ID: 1091023420

View in Genome Browser
Species Human (GRCh38)
Location 11:132121472-132121494
Sequence TTACTTAAATAAATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1765
Summary {0: 1, 1: 0, 2: 3, 3: 170, 4: 1591}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091023420_1091023423 16 Left 1091023420 11:132121472-132121494 CCCAGCTCCATTTATTTAAGTAA 0: 1
1: 0
2: 3
3: 170
4: 1591
Right 1091023423 11:132121511-132121533 AGAAAATATGAGTGAAAAGCTGG 0: 1
1: 0
2: 3
3: 48
4: 518
1091023420_1091023424 27 Left 1091023420 11:132121472-132121494 CCCAGCTCCATTTATTTAAGTAA 0: 1
1: 0
2: 3
3: 170
4: 1591
Right 1091023424 11:132121522-132121544 GTGAAAAGCTGGTTCATTATAGG 0: 1
1: 0
2: 1
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091023420 Original CRISPR TTACTTAAATAAATGGAGCT GGG (reversed) Intronic
901219044 1:7572572-7572594 TTTATTCAATAAATGGTGCTGGG - Intronic
901345997 1:8542806-8542828 TTAATTTAAAAAATGGAGATGGG - Intronic
902125743 1:14209412-14209434 TTACTTACTGAAATGGAGATGGG - Intergenic
905739512 1:40357658-40357680 TCTCTTCAATAAATGGTGCTAGG - Intronic
905903723 1:41600989-41601011 TCTCTTCAATAAATGGTGCTGGG - Intronic
906020407 1:42623467-42623489 TCTCTTCAATAAATGGTGCTGGG - Intronic
906334980 1:44921620-44921642 TCTCTTCAATAAATGGTGCTAGG - Intronic
906385681 1:45366692-45366714 GCATTTAAATAAATGGAGGTGGG + Intronic
906410190 1:45572444-45572466 TCTCTTCAATAAATGGTGCTGGG - Intergenic
906558488 1:46735143-46735165 TCTCTTCAATAAATGGTGCTGGG + Intergenic
906587209 1:46989807-46989829 TTCCCTTAATAAATGGTGCTGGG + Intergenic
906903437 1:49863197-49863219 TCTCTTCAATAAATGGTGCTGGG + Intronic
907014439 1:50998191-50998213 TCTCTTAAATAAATGGTGCTGGG + Intergenic
907100339 1:51827391-51827413 ATACTTAAATAAATCAAGCAGGG + Intronic
907802166 1:57780024-57780046 GTACTTAATTAAATGGATTTTGG + Intronic
908229054 1:62085983-62086005 TTTTTTAAATAAATAGAGATGGG + Intronic
908464423 1:64377809-64377831 TCTCTTCAATAAATGGTGCTGGG - Intergenic
908613399 1:65888180-65888202 TCTCTTCAATAAATGGTGCTAGG - Intronic
908706909 1:66967237-66967259 TCTCTTCAATAAATGGTGCTGGG - Intronic
909208903 1:72797165-72797187 TCTCTTCAATAAATGGTGCTGGG - Intergenic
909297304 1:73967176-73967198 TTCCTGTAATAAATGGTGCTGGG + Intergenic
909316651 1:74228578-74228600 TGTCTTCAATAAATGGTGCTGGG + Intronic
909482755 1:76143146-76143168 GTACTTAATGAAATGGATCTTGG + Intronic
909551489 1:76902792-76902814 TTTTTTAAACAAATGGTGCTAGG + Intronic
909690773 1:78405479-78405501 TCTCTTCAATAAATGGGGCTCGG - Intronic
909868209 1:80702635-80702657 GTGCTTTAATAAATGGTGCTGGG + Intergenic
910035966 1:82789586-82789608 TTATTTCAATAAACAGAGCTGGG - Intergenic
910103398 1:83602961-83602983 TCTCTTCAATAAATGGTGCTGGG + Intergenic
910193199 1:84615005-84615027 TTTCTTCAATAAATGGTGCTGGG + Intergenic
910230378 1:84980584-84980606 TCTCTTAAATAAATGGTGTTGGG + Intronic
910550777 1:88471742-88471764 TTGCTGAAATAAATGGTTCTTGG + Intergenic
910625735 1:89304404-89304426 TTTCTTCAATAAATGGTTCTGGG - Intergenic
910710689 1:90176783-90176805 TTACCTAAATAAAGGCAGCTTGG + Intergenic
910733572 1:90426364-90426386 TCTCTTTAATAAATGGTGCTGGG + Intergenic
911240952 1:95465629-95465651 TCTCTTCAATAAATGGTGCTGGG - Intergenic
911244032 1:95497031-95497053 GTACTTGCAAAAATGGAGCTGGG + Intergenic
911519713 1:98914095-98914117 TTTCTCATATAAATGGAGCATGG + Intronic
911679319 1:100696209-100696231 TGTCTTCAATAAATGGTGCTGGG - Intergenic
911744360 1:101423832-101423854 TTCCTTTAATAAATGGTGTTGGG + Intergenic
911932305 1:103920577-103920599 ATTATTCAATAAATGGAGCTGGG - Intergenic
911942577 1:104066625-104066647 TCACCTCAATAAATGGTGCTGGG - Intergenic
911989789 1:104679969-104679991 TTTCTTCAATAAATGGTGGTAGG + Intergenic
912016614 1:105045421-105045443 TTTCTTCAATAAATGGTTCTAGG + Intergenic
912018035 1:105066725-105066747 TCTCTTAAATAAATGGTGCTGGG - Intergenic
912117434 1:106424158-106424180 TATCTTCAATAAATGGTGCTGGG + Intergenic
912140905 1:106725760-106725782 TCTCTTCAATAAATGGTGCTGGG + Intergenic
912148347 1:106822661-106822683 TCTCTTCAATAAATGGTGCTGGG - Intergenic
912308233 1:108593175-108593197 ATACATAAATAAAAGGAGTTTGG + Intronic
912545089 1:110445065-110445087 TTAATTAAAAAAATGGAGATAGG + Intergenic
912614779 1:111087056-111087078 TCTCTTCAATAAATGGTGCTTGG - Intergenic
912632824 1:111261992-111262014 TCACTTCAATAAATTGTGCTGGG - Intergenic
912832178 1:112963142-112963164 TTTCTTCAATAAATGGTGCTGGG - Intergenic
912871990 1:113315965-113315987 TCTCTTCAATAAATGGTGCTGGG + Intergenic
913132438 1:115853488-115853510 CTTCTTCAATAAATGGTGCTGGG - Intergenic
913297022 1:117331987-117332009 TTAATTCAATAAATGGTGATGGG + Intergenic
913373492 1:118126919-118126941 CTTCTTCAATAAATGGTGCTGGG - Intronic
913381266 1:118213280-118213302 TCTCTTCAATAAATGGTGCTGGG - Intergenic
913466899 1:119152169-119152191 ATAAATAAATAAATGGTGCTGGG - Intergenic
913524096 1:119674699-119674721 TTACTTTTACAAATGTAGCTTGG - Intronic
914383414 1:147142145-147142167 TCTCTTAAACAAATGGTGCTTGG - Intergenic
914439131 1:147687845-147687867 CTTCTTCAATAAATGGTGCTAGG + Intergenic
914895767 1:151671017-151671039 TCTCTTCAATAAATGGTGCTGGG - Intronic
914985540 1:152453844-152453866 TATCTTCAATAAATGGTGCTGGG - Intergenic
915337614 1:155155502-155155524 TCTCTTTAATAAATGGTGCTGGG + Intergenic
915371264 1:155352631-155352653 TTTTTTAAATAAATAGAGATAGG - Intronic
915697330 1:157757253-157757275 GTACTTCAATATATGGAGTTTGG - Intronic
915857295 1:159403018-159403040 TCTCTTCAATAAATGGTGCTGGG + Intergenic
915877385 1:159626078-159626100 TGACTTAAATAAATTGATATTGG + Intergenic
916187932 1:162151194-162151216 TCTCTTCAATAAATGGTGCTGGG - Intronic
916823273 1:168420692-168420714 TGAATTAAATAAGTGGAGCCTGG + Intergenic
917167710 1:172131522-172131544 TTACCTGAAGAAATGGAGGTAGG + Intronic
917300217 1:173565440-173565462 TCTCTTCAATAAATGGTGCTGGG - Intronic
917306729 1:173633747-173633769 TCTCTTCAATAAATGGTGCTGGG + Intronic
917375217 1:174345018-174345040 TCTCTTCAATAAATGGTGCTGGG - Intronic
917395527 1:174589692-174589714 TCTCTTCAATAAATGGTGCTGGG - Intronic
917459132 1:175213620-175213642 TCTCTTCAATAAATGGTGCTGGG - Intergenic
917559037 1:176125458-176125480 TCTCTTAAATAAATGGTGCTTGG - Intronic
917841379 1:178982487-178982509 CTTCTTCAATAAATGGTGCTGGG + Intergenic
917919228 1:179735936-179735958 TCTCTTCAATAAATGGGGCTGGG + Intergenic
918401658 1:184168918-184168940 TCTCTTCAATAAATGGTGCTGGG - Intergenic
918452712 1:184675212-184675234 TTTCTTCAATAAAAGGTGCTGGG + Intergenic
918539415 1:185612838-185612860 TCTCTTCAATAAATGGTGCTGGG - Intergenic
918578656 1:186097959-186097981 TCTCTTCAATAAATGGTGCTGGG + Intronic
918644907 1:186892527-186892549 TCTCTTCAATAAATGGTGCTGGG - Intronic
918701220 1:187610683-187610705 TCTCTTCAATAAATGGTGCTGGG + Intergenic
918732483 1:188015363-188015385 TTACTTAAAATAATTGAGCTTGG + Intergenic
918850841 1:189687768-189687790 TCAATTAAACAAATGGTGCTGGG - Intergenic
918944347 1:191042098-191042120 TTTCTGCAATAAATGGAGTTGGG + Intergenic
919146962 1:193647787-193647809 TTTCTTCAGTAAATGGTGCTGGG - Intergenic
919173000 1:193979978-193980000 TTACTTAAGTAAATGCAGAAAGG + Intergenic
919236220 1:194846118-194846140 TTTCTTTAATAAACGGTGCTAGG + Intergenic
919236651 1:194854128-194854150 TCTCTTTAATAAATGGTGCTAGG + Intergenic
919286761 1:195573197-195573219 TCTCTTCAATAAATGGTGCTGGG + Intergenic
919328843 1:196143185-196143207 TTATTCAAATAAATGGAGTTTGG - Intergenic
919523358 1:198616915-198616937 TTTCTTCAGTAAATGGTGCTGGG + Intergenic
919962205 1:202482976-202482998 TTTCTTCAATAAATGCTGCTGGG - Intronic
920283872 1:204865508-204865530 TTTCTTCAACAAATGGTGCTAGG - Intronic
920384495 1:205559989-205560011 TCTCTTAAATAAATGGTGCTGGG + Intergenic
920745372 1:208622746-208622768 TCTCTTCAATAAATGGTGCTGGG + Intergenic
920768991 1:208862505-208862527 CTAATTCAATAAATGGTGCTGGG + Intergenic
920858197 1:209681089-209681111 TCTCTTCAATAAATGGTGCTGGG - Intergenic
920936069 1:210436192-210436214 TCTCTTCAATAAATGGTGCTGGG - Intronic
921038075 1:211401824-211401846 TCTCTTCAATAAATGGTGCTGGG - Intergenic
921044289 1:211462608-211462630 TCTCTTCAATAAATGGTGCTGGG + Intergenic
921120897 1:212136376-212136398 TATCTTCAATAAATGGTGCTGGG + Intergenic
921147560 1:212373264-212373286 TCTCTTCAATAAATGGTGCTGGG + Intronic
921164021 1:212493375-212493397 TTAATTAAAAAAATAGAGATGGG + Intergenic
921237417 1:213147428-213147450 TTTCTTCAATAAATGGTACTGGG - Intronic
