGGGGGG - Intronic
977931689 4:102756957-102756979 TATAGTTCCTATTTTGTGGGAGG - Intronic
978574764 4:110178418-110178440 TATAGTCACTACTACTTGGGAGG + Intronic
979495257 4:121376155-121376177 TTTTGTTACTCATATGAGGGTGG - Intronic
981843429 4:149138331-149138353 TATAATTATAAATATGAGGGTGG + Intergenic
981878719 4:149581372-149581394 TGTAATAACTACAATGAGGGAGG - Intergenic
983167497 4:164496161-164496183 TATAGTTATTTCAGTGAGGGGGG - Intergenic
984249663 4:177316804-177316826 TATAGTAAGTACTATGACAGTGG + Intronic
984296322 4:177858790-177858812 TATAGTCCCAACTATGTGGGAGG + Intronic
985100079 4:186450178-186450200 TTTAGTGACGACTATGATGGCGG - Intronic
987021774 5:13880363-13880385 TATACTTACTTTTATGAGTGAGG - Intronic
993043061 5:82837161-82837183 TTTAGATAATACCATGAGGGTGG - Intergenic
998299284 5:141002401-141002423 TTTTGTTACTACTATTTGGGAGG - Intronic
1003771789 6:9312885-9312907 TATAGTTACTAATATTAGGTTGG + Intergenic
1007798221 6:44368788-44368810 CATAGTGACTACTATGTGGGTGG + Intronic
1009225200 6:61014881-61014903 TATAGTTTCTAATATCAAGGGGG - Intergenic
1009225895 6:61019863-61019885 TATTGTTTCTAATATAAGGGGGG - Intergenic
1009228060 6:61035570-61035592 TATTGTTTCTAATATCAGGGGGG - Intergenic
1009228586 6:61038893-61038915 TATTGTTACCAATATGTGGGGGG - Intergenic
1009364311 6:62846170-62846192 TATTGTTCCTAATATCAGGGAGG - Intergenic
1017512588 6:155127572-155127594 TCTAGTTTCTGCTGTGAGGGAGG - Exonic
1027256995 7:76437294-76437316 TATAATTCCAACTATTAGGGAGG - Intronic
1027281854 7:76614737-76614759 TATAATTCCAACTATTAGGGAGG + Intronic
1027616942 7:80434924-80434946 TTTAATTACTATTATGGGGGGGG - Intronic
1029301765 7:99586882-99586904 TATAGTTCCTAATATCCGGGAGG - Intronic
1030322655 7:108185595-108185617 TATAGTTCCAGCTATGGGGGAGG + Intronic
1030649280 7:112099787-112099809 TATATTTATAAATATGAGGGAGG - Intronic
1039374993 8:37024206-37024228 TATAGTGAGTAGTATGTGGGAGG - Intergenic
1039609486 8:38907975-38907997 TATAGTCACAACTATTGGGGAGG - Intronic
1042258503 8:66831750-66831772 TATTGTTAGTATTTTGAGGGTGG - Intronic
1045171852 8:99679348-99679370 TATGGTTATTACTAAGAGGGAGG + Intronic
1045926113 8:107580061-107580083 TATTGTTCCTAATATTAGGGGGG + Intergenic
1048949829 8:139487061-139487083 TATAGGGACTGGTATGAGGGTGG - Intergenic
1052570111 9:30209933-30209955 TCTATTTACTACTAGTAGGGTGG - Intergenic
1058518955 9:105800834-105800856 TATTGTTCCTAATATCAGGGTGG - Intergenic
1059154322 9:111976488-111976510 TATAGTTGCTATGATGGGGGAGG - Intergenic
1059511538 9:114852615-114852637 TATATTTACAACTATCAGGCTGG + Intergenic
1203743097 Un_GL000218v1:19162-19184 TATTGTTACTAATATCTGGGGGG - Intergenic
1185678787 X:1871194-1871216 TATAGTTCCTGCTATTTGGGAGG - Intergenic
1186177429 X:6939742-6939764 TGTAGTTCCAGCTATGAGGGAGG + Intergenic
1187422648 X:19149541-19149563 TATAGTCCCAACTATGTGGGAGG + Intergenic
1188793109 X:34429000-34429022 TATAGTTAGTACAACCAGGGTGG + Intergenic
1189804449 X:44721338-44721360 TAAGGCTACTACTTTGAGGGAGG - Intergenic
1192620773 X:72677924-72677946 TATAGTTCCAACTACTAGGGAGG + Intronic
1192911189 X:75606207-75606229 TATAGTGTCTACTATGAGCCAGG - Intergenic
1194729809 X:97439989-97440011 GATAGTTAATAACATGAGGGTGG + Intronic
1196187086 X:112755862-112755884 TATGGTTATTACTATGAGGAAGG - Intergenic
1196196668 X:112843995-112844017 TATAGTTCCAACTACTAGGGAGG + Intergenic
1196851392 X:119942350-119942372 TATAGTCCCAGCTATGAGGGAGG + Intronic
1197233054 X:124027571-124027593 TATAGCTACTACTGTGGGTGAGG + Intronic
1199674504 X:150175470-150175492 TTCATTTACTTCTATGAGGGAGG + Intergenic
1201156626 Y:11136631-11136653 TATTGTTACTAATATCTGGGGGG - Intergenic