921295720 1:213700282-213700304 TCTCTTCAATAAATGGTGCTGGG - Intergenic
921457137 1:215385620-215385642 TCTCTTCAATAAATGGTGCTGGG + Intergenic
921640438 1:217546517-217546539 TCCCTTCAATAAATGGTGCTGGG + Intronic
921775383 1:219093432-219093454 TCTCTTAAATAAATTGTGCTAGG + Intergenic
922101554 1:222481477-222481499 AAAATTAAATAAATGTAGCTAGG - Intergenic
922262635 1:223956593-223956615 AAAATTAAATAAATGTAGCTAGG - Intergenic
922392681 1:225162240-225162262 GTACTTCAATAAATGGTGCTGGG - Intronic
922549913 1:226486921-226486943 TCTCTTTAATAAATGGTGCTGGG - Intergenic
922642608 1:227249190-227249212 TCTCTTCAATAAATGGTGCTGGG + Intronic
922976518 1:229788755-229788777 TTTATTTAATAAATGGTGCTGGG + Intergenic
923258312 1:232241618-232241640 TCTCTTCAATAAATGGTGCTGGG + Intergenic
923459871 1:234199396-234199418 TCTCTTCAATAAATGGTGCTGGG + Intronic
923658849 1:235941349-235941371 ATATTTAAACAAATGGAGCCAGG - Intergenic
923691956 1:236202941-236202963 AGACTTCAATAAATGGTGCTGGG - Intronic
923720301 1:236461382-236461404 TCTCTTCAATAAATGGTGCTGGG - Intronic
923960452 1:239076672-239076694 TCTCTTCAATAAATGGTGCTGGG + Intergenic
924061436 1:240178988-240179010 TAACTTAAAAGCATGGAGCTTGG + Intronic
924192639 1:241570509-241570531 TCTCTTCAATAAATGGTGCTGGG - Intronic
924239647 1:242028847-242028869 TTAATTTAATAAATAGAGATGGG + Intergenic
924242264 1:242052689-242052711 TTTCTTCAATAAATAGGGCTGGG + Intergenic
924344474 1:243061594-243061616 AAAATTAAATAAATGTAGCTAGG - Intergenic
924361907 1:243250168-243250190 TTACATAAATAAAAGATGCTGGG - Intronic
924618548 1:245637733-245637755 TCTCTTTAATAAATGGTGCTGGG - Intronic
1062765746 10:63556-63578 TTACTTAAAAAAATTGATCAAGG - Intergenic
1062772152 10:110754-110776 TTATTTAAATAAATGTATTTTGG - Intergenic
1062847567 10:719328-719350 TTACTTAAAAAAATAGAATTGGG + Intergenic
1063736556 10:8762012-8762034 TAACTTAAGTAAATTGAGATGGG - Intergenic
1063829756 10:9938919-9938941 GAACATAAAAAAATGGAGCTGGG - Intergenic
1064078883 10:12292259-12292281 TTTTTTAAATAAATAGAGATGGG - Intergenic
1064447031 10:15404583-15404605 TTTCTTCAATAAACGGTGCTGGG + Intergenic
1064696373 10:17970020-17970042 TCTCTTCAATAAATGGTGCTGGG - Intronic
1064889492 10:20154070-20154092 TTTCTTAAATACATGGAGTTTGG + Intronic
1065248263 10:23781801-23781823 TCTCTTCAATAAATGGTGCTGGG - Intronic
1065353698 10:24818552-24818574 TTTCTTAGATAAATAGAGCCAGG + Intergenic
1065609178 10:27454127-27454149 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1066172394 10:32863659-32863681 TCTCTTCAATAAATGGTGCTGGG + Intronic
1066327424 10:34377311-34377333 TAACTAAACTAAATGGGGCTGGG + Intronic
1066362599 10:34745642-34745664 TTGCTTAAAAAATTGTAGCTGGG + Intronic
1066700498 10:38122588-38122610 TGTCTTTAATAAATGGTGCTGGG + Exonic
1066731858 10:38443478-38443500 AAAATTAAATAAATGTAGCTAGG + Intergenic
1066748285 10:38625236-38625258 ATACTTACATAAATGGAGAGAGG + Intergenic
1067764909 10:49077574-49077596 TTTCTTCAATCAATGGTGCTGGG + Intronic
1067799080 10:49345778-49345800 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1067958055 10:50815285-50815307 TTTCTTGAAGAAATGGAGCTTGG + Intronic
1068069307 10:52176248-52176270 TCCCTTCAATAAATGGTGCTAGG - Intronic
1068155853 10:53197632-53197654 TCACTTCAACAAATGGAGCCAGG - Intergenic
1068232652 10:54190819-54190841 TTATAAAAATAAATGGTGCTCGG + Intronic
1068356617 10:55918167-55918189 TGTCTTCAATAAATGGTGCTAGG - Intergenic
1068377287 10:56197324-56197346 TCAATTTAATAAATGGTGCTGGG - Intergenic
1068640570 10:59400940-59400962 CTATTTAAACAAATGGTGCTGGG - Intergenic
1068696850 10:59976858-59976880 TTACATTAATAAATGTGGCTGGG - Intergenic
1068732848 10:60378604-60378626 TTCCTTCAATAATTGGTGCTGGG + Intronic
1068833859 10:61530278-61530300 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1068903437 10:62296524-62296546 TCATTTAAATAGATGGTGCTGGG + Intergenic
1068918533 10:62459636-62459658 TTACTTAAATGAATGGAACATGG + Intronic
1069234595 10:66054954-66054976 TATCTTCAATAAATGGTGCTGGG - Intronic
1069262782 10:66419796-66419818 TTTCTTCAATAAATAGTGCTGGG + Intronic
1069322665 10:67191990-67192012 TCTCTTCAATAAATGGTGCTGGG + Intronic
1069358870 10:67619375-67619397 TTTCTTCAATAAATGGTGCTAGG + Intronic
1070024996 10:72623881-72623903 TTAATTAATTAAATGGAGATGGG - Intronic
1070058869 10:72962026-72962048 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1070060226 10:72975345-72975367 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1070235515 10:74621302-74621324 TTTCTTCAATAAATGATGCTGGG - Intronic
1070261764 10:74863021-74863043 TTACTTAAATAACATGAGGTGGG - Intronic
1070317401 10:75328325-75328347 TTTCTTCAATAAATGGTGTTAGG - Intergenic
1070478419 10:76853544-76853566 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1070584735 10:77755251-77755273 TCTCTTCAATAAATGGTGCTAGG + Intergenic
1070941450 10:80351795-80351817 ATATCTAAATAACTGGAGCTGGG + Intronic
1071081598 10:81819191-81819213 TTACTAAAATATAATGAGCTGGG + Intergenic
1071113302 10:82188220-82188242 TCACTTCAATAAGTGGTGCTGGG + Intronic
1071116306 10:82224526-82224548 TTACTTAAAAGAATTGTGCTGGG - Intronic
1071582106 10:86781263-86781285 TCTCTTCAATAAATGGTGCTGGG - Intronic
1072114712 10:92359259-92359281 TTTCCTTAATAAATGGTGCTGGG - Intergenic
1072347978 10:94527804-94527826 TCTCTTCAATAAATGGTGCTGGG - Intronic
1072369460 10:94749772-94749794 TTTCTTCAATAAATGGTGCTGGG - Intronic
1072398851 10:95075443-95075465 TTTTTTCAATAAATGGTGCTAGG - Intergenic
1072645981 10:97254442-97254464 TTTCTTCAACAAATGGTGCTGGG + Intronic
1072878121 10:99196115-99196137 TCTCTTCAATAAATGGTGCTGGG + Intronic
1072953057 10:99865025-99865047 CTAATTTAATAAATGGTGCTGGG - Intergenic
1073669337 10:105570184-105570206 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1073672140 10:105603687-105603709 CCTCTTAAATAAATGGAGCTGGG + Intergenic
1073807568 10:107115512-107115534 TCACTTCAATAAATGATGCTTGG + Intronic
1073826849 10:107333812-107333834 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1073844568 10:107539616-107539638 TTCCTTCAATAAATTGTGCTTGG + Intergenic
1073897725 10:108182765-108182787 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1074173242 10:110966966-110966988 TAACTTAGATACATGGATCTGGG + Intronic
1074469983 10:113718218-113718240 TGTCTTCAATAAATGGTGCTGGG - Intronic
1074637634 10:115338954-115338976 ATTCTTCAATAAATGGTGCTGGG - Intronic
1075012117 10:118882393-118882415 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1075148618 10:119905973-119905995 TGACCTCAAGAAATGGAGCTAGG + Intronic
1075355731 10:121772646-121772668 TTACTGAAAGATATGGAGCTTGG - Intronic
1075596423 10:123733075-123733097 TCTCTTAAATTAAAGGAGCTAGG + Intronic
1075830124 10:125402078-125402100 TCTCTTAAATAAATGGTGCTGGG - Intergenic
1076377095 10:129997914-129997936 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1076407793 10:130224795-130224817 ATTCTTCAATAAAAGGAGCTGGG - Intergenic
1077872754 11:6276913-6276935 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1077912411 11:6584863-6584885 TCTCTTCAATAAATGGTGCTGGG + Intronic
1077990638 11:7407770-7407792 ATTCTTCAATAAATGGTGCTGGG - Intronic
1078193133 11:9109946-9109968 ATAAATAAATAAATGAAGCTAGG + Intronic
1078384463 11:10875963-10875985 TCTATTCAATAAATGGAGCTGGG - Intergenic
1078554503 11:12310408-12310430 TTTCTTAAATAAATAGTGCTGGG - Intronic
1078692095 11:13592198-13592220 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1078786237 11:14496955-14496977 TCCCTTCAATAAATGGTGCTTGG + Intronic
1078881980 11:15460634-15460656 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1078915822 11:15777828-15777850 TTTCTCAAATGAATGGAACTGGG - Intergenic
1078960788 11:16266950-16266972 TCTCTTCAATAGATGGAGCTGGG + Intronic
1079228478 11:18628870-18628892 TTTTTTAAATACATGGAGCTTGG + Intronic
1079275549 11:19032901-19032923 TTTATTTAATAAATGGTGCTGGG - Intergenic
1079625610 11:22613160-22613182 TTCAATAAATAAATGGTGCTGGG - Intergenic
1079687277 11:23375427-23375449 TATCTTCAATAAATGGTGCTTGG + Intergenic
1079710312 11:23675242-23675264 CTTATTAAATAAATGTAGCTGGG + Intergenic
1079728873 11:23915178-23915200 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1079808710 11:24968097-24968119 TCAATTAAATAAGAGGAGCTTGG - Intronic
1079843235 11:25429906-25429928 CTATTTAAATAAATGGTGCTGGG + Intergenic
1080315848 11:30947470-30947492 CTTCTTCAATAAATGGTGCTGGG + Intronic
1080360138 11:31503986-31504008 TTTTTTCAATAAATGGTGCTAGG + Intronic
1080704297 11:34675231-34675253 TTTCTTCAATAAATGGTTCTAGG - Intergenic
1080706534 11:34700836-34700858 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1080889095 11:36393409-36393431 TCTCTTTAATAAATGGTGCTGGG - Intronic
1080908444 11:36571071-36571093 GTATTTAAATAAATGTAGTTTGG + Intronic
1081143912 11:39537194-39537216 TTTCTTCAATAAATTGTGCTGGG - Intergenic
1081409360 11:42738389-42738411 TAATTTAAAAAAAAGGAGCTTGG + Intergenic
1081504506 11:43701568-43701590 TCTCTTGAATAAATGGTGCTAGG - Intronic
1081775803 11:45675244-45675266 TTACCTACACAAAAGGAGCTGGG - Intergenic
1082111154 11:48275981-48276003 TTTCTTCAATAAATGGTGCTTGG - Intergenic
1082190615 11:49238710-49238732 TCACTTCAATAAATGGTGTTAGG + Intergenic
1082618667 11:55394497-55394519 TTTATTTAATAAATGGTGCTGGG - Intergenic
1082727231 11:56750828-56750850 TTTTTTAAATAAATGAGGCTGGG - Intergenic
1082754630 11:57062362-57062384 CTTCTTTAATAAATGGTGCTGGG + Intergenic
1082784383 11:57308887-57308909 TTCCTTAAATCAAGGGAGCGTGG - Exonic
1082923348 11:58519820-58519842 TTACTTAAAATAATTCAGCTTGG - Intergenic
1083040874 11:59685327-59685349 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1084437279 11:69151088-69151110 TTTATTCAATAAATGGTGCTGGG + Intergenic
1084763354 11:71289002-71289024 TCACTTCAATAAATGGTGCTGGG - Intergenic
1084803217 11:71560036-71560058 GTACTTCAACAAATGGTGCTGGG + Intronic
1084989121 11:72906658-72906680 TCAGTTTAATAAATGGTGCTGGG - Intronic
1085072283 11:73557932-73557954 TTTCTTCAACAAATGGTGCTTGG + Intronic
1085178963 11:74516894-74516916 TTTGTTCAATAAATGGTGCTGGG + Intronic
1085682432 11:78589810-78589832 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1085749047 11:79143707-79143729 ATAAATAAATAAATGGTGCTGGG + Intronic
1085814540 11:79723338-79723360 TCTCTTCAATAAATGGTGCTAGG + Intergenic
1085842286 11:80026200-80026222 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1085850520 11:80114258-80114280 TTTATTTAATAAATGGTGCTGGG + Intergenic
1085979004 11:81698943-81698965 CTTCTTCAATAAATGGTGCTGGG + Intergenic
1086050205 11:82580408-82580430 CTTCTTTAATAAATGGTGCTGGG + Intergenic
1086184334 11:83995732-83995754 TCTCTTCAATAAATGGTGCTGGG + Intronic
1086720510 11:90115583-90115605 TCTCTTCAATAAATGGTGCTTGG + Intergenic
1086767291 11:90712901-90712923 TTTCTAAAATAAATGCTGCTGGG - Intergenic
1086771393 11:90771862-90771884 TTTCTTCAATAAATGGTTCTGGG + Intergenic
1086991708 11:93310937-93310959 TCCCTTCAATAAATGGTGCTGGG + Intergenic
1087133454 11:94690663-94690685 TTTCTTCAATAAATGGTGTTGGG + Intergenic
1087380045 11:97393920-97393942 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1087399505 11:97647158-97647180 TCTCTTCAATAAATGGTGCTAGG + Intergenic
1087401967 11:97678801-97678823 TCTCTTCAATAAATGGTGCTAGG - Intergenic
1087460603 11:98440785-98440807 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1087493943 11:98864946-98864968 TATCTTCAATAAATGGTGCTGGG + Intergenic
1087699356 11:101418111-101418133 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1087878483 11:103387734-103387756 CTATTTTAATAAATGGTGCTGGG - Intronic
1087955603 11:104283252-104283274 TTAATTAAATACATGAAGTTAGG + Intergenic
1088040673 11:105377215-105377237 CTTCTTAAATAAAAGTAGCTAGG - Intergenic
1088056485 11:105586269-105586291 TTGCTTCAATAAATTGTGCTTGG - Intergenic
1088375577 11:109137362-109137384 TTTCTTCAATAAATGGTACTGGG - Intergenic
1088406372 11:109484127-109484149 TCTCTTCAATAAATGGTGCTAGG + Intergenic
1088491709 11:110394854-110394876 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1088643194 11:111893871-111893893 TCTCTTTAATAAATGGTGCTGGG + Intergenic
1088667754 11:112110810-112110832 TCACTTCAATAAATGGTGCTGGG - Intronic
1088848680 11:113688323-113688345 TTACTAAAATAAAAGTCGCTTGG - Intronic
1088985653 11:114905132-114905154 TTTCTTCAATAAATGGTGCTAGG + Intergenic
1089545057 11:119217692-119217714 TTTTTTAAATAAATGGAAGTTGG + Intronic
1089907166 11:122052304-122052326 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1089919387 11:122193964-122193986 TTACCTAACTAAATTAAGCTGGG + Intergenic
1089946928 11:122485395-122485417 TCTCTTTAATAAATGGTGCTGGG + Intergenic
1090317867 11:125812044-125812066 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1090495029 11:127203278-127203300 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1090877134 11:130800828-130800850 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1091023420 11:132121472-132121494 TTACTTAAATAAATGGAGCTGGG - Intronic
1091598754 12:1903123-1903145 TCTCTTCAATAAATGGTGCTGGG + Intronic
1091867016 12:3848558-3848580 TCTCTTCAATAAATGGTGCTGGG + Intronic
1091966655 12:4748453-4748475 TCTCTTCAATAAATGGTGCTGGG - Intronic
1092493888 12:8972543-8972565 TTTCTTCAATAAATGGTGTTGGG - Intronic
1092605556 12:10114576-10114598 ATACTTGAATAACTGAAGCTTGG - Intergenic
1092685782 12:11044200-11044222 TCTCTTCAATAAATGGTGCTGGG + Intronic
1092691619 12:11117826-11117848 TCTCTTCAATAAATGGTGCTGGG + Intronic
1092855241 12:12667052-12667074 TTATCTAAATTAATGGAGCAGGG - Intronic
1092927522 12:13285125-13285147 TCTCTTTAATAAATGGTGCTGGG + Intergenic
1093123637 12:15302453-15302475 TCTCTTTAATAAATGGTGCTGGG + Intronic
1093202214 12:16201871-16201893 TCTCTTCAATAAATGGTGCTGGG + Intronic
1093242414 12:16694155-16694177 TTTCTTCAATAAATGGTGTTGGG + Intergenic
1093271706 12:17070433-17070455 ATACTTCAATAAATGGTGCTGGG + Intergenic
1093419586 12:18959406-18959428 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1093550702 12:20406928-20406950 TGTCTTTAATAAATGGTGCTTGG - Intronic
1093584100 12:20817413-20817435 TCACTTCAATAAATGGTGCTAGG - Intronic
1093674543 12:21921804-21921826 TCACTTCAATAAATGGTTCTGGG - Intronic
1093825124 12:23675458-23675480 TCTCTTCAATAAATGGTGCTGGG + Intronic
1093887582 12:24480170-24480192 TCACTTCAATAAATGGTGTTGGG + Intergenic
1094188811 12:27675586-27675608 CCACTTCAATAAATGGTGCTGGG + Intronic
1094213427 12:27916630-27916652 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1094345024 12:29458402-29458424 TCACTTTGATAAATGGTGCTGGG + Intronic
1094758631 12:33501586-33501608 TTTCTTAAAAAAATGGTCCTGGG - Intergenic
1094759129 12:33509471-33509493 TTTCTTCAATAAATGGTGTTAGG + Intergenic
1094761821 12:33542255-33542277 TTTCTTTAATAAATGGTGCTGGG + Intergenic
1094790856 12:33913270-33913292 TTTATTCAATAAATGGTGCTAGG - Intergenic
1094805625 12:34088090-34088112 TGTATTTAATAAATGGAGCTGGG + Intergenic
1095134198 12:38578616-38578638 TGTCTTCAATAAATGGTGCTGGG + Intergenic
1095163721 12:38946975-38946997 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1095361201 12:41342107-41342129 TTTATTCAATAAATGGTGCTGGG + Intronic
1095408725 12:41898295-41898317 TTTATTCAATAAATGGTGCTGGG + Intergenic
1095432800 12:42152200-42152222 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1095565206 12:43614955-43614977 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1095710025 12:45278257-45278279 TTCCTTTAAAAAATGGAGTTGGG - Intronic
1095911839 12:47435446-47435468 CTTCTTCAATAAATGGTGCTGGG + Intergenic
1096014223 12:48253332-48253354 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1096040836 12:48515343-48515365 TTTCTTCAATAAATGGTGCTGGG - Intronic
1096442629 12:51657850-51657872 TTTCTTCAATAAATGGTGCCGGG - Intronic
1096889010 12:54747424-54747446 TCAATTCAATAAATGGTGCTGGG + Intergenic
1096930782 12:55207106-55207128 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1097520608 12:60665157-60665179 TCACTTCAATAAATGTTGCTGGG - Intergenic
1097536719 12:60881072-60881094 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1097551939 12:61083953-61083975 TGTCTTCAATAAATGGATCTAGG + Intergenic
1097552229 12:61088903-61088925 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1097609491 12:61801516-61801538 TCTCTTCAATAAATGGATCTGGG + Intronic
1097682357 12:62660598-62660620 TCTCTTCAATAAATGGTGCTGGG + Intronic
1097701999 12:62829776-62829798 TTCCTTCTAGAAATGGAGCTGGG - Intronic
1097714275 12:62949225-62949247 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1097716924 12:62976775-62976797 TTTTTTAAATAAAAGCAGCTGGG - Intergenic
1097721972 12:63031519-63031541 TTTATTTAATAAATGGTGCTGGG - Intergenic
1097816993 12:64085774-64085796 TAACTTAAATAAGTAGAACTGGG + Intronic
1097933706 12:65220801-65220823 TCTCTTCAATAAATGGTGCTAGG - Intronic
1098142570 12:67465483-67465505 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1098240005 12:68457279-68457301 TTTCTTCAATAAATGGTGCTGGG + Intergenic
1098249520 12:68554664-68554686 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1098609233 12:72434082-72434104 TTTCTTAAATAAATGTTTCTTGG + Intronic
1098786316 12:74761136-74761158 TCAGTTAAATAAACAGAGCTTGG - Intergenic
1098789162 12:74798605-74798627 TTTCTTCAATAAATGGTGCTGGG + Intergenic
1099003675 12:77211794-77211816 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1099043322 12:77683246-77683268 TATCTTTAATAAATGGTGCTTGG - Intergenic
1099059001 12:77882339-77882361 CTATTTCAATAAATGGTGCTGGG + Intronic
1099192879 12:79578627-79578649 TTTCTTCAATAAATGGTGCTAGG + Intronic
1099207012 12:79740102-79740124 TTATTAAAATAAATGTAGCCAGG - Intergenic
1099242776 12:80157658-80157680 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1099271683 12:80518709-80518731 TCTCTTCAATAAATGGTGCTGGG - Intronic
1099323314 12:81179052-81179074 TCCATTCAATAAATGGAGCTAGG + Intronic
1099409836 12:82311718-82311740 TTTATTTAATAAATGGTGCTGGG - Intronic
1099423582 12:82494809-82494831 TTTCTTCAATAAATGATGCTGGG + Intergenic
1099509435 12:83515736-83515758 TTACTTATATAAATTTATCTAGG - Intergenic
1099652823 12:85450430-85450452 TTTCTTCAATAAATGGTGCTTGG - Intergenic
1099701479 12:86088131-86088153 GTGCTTCAATAAATGGTGCTGGG + Intronic
1099714803 12:86277628-86277650 TCTCTTAAATAAATGGTGTTGGG - Intronic
1099840764 12:87962943-87962965 TGTCTTCAATAAATGGAACTGGG - Intergenic
1100387419 12:94116632-94116654 TGCCTTAAATAAATGGTGTTGGG - Intergenic
1100425402 12:94480393-94480415 TTAATGAAAAAAATGGACCTAGG + Intergenic
1100582902 12:95952285-95952307 TCTCTTCAATAAATGGTGCTAGG - Intronic
1100729738 12:97451501-97451523 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1100904194 12:99278747-99278769 TTAATAAAATAAATGGAGAAAGG + Intronic
1101034628 12:100693171-100693193 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1101117399 12:101545403-101545425 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1101303954 12:103508620-103508642 ATAAATAAATAAATGGTGCTAGG - Intergenic
1101378825 12:104194891-104194913 TATCTTCAATAAATGGTGCTGGG - Intergenic
1101566969 12:105916165-105916187 TCACTTCAATAAATGGTGTTGGG - Intergenic
1102267390 12:111498956-111498978 TCTCTTCAATAAATGGTGCTGGG + Intronic
1102676342 12:114661886-114661908 TGAATTAAATAGATGGAGATTGG + Intergenic
1102690268 12:114755118-114755140 ATACAAAAATAAATGGAGCATGG - Intergenic
1103383945 12:120517057-120517079 TTAATTAAAGAAATTGGGCTGGG + Intronic
1103741810 12:123096238-123096260 TTGCGTAAATAAATGGTGCCTGG - Intronic
1103802767 12:123550030-123550052 GTACTTTAATAATTGGAACTGGG + Intergenic
1103964736 12:124631691-124631713 CTAATTAAATAAATGGAGAGAGG - Intergenic
1104050811 12:125192478-125192500 TTTCTAAAATAAATGGGGGTTGG - Intronic
1104102694 12:125628881-125628903 TCTCTTCAATAAATGGTGCTGGG - Intronic
1105565570 13:21544070-21544092 TCTCTTCAATAAATGGTGCTGGG + Intronic
1106163532 13:27221389-27221411 TTCATTCAATAAATGGTGCTGGG + Intergenic
1106349587 13:28916030-28916052 TTTTTTCAATAAATGGTGCTGGG - Intronic
1106441089 13:29771441-29771463 TTACGTGCATAAATGGTGCTTGG - Intronic
1106910803 13:34461580-34461602 TTGCTTAAAGCCATGGAGCTTGG + Intergenic
1106919243 13:34545576-34545598 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1106921474 13:34568722-34568744 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1107089853 13:36466777-36466799 TTTCTTCAATAAATGGTGCTGGG - Intergenic
1107098864 13:36566422-36566444 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1107265532 13:38549173-38549195 TTTCTTTAATAAATGGCACTGGG - Intergenic
1107582794 13:41809512-41809534 TTTCTTCAATAAATGGTGCTGGG + Intronic
1108037169 13:46303157-46303179 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1108158101 13:47609043-47609065 TGTCTTCAATAAATGGTGCTGGG + Intergenic
1108231989 13:48354826-48354848 TCTCTTCAATAAATGGTGCTGGG + Intronic
1108239703 13:48450360-48450382 TTAAATAAATAAATGGTCCTCGG - Intronic
1108664248 13:52613879-52613901 TCCCTTCAATAAATGGTGCTGGG + Intergenic
1108878764 13:55082765-55082787 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1109031469 13:57195267-57195289 TTTCTTCAATAAATGGTGCTGGG - Intergenic
1109615029 13:64822562-64822584 TCTCTTCAATAAATGGTGCTAGG + Intergenic
1109644396 13:65234577-65234599 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1109688461 13:65852152-65852174 TTACAGACATAAATGGAACTTGG - Intergenic
1109780549 13:67105790-67105812 ATACTTAAATACATTGATCTTGG - Intronic
1109892802 13:68638721-68638743 TCTCTTCAATAAATGGAGCTGGG - Intergenic
1109934072 13:69258328-69258350 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1110067999 13:71133249-71133271 TGACTTAAATACATGGATTTGGG + Intergenic
1110078556 13:71281620-71281642 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1110448312 13:75613062-75613084 TATCTTAAGTAAATGGTGCTGGG - Intergenic
1110476642 13:75922875-75922897 TTTCTTTAATAAATGGTTCTGGG + Intergenic
1110491639 13:76116903-76116925 CTTCTTCAATAAATGGTGCTGGG + Intergenic
1110888778 13:80672200-80672222 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1110949750 13:81470930-81470952 TCTCTTTAATAAATGGTGCTGGG + Intergenic
1110959474 13:81603267-81603289 TTACTTAAATAAATTTATATTGG - Intergenic
1111007469 13:82266734-82266756 TTTCTTTAATAAATGGTGTTTGG - Intergenic
1111016952 13:82393827-82393849 TATCTTTAATAAATGGTGCTGGG + Intergenic
1111284494 13:86071121-86071143 TTAATTTAATAACTGGTGCTAGG + Intergenic
1111410500 13:87871021-87871043 TTGATTAAATATATGGAGCATGG + Intergenic
1111479193 13:88799908-88799930 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1111490935 13:88974250-88974272 TCACTTCACTAAATGGTGCTGGG + Intergenic
1111650416 13:91083618-91083640 TTAATTAAATAAATGGATCTTGG + Intergenic
1112055497 13:95686604-95686626 CTAATTCAATAAATGGTGCTGGG - Intronic
1112088987 13:96062420-96062442 TCACTTCAATAAATGGTGCTGGG + Intergenic
1112532011 13:100213963-100213985 TCTCTTCAATAAATGGTGCTCGG - Intronic
1112618412 13:101029214-101029236 TTTCTTCAATAAATGGTTCTGGG - Intergenic
1112639166 13:101253720-101253742 TTATTTACAAAAATGGATCTTGG - Intronic
1113285428 13:108841982-108842004 TTACTTTAATAATTGGTACTAGG + Intronic
1114127076 14:19741026-19741048 TCTCTTCAATAAATGGTGCTGGG + Intronic
1114326779 14:21597114-21597136 GTCCTTTAATAAATGGTGCTGGG + Intergenic
1114593213 14:23888491-23888513 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1114687327 14:24546038-24546060 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1114761244 14:25317124-25317146 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1114922619 14:27351915-27351937 TTAATTAAATGAATGCAGATTGG - Intergenic
1114947581 14:27704197-27704219 CTTCTTCAATAAATGGTGCTGGG - Intergenic
1115270693 14:31549024-31549046 TCTCTTCAATAAATGGTGCTGGG - Intronic
1115296956 14:31839372-31839394 TTGCTTCAATAAATGGTGTTAGG + Intronic
1115381138 14:32740604-32740626 TCTCTTCAATAAATGGTGCTGGG - Intronic
1115678391 14:35708022-35708044 TATCTTCAATAAATGGTGCTGGG + Intronic
1115803724 14:37026909-37026931 GTCTTTAAATAAATGGAGCCTGG - Intronic
1115826234 14:37281238-37281260 TCTCTTCAATAAATGGTGCTGGG - Intronic
1115833167 14:37364459-37364481 TCTCTTCAATAAATGGTGCTGGG - Intronic
1116076262 14:40114716-40114738 TTGCTTAAATAAAGGAATCTTGG - Intergenic
1116276622 14:42841704-42841726 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1116399258 14:44485173-44485195 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1116413385 14:44651106-44651128 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1116422384 14:44747702-44747724 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1116434668 14:44883602-44883624 TCTCTTTAATAAATGGTGCTGGG + Intergenic
1116475694 14:45336105-45336127 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1116604369 14:46970458-46970480 TATCTTCAATAAATGGTGCTGGG + Intronic
1116810134 14:49531738-49531760 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1117110826 14:52452591-52452613 TTTCTTCAATAAATGGTGCTGGG + Intronic
1117482641 14:56163309-56163331 TCTCTTCAATAAATGGTGCTGGG - Intronic
1117835052 14:59795527-59795549 TTACTTTTATAAATAGAGATGGG - Intronic
1117883311 14:60332942-60332964 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1117890196 14:60412961-60412983 TGACTTAAATAAATGAAAGTGGG + Intronic
1118263698 14:64272629-64272651 TCTCTTCAATAAATGGTGCTGGG - Intronic
1118275376 14:64381808-64381830 ATACTTAAATACCTGCAGCTTGG - Intergenic
1118413672 14:65509157-65509179 TTTCTTCAATAAATGGTGCTTGG - Intronic
1118425540 14:65656911-65656933 TCTCTTCAATAAATGGTGCTGGG + Intronic
1118430450 14:65714102-65714124 TCTCTTCAATAAATGGTGCTGGG - Intronic
1118509558 14:66456514-66456536 TGTCTTCAATAAATGGTGCTGGG + Intergenic
1118538592 14:66797064-66797086 TTTCTTCAATGAATGGTGCTGGG - Intronic
1118548841 14:66926483-66926505 TCTCTTCAATAAATGGTGCTGGG - Intronic
1118651879 14:67905143-67905165 TCTATTAAATAAATGGTGCTGGG - Intronic
1118660756 14:68007928-68007950 TTACTGAAATAAATGCAAATTGG + Intronic
1118674087 14:68163918-68163940 ATACTGTAATAAATGGTGCTGGG + Intronic
1118929436 14:70226763-70226785 TTACTAAAATAAATTCAACTTGG + Intergenic
1119106105 14:71925635-71925657 TCTCTTAAATAAATGGTACTGGG - Intergenic
1119121304 14:72080750-72080772 TCTCTTAAATAAATGGTGTTGGG - Intronic
1119443666 14:74646662-74646684 TTACATAAAAAACTGGAGTTTGG + Intergenic
1119493540 14:75058764-75058786 TCACTTCAACAAATGGTGCTGGG + Intronic
1119807660 14:77492680-77492702 TTAATTAAATAAAAGAGGCTGGG - Intronic
1120073479 14:80129341-80129363 TTTCTTCAATAAATGGTGCTGGG + Intergenic
1120100768 14:80442964-80442986 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1120430964 14:84414402-84414424 TTTCTTGAATAAATAGTGCTGGG - Intergenic
1120514779 14:85457694-85457716 TAAGTTAAATAAACGCAGCTAGG - Intergenic
1120636797 14:86962933-86962955 TTCCTTCAATAAATGGTGCTAGG - Intergenic
1121352909 14:93187946-93187968 TAACATAAATAAATACAGCTAGG - Intronic
1121373671 14:93384914-93384936 TCTCTTCAATAAATGGTGCTTGG - Intronic
1121377220 14:93423622-93423644 TCTCTTCAATAAATGGTGCTTGG + Intronic
1121580925 14:95029427-95029449 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1121804803 14:96808382-96808404 TTTTTTTAATCAATGGAGCTTGG - Intronic
1122755709 14:103977900-103977922 TCTCTTCAATAAATGGTGCTGGG - Intronic
1123219395 14:106842260-106842282 TTACTAAAATTACTGGAGTTTGG - Intergenic
1123570536 15:21602665-21602687 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1123606650 15:22038019-22038041 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1123800997 15:23820376-23820398 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1123802612 15:23837162-23837184 TTTCTTCAATAAATGGTGCTGGG - Intergenic
1123839352 15:24231320-24231342 TCTCTTAAATAAATGGTGCTGGG - Intergenic
1123849222 15:24337126-24337148 TCTCTTAAATAAATGGTGCTGGG - Intergenic
1123868286 15:24544631-24544653 TCTCTTAAATAAATGGTGCAGGG - Intergenic
1123980993 15:25602796-25602818 TCTCTTAAATAAATGGTGTTGGG - Intergenic
1124131454 15:26991149-26991171 TGTCTTCAATAAATGGTGCTAGG - Intronic
1124159756 15:27257607-27257629 CTTCTTCAATAAATGGTGCTGGG - Intronic
1124232701 15:27959239-27959261 TTACTAAAATAAAAGGAACTTGG + Intronic
1124273754 15:28307785-28307807 TCTCTTCAATAAATGGTGCTGGG - Intronic
1124572811 15:30881689-30881711 TTTCTTCAATAAATGGTGCTAGG - Intergenic
1124931312 15:34122236-34122258 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1124946269 15:34269904-34269926 TCTCATAAATTAATGGAGCTAGG - Intronic
1125396876 15:39258567-39258589 CTATTTAAATAAATGGTGCTGGG + Intergenic
1125400844 15:39301214-39301236 TTAGTTAAATAAATGGAGAGTGG + Intergenic
1125445484 15:39750545-39750567 TCTCTTCAATAAATGGTGCTGGG + Intronic
1126052558 15:44699732-44699754 TCTCTTCAATAAATGGTGCTGGG - Intronic
1126224873 15:46259431-46259453 TTATTTAAAAAAATTGAGATGGG - Intergenic
1126231814 15:46335900-46335922 TTTATTCAATAAATGGTGCTAGG + Intergenic
1126251131 15:46569385-46569407 TGAGTAAAATAAATGGAGATAGG - Intergenic
1126515827 15:49536825-49536847 TTTTTTCAATAAATGGTGCTGGG + Intronic
1126521716 15:49602878-49602900 TTTCTTCAATAAATGGTGCTGGG - Intronic
1126927565 15:53607433-53607455 TCTCTTCAATAAATGGTGCTGGG + Intronic
1127155401 15:56119418-56119440 TTTCTTCAATAAATGATGCTGGG - Intronic
1127177582 15:56376985-56377007 TCTCTTCAATAAATGGTGCTGGG - Intronic
1127406406 15:58652473-58652495 TCTCTTCAATAAATGGTGCTGGG - Intronic
1127822508 15:62671512-62671534 TTTTTTAAATAACTGGTGCTAGG - Intronic
1127889612 15:63237966-63237988 TCTCTTCAATAAATGGTGCTGGG - Intronic
1128966476 15:72063156-72063178 TCTCTTCAATAAATGGTGCTTGG + Intronic
1129311443 15:74712655-74712677 TCTCTTCAATAAATGGTGCTTGG + Intergenic
1129428151 15:75480062-75480084 TCACTTCAATAAATGGTGCTGGG + Intronic
1129501625 15:76044355-76044377 TCTCTTCAATAAATGGTGCTGGG + Intronic
1129584169 15:76846104-76846126 TCTCTTCAATAAATGGTGCTGGG + Intronic
1130299685 15:82670462-82670484 TCTCTTCAATAAATGGCGCTGGG + Intronic
1130311677 15:82761453-82761475 TTACTTAAAAAGATGGAACTGGG + Intronic
1130645264 15:85719935-85719957 TTATTTAAATATTTGGGGCTGGG + Intronic
1130665762 15:85868530-85868552 TCTCTTCAATAAATGGTGCTAGG - Intergenic
1130711599 15:86287574-86287596 TTTCTTCAATAAATGGTGTTGGG - Intronic
1130786987 15:87109516-87109538 CTTCTTTAATAAATGGTGCTTGG + Intergenic
1131903155 15:97111271-97111293 TTTATTCAATAAATGGTGCTGGG + Intergenic
1202978889 15_KI270727v1_random:329789-329811 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1133082482 16:3333928-3333950 TCTCTTCAATAAATGGTGCTTGG - Intergenic
1133951402 16:10397060-10397082 TTGCTTTGATAAATGGTGCTGGG - Intronic
1133953138 16:10415386-10415408 TCTCTTCAATAAATGGTGCTGGG + Intronic
1134374966 16:13663525-13663547 TTACTTAAATAATTGGTGGTCGG - Intergenic
1134646607 16:15873112-15873134 TTAATTAAAAAAATAGAGATGGG + Intronic
1135203923 16:20465865-20465887 TTGCTTAAATAAGTGGAAGTAGG - Intronic
1135297615 16:21296231-21296253 TTACTTAAAAAACTCCAGCTGGG - Intronic
1135583645 16:23649933-23649955 TCTCTTCAATAAATGGTGCTGGG - Intronic
1137226925 16:46521891-46521913 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1137324320 16:47418613-47418635 TTTCTTTAATAAATAGTGCTGGG - Intronic
1137358424 16:47789622-47789644 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1137946565 16:52738360-52738382 TTATTTTAATAAATGGTGCTGGG + Intergenic
1138005711 16:53334922-53334944 TTTCTTGAATAAATCCAGCTTGG - Intergenic
1138259386 16:55603557-55603579 CTATTTAAATAAATGGTGCTGGG + Intergenic
1138429824 16:56961661-56961683 TTACTTAAATACATATATCTAGG - Intergenic
1138742533 16:59327387-59327409 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1138800353 16:60019200-60019222 TCACTTTAATAAATGCTGCTGGG - Intergenic
1138939330 16:61771236-61771258 TTACTTAAATAAATGAATGTGGG + Intronic
1139023077 16:62776693-62776715 TTTTTTCAATAAATGGTGCTAGG + Intergenic
1139070489 16:63375401-63375423 TTTCTTCAATAAATGGTGCTGGG + Intergenic
1139228930 16:65262914-65262936 TTTTTTCAATAAATGGTGCTGGG - Intergenic
1139755934 16:69143733-69143755 TTAATTAAAAAAATAGAGATGGG + Intronic
1140157674 16:72449774-72449796 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1140313225 16:73868826-73868848 TGACATAAAAATATGGAGCTTGG - Intergenic
1141505351 16:84473852-84473874 TGTCTTCAATAAATGGTGCTGGG + Intergenic
1142168058 16:88603926-88603948 TTATTTTAAGAAATGGGGCTGGG - Intronic
1143430856 17:6882686-6882708 TCTCTTCAATAAATGGTGCTGGG - Intronic
1144097678 17:11916589-11916611 TTACTTAATAAACTGGGGCTTGG - Intronic
1144340723 17:14308995-14309017 TTGATTTAATGAATGGAGCTGGG + Intronic
1144858035 17:18281279-18281301 TTATTTAAATGATTGGAGTTCGG - Intronic
1145822221 17:27847634-27847656 GTACTTATATAAATGGATCTGGG + Intronic
1146114944 17:30127078-30127100 TTATTTACAAAAATGGAGATGGG + Intronic
1146116936 17:30149219-30149241 TTACTTAAAAAAATAGAGATGGG + Intronic
1146147647 17:30435420-30435442 TTTTTTAAATAAATGGTGCTGGG + Intronic
1146253897 17:31377630-31377652 TTACTTAAAAAAAGGGGGGTGGG - Exonic
1147397690 17:40157378-40157400 TTAATTAATTAAAAGGGGCTGGG + Intronic
1149027338 17:52042828-52042850 TTTCTTAAATAAATGATGTTGGG - Intronic
1149054054 17:52341456-52341478 TCTCTTCAATAAATGGCGCTGGG - Intergenic
1149092609 17:52802319-52802341 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1149106062 17:52966873-52966895 TTATTTAAAAAAATGGTACTGGG - Intergenic
1149235580 17:54586796-54586818 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1149240885 17:54647496-54647518 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1149256637 17:54835019-54835041 TTACTAAAATGAAATGAGCTTGG - Intergenic
1149499689 17:57142831-57142853 TTGAATAAATAAATGAAGCTGGG - Intergenic
1149648467 17:58258374-58258396 TCTCTTCAATAAATGGTGCTGGG - Intronic
1149717120 17:58802264-58802286 TTTCTTTAATAAATGGTGGTAGG - Intronic
1149933949 17:60784793-60784815 TTAGTAAATTAAATGTAGCTAGG + Intronic
1150022488 17:61632045-61632067 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1150189929 17:63227837-63227859 ATAAATAAATAAATGGTGCTGGG - Intronic
1150201704 17:63363592-63363614 TCTCTTCAATAAATGGTGCTGGG - Intronic
1150537710 17:66060664-66060686 TCTCTTTAATAAATGGTGCTGGG + Intronic
1150544650 17:66142582-66142604 TCACTTCAATAAATGGTGTTAGG - Intronic
1150859771 17:68789582-68789604 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1151366437 17:73619498-73619520 TCTCTTCAACAAATGGAGCTTGG + Intronic
1151779217 17:76231618-76231640 TTTTTTAAATAAGTGGAGATGGG - Intronic
1152958546 18:62901-62923 TTACTTAAAAAAATTGATCAAGG - Intronic
1153183115 18:2458387-2458409 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1153351815 18:4089695-4089717 TTTATTTAATAAATGGTGCTGGG + Intronic
1153356125 18:4137356-4137378 TCTCTTCAATAAATGGTGCTGGG - Intronic
1153363741 18:4229583-4229605 TCTCTTCAATAAATGGTGCTAGG + Intronic
1153553998 18:6291607-6291629 TCGCTTCAATAAATGGTGCTGGG + Intronic
1153942065 18:9987163-9987185 TTTCATAAATAAAAGGAGCCAGG - Intergenic
1154038407 18:10830200-10830222 TCTCTTCAATAAATGGTGCTGGG + Intronic
1154038426 18:10830424-10830446 TCTCTTCAATAAATGGTGCTAGG - Intronic
1154098011 18:11438497-11438519 TGTCTTTAATAAATGGTGCTAGG + Intergenic
1154286701 18:13064252-13064274 TCCCTTGAATAAATGGCGCTGGG - Intronic
1154305257 18:13226024-13226046 TAATTTAAAAAAATGGAGATGGG + Intronic
1155197774 18:23491006-23491028 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1155467624 18:26155560-26155582 CCACTTCAATAAATGGAGCTGGG + Intronic
1155721591 18:29019928-29019950 TTATCTAAATAAATGGATATTGG + Intergenic
1155807036 18:30184293-30184315 TTTCTTAAACAAATGGTGTTGGG + Intergenic
1155823703 18:30411628-30411650 TCTCTTCAATAAATGGGGCTAGG - Intergenic
1156045723 18:32874987-32875009 ATACATTAATGAATGGAGCTAGG + Intergenic
1156073440 18:33242173-33242195 TTTATTCAATAAATGGTGCTAGG + Intronic
1156672956 18:39492470-39492492 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1156831243 18:41494058-41494080 TTAGTTCATTAGATGGAGCTGGG - Intergenic
1156993435 18:43438317-43438339 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1157089388 18:44618306-44618328 TGTCTTCAATAAATGGGGCTGGG + Intergenic
1157879781 18:51310183-51310205 TCTCTTTAATAAATGGTGCTGGG + Intergenic
1157999546 18:52600240-52600262 TCATTTCAATAAATAGAGCTGGG - Intronic
1158163363 18:54511120-54511142 TTTCTTCAATAAATGGTTCTGGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158270534 18:55709588-55709610 TCACTTCAATAAATGATGCTGGG - Intergenic
1158616058 18:58988087-58988109 TTACTTAAAAATATGGAAGTAGG + Intergenic
1158746421 18:60204897-60204919 TTACTTATATAAAAGTGGCTAGG + Intergenic
1158881946 18:61788315-61788337 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1159137903 18:64358712-64358734 TCTATTAAATAAATGGTGCTGGG - Intergenic
1159334831 18:67048581-67048603 TTTCTTTAATAAATGGCCCTGGG - Intergenic
1159393390 18:67825275-67825297 TGTCTTCAATAAATGGTGCTGGG + Intergenic
1159542187 18:69791984-69792006 TCTCTTCAATAAATGGTGCTGGG - Intronic
1159730975 18:72027286-72027308 TTCCTTCAATAAATGGTGCTGGG - Intergenic
1160142021 18:76333435-76333457 TCACTTAAATAAATGGTATTGGG + Intergenic
1161540797 19:4850237-4850259 TTAAATAAATACATGCAGCTGGG - Intronic
1161566003 19:5003177-5003199 TTTTTTTAATCAATGGAGCTGGG - Intronic
1161647801 19:5465059-5465081 TTAATTAAATAAAATTAGCTGGG + Intergenic
1162542340 19:11304944-11304966 TTTTTTTAATAAATGAAGCTGGG - Intronic
1162664472 19:12198155-12198177 TTTCTTCAATAAATGGTACTGGG - Intergenic
1162923190 19:13915889-13915911 TTGCTGACATAATTGGAGCTGGG - Intronic
1164070517 19:21763913-21763935 TTTTTTAAATAAATTGAACTTGG + Intronic
1164389779 19:27807947-27807969 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1164408699 19:27978098-27978120 TGTCTTCAATAAATGGTGCTGGG + Intergenic
1164954546 19:32370959-32370981 TCTCTTCAATAAATGGTGCTGGG - Intronic
1165260301 19:34609551-34609573 TCTCTTCAATAAATGGTGCTGGG - Intronic
1165616035 19:37201409-37201431 CTACTTTATCAAATGGAGCTGGG - Intronic
1165703505 19:37957025-37957047 TTTTTTCAACAAATGGAGCTGGG - Intronic
1166322921 19:42030146-42030168 CTATTCAAGTAAATGGAGCTGGG + Intronic
1167727685 19:51227949-51227971 TTTCTTTAATAAATGATGCTGGG - Intronic
1167773093 19:51534082-51534104 CTTCTTCAATAAATGGTGCTGGG - Intergenic
1168551076 19:57295156-57295178 TCTCTTCAATAAATGGTGCTGGG - Intergenic
925017283 2:540339-540361 TTTATTCAATAAATGGTGCTGGG + Intergenic
925021353 2:571554-571576 TCTCTTTAATAAATGGTGCTTGG + Intergenic
925088019 2:1127194-1127216 TCTCTTCAATAAATGGTGCTGGG - Intronic
925243500 2:2356928-2356950 ATTCTTCAATAAATGGTGCTGGG + Intergenic
926852161 2:17210682-17210704 TTGCTTCAATAAATGGTGCTGGG - Intergenic
926959040 2:18333177-18333199 TCTCTTCAATAAATGGTGCTGGG + Intronic
926993299 2:18703871-18703893 TTACCTGAATAAATGAAGCAAGG + Intergenic
927034620 2:19161521-19161543 TCTCTTAAATAAGTGGTGCTGGG - Intergenic
927116328 2:19905783-19905805 TTTTTTAAACAAATGGTGCTAGG + Intergenic
927263715 2:21120973-21120995 TCTCTTTAATAAATGGTGCTGGG - Intergenic
927425074 2:22972446-22972468 TCTCTTCAATAAATGGTGCTGGG + Intergenic
927429034 2:23011114-23011136 TTTCTTCAATAAATGGTGTTGGG - Intergenic
927970055 2:27299966-27299988 AAAAATAAATAAATGGAGCTGGG - Intronic
928293985 2:30066530-30066552 TCTCTTCAATAAATGGTGCTGGG + Intergenic
928303815 2:30148648-30148670 TTAGTAAAATATATGTAGCTTGG + Intronic
928494501 2:31818547-31818569 TCTCTTCAATAAATGGTGCTGGG - Intergenic
928547547 2:32342410-32342432 TTAATTAAATAAATGAGGCCGGG + Intergenic
928764633 2:34629382-34629404 TTACTTCCATAAATGGTGTTAGG + Intergenic
928784028 2:34860112-34860134 TTTCTTCAATAAACGGTGCTGGG + Intergenic
928851571 2:35753905-35753927 TCTCTTCAATAAATGGTGCTAGG - Intergenic
929100440 2:38306921-38306943 TGGCTTCAATAAATGGTGCTGGG + Intronic
929170567 2:38928729-38928751 TTTCTTAGATAAATGGGGCCAGG + Intronic
929233412 2:39583085-39583107 TGTCTTTAATAAATGGTGCTAGG - Intergenic
929497016 2:42453937-42453959 TCTCTTCAATAAATGGTGCTGGG - Intronic
929847728 2:45548603-45548625 TTCCTTAGATTAATGGAACTTGG - Intronic
930103848 2:47624247-47624269 TCTCTTCAATAAATGGTGCTGGG - Intergenic
930295233 2:49545853-49545875 TTTATTTAATAAATGGTGCTGGG + Intergenic
930413036 2:51051275-51051297 TTAATTAAATATTTGGAGCATGG + Intergenic
930453004 2:51567385-51567407 TCTCTTCAATAAATGGTGCTGGG - Intergenic
930497231 2:52161297-52161319 TTTCTTCAATAAATGGTGCTGGG - Intergenic
930588235 2:53295845-53295867 TGTCTTCAATAAATGGTGCTGGG + Intergenic
930592703 2:53348209-53348231 GAACTTTAATAAATGGTGCTGGG - Intergenic
931071261 2:58652996-58653018 TTAATAAAATAAAGGGAGCAAGG - Intergenic
931161635 2:59698684-59698706 TCTCTTCAATAAATGGTGCTGGG - Intergenic
931217028 2:60255271-60255293 TTTCTTCAATAAATGATGCTAGG - Intergenic
931453967 2:62392543-62392565 TCTCTTAAATAAATGGTGCTGGG - Intergenic
931461587 2:62454680-62454702 ATACATAAATAAATAAAGCTGGG - Intergenic
931531840 2:63223771-63223793 TCTTTTAAATAAATGGTGCTAGG - Intronic
931568461 2:63642024-63642046 TCTCTTCAATAAATGGTGCTGGG - Intronic
932101752 2:68907789-68907811 TGCCTTCAATGAATGGAGCTAGG + Intergenic
932535254 2:72586008-72586030 CTAATTCAATAAATGGTGCTGGG + Intronic
932913219 2:75827173-75827195 TTTATTCAATAAATGGTGCTGGG + Intergenic
932967774 2:76498127-76498149 TTTGTTAAATAAATGTGGCTTGG - Intergenic
933339197 2:81000208-81000230 TCTCTTCAATAAATGGTGCTGGG - Intergenic
933396980 2:81744982-81745004 TCTATTAAATAAATGGTGCTGGG - Intergenic
933538034 2:83602265-83602287 TCACTTAAATAAATGGCTCTGGG + Intergenic
933546981 2:83726818-83726840 TCTCTTCAATAAATGGTGCTGGG - Intergenic
933854892 2:86403614-86403636 TTACTCACATAAAGGGATCTGGG - Intergenic
934043862 2:88154469-88154491 CTTCTTCAATAAATGGTGCTGGG + Intergenic
934996786 2:98969640-98969662 TCTCTTCAATAAATGGTGCTGGG - Intergenic
935478209 2:103551875-103551897 TCTCTTCAATAAATGGTGCTGGG - Intergenic
935483686 2:103625751-103625773 TCAATTCAATAAATGGAGCTGGG + Intergenic
935508484 2:103938559-103938581 TCTCTTAAACAAATGGTGCTGGG - Intergenic
935533010 2:104258569-104258591 TCTCTTCAATAAATGGTGCTGGG + Intergenic
935576069 2:104711971-104711993 TGTCTTCAATAAATGGTGCTGGG - Intergenic
935582594 2:104770742-104770764 TCTCTTAAACAAATGGTGCTGGG + Intergenic
935990029 2:108711270-108711292 TCTCTTCAATAAATGGTGCTGGG + Intergenic
936135857 2:109893198-109893220 TCTCTTCAATAAATGGTGCTGGG - Intergenic
936208840 2:110478287-110478309 TCTCTTCAATAAATGGTGCTGGG + Intergenic
936726107 2:115318174-115318196 TCTCTTCAATAAATGGTGCTGGG - Intronic
936793701 2:116182868-116182890 TCTCTTCAATAAATGGTGCTTGG - Intergenic
936869618 2:117119615-117119637 TCACTTCAATAAATGGTGCTAGG - Intergenic
936939332 2:117867620-117867642 TCTCTTCAATAAATGGTGCTAGG - Intergenic
936988564 2:118336788-118336810 TCTCTTCAATAAATGGAGTTGGG - Intergenic
936994674 2:118400426-118400448 TCTCTTCAATAAATGGTGCTGGG - Intergenic
937116696 2:119410650-119410672 TTTCTTCAACAAATGGTGCTGGG - Intergenic
937194428 2:120139090-120139112 TCTCTTCAATAAATGGTGCTAGG + Intronic
937628642 2:124073117-124073139 TCTCTTCAATAAATGGTGCTGGG + Intronic
937793600 2:125989845-125989867 TTAGTTCAATAAATGGTGCTTGG - Intergenic
937830454 2:126415816-126415838 TCTCTTCAATAAATGGTGCTGGG + Intergenic
938218019 2:129538051-129538073 TTTCTTAAATAAATGGTCCTTGG - Intergenic
938261606 2:129899980-129900002 TCTCTTCAATAAATGGTGCTGGG + Intergenic
938575740 2:132602295-132602317 TCTCTTCAATAAATGGTGCTGGG + Intronic
938800417 2:134758263-134758285 TCTCTTCAATAAATGGTGCTGGG + Intergenic
938863574 2:135395258-135395280 TCTCTTCAATAAATGGTGCTGGG + Intronic
939098122 2:137859841-137859863 ACACTTCAATAAATGGTGCTGGG - Intergenic
939172893 2:138716160-138716182 CTATTTAAAAAAATGGAGTTCGG - Intronic
939241573 2:139567569-139567591 TCTCTTCAATAAATGGTGCTGGG + Intergenic
939665259 2:144943922-144943944 TTATTTTAATAAATGGCTCTTGG + Intergenic
939831499 2:147077725-147077747 TCTCTTTAATAAATGGTGCTTGG + Intergenic
939853111 2:147323260-147323282 TCTCTTCAATAAATGGTGCTGGG + Intergenic
939930005 2:148221991-148222013 TCTCTTCAATAAATGGTGCTGGG - Intronic
940072701 2:149706994-149707016 TTTCTTTAATAAATGGTGCTGGG + Intergenic
940105354 2:150093570-150093592 TTTCTTTAATTAATGGTGCTGGG - Intergenic
940181377 2:150937356-150937378 TTACTTAAACCAATTTAGCTGGG - Intergenic
940425795 2:153530797-153530819 TGTCTTCAATAAATGGTGCTGGG + Intergenic
940429375 2:153570689-153570711 TCTCTTTAATAAATGGTGCTGGG - Intergenic
940527822 2:154840169-154840191 TTTATTTAATAAATGGTGCTGGG - Intronic
941138200 2:161743351-161743373 TCTCTTCAATAAATGGTGCTGGG - Intronic
941587176 2:167375067-167375089 TCTATTCAATAAATGGAGCTGGG - Intergenic
941672056 2:168304722-168304744 TCTCTTCAATAAATGGTGCTGGG - Intergenic
941971808 2:171358569-171358591 TCTCTTCAATAAATGGTGCTGGG + Intronic
941973745 2:171381164-171381186 TTCCCTATATAAATGGTGCTGGG + Intronic
942309395 2:174641155-174641177 TCTCTTCAATAAATGGTGCTGGG + Intronic
942356516 2:175118722-175118744 TTATTTAAATAAATGAAATTTGG + Intronic
942425853 2:175859777-175859799 TCTCTAAAATAAATGGACCTTGG + Intergenic
942746738 2:179242710-179242732 CTATTCAAATAAATGGTGCTGGG + Intronic
942773188 2:179547448-179547470 TCTCTTCAATAAATGGTGCTGGG - Intronic
942806566 2:179937895-179937917 TTTGTTCAATAAATGGTGCTGGG - Intergenic
942927659 2:181453336-181453358 TCTCTTTAATAAATGGTGCTAGG - Intergenic
942971789 2:181965530-181965552 TTTCTTCAATAAATGGTGCCAGG - Intronic
943044809 2:182847886-182847908 TTTCTCAAATAACTGGAGTTGGG + Intronic
943102189 2:183500541-183500563 TCTCTTCAATAAATGGTGCTGGG - Intergenic
943128345 2:183825326-183825348 TCTCTTCAATAAATGGTGCTGGG + Intergenic
943138216 2:183942841-183942863 TTTCTTCAATAAATGGTGTTGGG + Intergenic
943259406 2:185639835-185639857 TTACATAAAGAAATAAAGCTGGG - Intergenic
943484294 2:188459875-188459897 TTTCTTCAATAAATGATGCTGGG - Intronic
943495407 2:188614132-188614154 TTTCTTCAATAAATGGTGCCGGG - Intergenic
943572628 2:189591604-189591626 TTTCTTCAATAAATGGTTCTGGG - Intergenic
944027924 2:195194319-195194341 TCTATTAAATAAATGGTGCTGGG + Intergenic
944079055 2:195765141-195765163 TCTCTTCAATAAATGGTGCTGGG + Intronic
944463545 2:199977528-199977550 TTTCTTCAATAAATGGTGCTGGG - Intronic
944570283 2:201037650-201037672 TTTATTTAATAAATGGTGCTGGG + Intronic
944938853 2:204600398-204600420 TCTCTTCAATAAATGGTGCTAGG - Intronic
945031445 2:205667773-205667795 CTTCTTAAATAAATGATGCTGGG - Intergenic
945349900 2:208765043-208765065 TTTAATAAATAAATGGTGCTGGG + Intronic
945713845 2:213333760-213333782 TCTCTTCAATAAATGGTGCTGGG + Intronic
945802981 2:214456803-214456825 TTTCTTCAATAAATGGTACTGGG - Intronic
946100833 2:217320226-217320248 TTACATAAATACATGGAGTTAGG - Intronic
946513017 2:220380377-220380399 TCTCTTCAATAAATGGTGCTGGG - Intergenic
946606015 2:221405975-221405997 TCTCTTTAATAAATGGTGCTGGG - Intergenic
946792593 2:223316365-223316387 TTACTTAAAAAAATTGAAATTGG + Intergenic
946963654 2:225012413-225012435 TTACTGAAATAAAATGAACTTGG - Intronic
946985119 2:225263576-225263598 TTTCTTCAATAAATGATGCTGGG + Intergenic
947311824 2:228811315-228811337 TCTCTTCAATAAATGGTGCTGGG - Intergenic
947429822 2:230017431-230017453 TGTCTTCAATAAATGGTGCTGGG + Intergenic
947439203 2:230103289-230103311 TCTCTTCAATAAATGGTGCTGGG - Intergenic
947683638 2:232060467-232060489 TTTCTTCAATAAATGGTGCTGGG - Intronic
947768622 2:232653614-232653636 GGACTTAAATAAAGGGAACTTGG + Intronic
947870180 2:233431731-233431753 TCTCTTCAATAAATGGTGCTGGG + Intronic
947908225 2:233781955-233781977 TCTCTTCAATAAATGGTGCTGGG - Intronic
948303574 2:236929102-236929124 TTAATTAATTAAATGGTGGTTGG + Intergenic
948440783 2:237986745-237986767 TTCCTTCAATAAATGGTGTTGGG - Intronic
948812373 2:240488203-240488225 TTTCTTCAGTAAATGGTGCTGGG - Intronic
949020285 2:241737263-241737285 TTATTTGAAAAAATGGGGCTGGG - Intronic
1168732034 20:92789-92811 TTGTTTAAATAAATGGGGCATGG - Intronic
1169185069 20:3608439-3608461 GTTCTTCAATAAATGGTGCTGGG - Intronic
1169533686 20:6513183-6513205 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1169624283 20:7546136-7546158 TTTCTTCAATACATGGTGCTGGG + Intergenic
1169740344 20:8886829-8886851 TCTCTTCAATAAATGGTGCTGGG - Intronic
1169773548 20:9227553-9227575 TTTCTTCAATAAATGGTGCTGGG - Intronic
1169836189 20:9882106-9882128 CCTCTTAAATAAATGGTGCTGGG - Intergenic
1169902102 20:10563638-10563660 TTTCTTTAATAAATGCTGCTGGG - Intronic
1169989097 20:11480385-11480407 TCTCTTTAATAAATGGTGCTGGG + Intergenic
1169991393 20:11507002-11507024 ATAATTCAATAAATGGTGCTGGG + Intergenic
1169991569 20:11509767-11509789 TCCCTTCAATAAATGGTGCTAGG + Intergenic
1170031255 20:11946600-11946622 TTATTTAAATAAATGAATCATGG - Intergenic
1170146215 20:13177670-13177692 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1170721547 20:18884608-18884630 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1170996874 20:21370088-21370110 TCTCTTCAATAAATGGTGCTGGG - Intronic
1171024799 20:21620193-21620215 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1172203359 20:33143040-33143062 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1172374205 20:34423470-34423492 TTCCTTTACTAAATGGACCTAGG + Intronic
1173203739 20:40974363-40974385 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1173966083 20:47113918-47113940 TTTCTTATTTAAATGGAACTAGG + Intronic
1174502352 20:50994946-50994968 TTACTTAAATTAGTGGGGTTGGG - Intergenic
1174502804 20:50997981-50998003 TTATTTCAACAAATTGAGCTTGG + Intergenic
1174707764 20:52674676-52674698 TTTCATACATAAATGGATCTAGG + Intergenic
1174806312 20:53607119-53607141 TTTTTTAAATAAATTGAGATAGG - Intronic
1174889152 20:54370844-54370866 TCTCTTAAATAAGTGGTGCTGGG - Intergenic
1174953800 20:55073719-55073741 TGTCTTCAATAAATGGTGCTGGG - Intergenic
1174981746 20:55403266-55403288 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1175573729 20:60043917-60043939 TTTCTTCAATAAATGGTGCTGGG - Intergenic
1175747624 20:61469792-61469814 TCTCTTCAATAAATGGTGCTGGG - Intronic
1176725499 21:10428640-10428662 TTACTTAAATAAATGATTCATGG + Intergenic
1176788017 21:13282433-13282455 TATCTTCAATAAATGGTGCTGGG + Intergenic
1176883995 21:14232181-14232203 TCACTCAAATAAATGGAAATGGG + Intergenic
1176999524 21:15595014-15595036 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1177118341 21:17111679-17111701 TCTATTAAATAAATGGTGCTGGG + Intergenic
1177279738 21:18965757-18965779 GTATTTTAATAAATGGAGATTGG + Intergenic
1177338663 21:19767927-19767949 TTTATTCAATAAATGGTGCTGGG - Intergenic
1177379091 21:20314746-20314768 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1177382274 21:20360206-20360228 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1177740753 21:25149772-25149794 GTACTTTAATAAGTGGAGCAAGG - Intergenic
1177873629 21:26603926-26603948 TCTCTTCAATAAATGGGGCTGGG - Intergenic
1177970492 21:27783631-27783653 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1178546063 21:33493842-33493864 TTTTTTAAATAAATAGAGATGGG - Intergenic
1178986845 21:37312304-37312326 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1179569246 21:42268339-42268361 TTCCTTACATAAATAGAGGTAGG + Intronic
1180597024 22:16983709-16983731 TCTCTTCAATAAATGGTGCTGGG + Intronic
1180745059 22:18082438-18082460 TCTCTTTAATAAATGGTGCTGGG - Intronic
1181261109 22:21598554-21598576 TTTTTTAAATAAATAGAGATGGG + Intronic
1181293042 22:21812601-21812623 TCTCTTCAATAAATGGTGCTGGG + Intronic
1181648622 22:24246970-24246992 TTATTTAAACAAATAGAGATGGG - Intergenic
1182156739 22:28080918-28080940 TTTCTTCAATAAATGGTGTTAGG - Intronic
1182164400 22:28158670-28158692 TCTCTTCAATAAATGGTGCTGGG + Intronic
1182379439 22:29874655-29874677 TCTCTTCAATAAATGGTGCTAGG - Intergenic
1182818680 22:33192899-33192921 TTTCTTCAATAAATGGTGTTGGG - Intronic
1183758525 22:39793691-39793713 CTTCTTCAATAAATGGTGCTGGG - Intronic
1184305388 22:43597009-43597031 TCTCTTTAATAAATGGTGCTGGG + Intronic
1184349521 22:43934543-43934565 ATGCTGAAATAAATGGTGCTTGG + Intronic
1184862888 22:47185657-47185679 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1184928013 22:47657700-47657722 TTCCTTTAATAAATAGAGTTAGG + Intergenic
1185087326 22:48748000-48748022 TTACCTGGATGAATGGAGCTGGG + Intronic
949149834 3:753272-753294 CTTCTTGAATAAATGGTGCTGGG - Intergenic
949176269 3:1066558-1066580 TCATTTCAATAAATGGTGCTGGG + Intergenic
949219460 3:1613168-1613190 AAACATAAATAAATGGAGCATGG - Intergenic
949235399 3:1802878-1802900 TTTCTTCAATAAATGGTGATGGG - Intergenic
949246255 3:1928198-1928220 TCTCTTCAATAAATGGTGCTGGG - Intergenic
949382171 3:3458511-3458533 TTACTCACATAAATGTAACTGGG + Intergenic
949428320 3:3943517-3943539 TATCTTCAATAAATGGTGCTGGG - Intronic
950823650 3:15791523-15791545 TCTCTTTAATAAATGGTGCTGGG + Intronic
950830349 3:15868792-15868814 TCTCTTCAATAAATGGTGCTGGG + Intergenic
950936935 3:16848512-16848534 TTACTAAAACAAATAGAGCTAGG - Intronic
951028490 3:17855028-17855050 TCTCTTCAATAAATGGTGCTAGG - Intronic
951176075 3:19601792-19601814 TCTCTTTAATAAATGGTGCTGGG + Intergenic
951204722 3:19913941-19913963 TCTCTTCAATAAATGGTGCTGGG + Intronic
951435901 3:22664063-22664085 TTACTTAAGTAAATAAAGCAAGG - Intergenic
951653004 3:24973208-24973230 TCTCTTCAATAAATGGTGCTGGG - Intergenic
951680349 3:25288502-25288524 TTATTTAAATGAATGCAGCTGGG - Intronic
951793751 3:26515794-26515816 TATCTTCAATAAATGGTGCTGGG - Intergenic
951878340 3:27454137-27454159 TTTATTAAATAAATGGAGATGGG - Intronic
951959880 3:28305918-28305940 TTTATTCAATAAATGGTGCTGGG - Intronic
951977669 3:28531107-28531129 TCTCTTCAATAAATGGTGCTGGG + Intronic
951995704 3:28725874-28725896 TAAATTAAATAACTGGAGCGAGG - Intergenic
952046795 3:29331346-29331368 TAACTTAAGGAAAGGGAGCTGGG - Intronic
952177644 3:30883380-30883402 TCTCTTCAATAAATGGTGCTGGG - Intronic
952429773 3:33211969-33211991 TATCTTCAATAAATGGTGCTGGG - Intronic
952440955 3:33328606-33328628 TTTCTTCAATAAATGGTGCTGGG + Intronic
952562986 3:34617546-34617568 TTTCTTTAATAAATTGTGCTAGG - Intergenic
952627376 3:35423068-35423090 TTACTTCAATAACTGCATCTGGG - Intergenic
952673234 3:35995881-35995903 TTTATTCAATAAATGGAGCTGGG - Intergenic
953087728 3:39688144-39688166 TCTCTTCAATAAATGGTGCTGGG + Intergenic
953199144 3:40762297-40762319 TTTCTTCAATAAATGGTGCTGGG + Intergenic
953280694 3:41553011-41553033 CTTCTTCAATAAATGGTGCTGGG + Intronic
954084001 3:48229774-48229796 TTATTTCAATAAAAGGTGCTGGG - Intergenic
954281934 3:49586641-49586663 TATCTTCAATAAATGGTGCTGGG - Intronic
954478318 3:50770870-50770892 TCTCTTCAATAAATGGTGCTGGG + Intronic
954487466 3:50866662-50866684 TCTCTTTAATAAATGGTGCTGGG - Intronic
955030993 3:55218005-55218027 TTTCTTCAATAAGTGGGGCTGGG - Intergenic
955625508 3:60914372-60914394 TTAATTAAATAAATGGTTCATGG - Intronic
955854687 3:63260478-63260500 TTTATTTAATAAATGGTGCTGGG + Intronic
956573519 3:70724881-70724903 TCTCTTCAATAAATGGTGCTGGG - Intergenic
956619425 3:71206041-71206063 CTTATTAAACAAATGGAGCTGGG - Intronic
957383944 3:79471063-79471085 TCTCTTCAATAAATGGTGCTGGG + Intronic
957907264 3:86573648-86573670 TTTCTTCAATAAATGGTGCTGGG + Intergenic
957917439 3:86704522-86704544 TTTATTTAATAAATGGTGCTGGG - Intergenic
957925871 3:86810510-86810532 TCTCTTCAATAAATGGTGCTGGG + Intergenic
957926042 3:86812579-86812601 TTTCTTCAATAAATGGTGTTTGG + Intergenic
958161585 3:89822788-89822810 TTGCTTCAATAAATGGCACTGGG + Intergenic
958444965 3:94203646-94203668 TTTCTTCAATAAATGGTGTTGGG - Intergenic
958725591 3:97902049-97902071 TTACTTAAACAAACAGATCTTGG + Intronic
958760550 3:98302315-98302337 TCTCTTCAATAAATGGTGCTGGG + Intergenic
959055144 3:101560428-101560450 TTACTAAAATAAAAGAAGGTAGG - Intergenic
959182268 3:102996647-102996669 TCTCTTCAATAAATGGTGCTGGG + Intergenic
959186450 3:103052936-103052958 GTATGTAAAAAAATGGAGCTTGG - Intergenic
959336313 3:105069479-105069501 TCTCTTCAATAAATGGTGCTGGG + Intergenic
959408513 3:105991431-105991453 TCTCTTCAATAAATGGTGCTGGG - Intergenic
959443684 3:106411274-106411296 TTTCTTCAATAAATGGTGCTAGG - Intergenic
959491550 3:106995262-106995284 TCTCTTTAATAAATGGTGCTGGG + Intergenic
959492716 3:107010548-107010570 TTTCTTTAATAAATGGTACTGGG + Intergenic
959868152 3:111294924-111294946 TCACTTCAATAAATGATGCTGGG - Intronic
959900852 3:111660777-111660799 CTAATTCAATAAATGGTGCTGGG + Intronic
960020095 3:112940077-112940099 CTTCTTTAATAAATGGCGCTGGG + Intronic
960206952 3:114913814-114913836 TCTCTTCAATAAATGGTGCTGGG - Intronic
960217299 3:115057476-115057498 TTACATAAATAATTGGAGCAGGG - Intronic
960242029 3:115355497-115355519 TCTTTTAAATAAATGGTGCTGGG + Intergenic
960581658 3:119284300-119284322 TCTCTTTAATAAATGGTGCTGGG - Intergenic
960748753 3:120921702-120921724 TTTCTTCAACAAATGGTGCTGGG - Intronic
961225927 3:125245827-125245849 TTACTTAAATAAACAGAGGCTGG - Intronic
961356628 3:126343661-126343683 TTGCTTAAAAAAATGGGGATGGG + Exonic
961850735 3:129815508-129815530 TCTCTTTAATAAATGGTGCTGGG + Intronic
961940770 3:130635677-130635699 TTACTTTAATAAATGTATTTAGG + Exonic
962037940 3:131673071-131673093 TCTCTTGAATAAATGGTGCTGGG - Intronic
962211694 3:133484817-133484839 CTTCTTCAATAAATGGTGCTGGG - Intergenic
962447192 3:135476991-135477013 TTTCTTCAATAAATGGTGTTGGG - Intergenic
962483800 3:135822094-135822116 TCTCTTCAATAAATGGTGCTGGG + Intergenic
962689464 3:137879280-137879302 TCTCTTCAATAAATGGTGCTGGG + Intergenic
963020211 3:140865991-140866013 TGTCTTCAATAAATGGTGCTGGG - Intergenic
963096469 3:141546930-141546952 TTTCTTCAATAAATGGTGCTGGG - Intronic
963454601 3:145528333-145528355 TTTCTTCAATAAATAGTGCTGGG + Intergenic
963459469 3:145590466-145590488 TCTCTTCAATAAATGGTGCTGGG + Intergenic
963484310 3:145917413-145917435 CCACTTCAATAAATGGAGTTGGG + Intergenic
963515634 3:146305244-146305266 TCCCTTCAATAAATGGTGCTGGG + Intergenic
963537755 3:146549205-146549227 TCTCTTGAATAAATGGTGCTGGG + Intergenic
963551065 3:146723522-146723544 TTTCTTCAATAAATGGTGCTAGG + Intergenic
963579255 3:147103833-147103855 TTTCTTCAATAAACGGTGCTGGG - Intergenic
963758846 3:149264684-149264706 CTTCTTCAATAAATGGTGCTGGG + Intergenic
963853416 3:150229539-150229561 CTGCTTCAATAAATGGTGCTGGG + Intergenic
964230563 3:154461859-154461881 TTACAAAGATAAATGGAGCATGG - Intergenic
964234999 3:154514915-154514937 AGACTTTAATAAATGGTGCTGGG - Intergenic
964254110 3:154755395-154755417 TGTCTTCAATAAATGGTGCTGGG + Intergenic
964262889 3:154859960-154859982 TCTCTTCATTAAATGGAGCTGGG - Intergenic
964267041 3:154910389-154910411 TCTCTTCAATAAATGGTGCTAGG + Intergenic
964687245 3:159410033-159410055 TCTCTTGAATAAATGGTGCTGGG + Intronic
964853110 3:161116593-161116615 TGTCTTCAATAAATGGTGCTGGG + Intronic
964925035 3:161945230-161945252 CTTCTTTAATAAATGGTGCTGGG - Intergenic
964991126 3:162813843-162813865 TTAATTTAATAAATGGTGCTAGG - Intergenic
965026539 3:163309315-163309337 TTTCTTTAATAAATAGTGCTGGG + Intergenic
965046316 3:163582961-163582983 TCACTACAATAAATGGTGCTGGG + Intergenic
965047918 3:163602998-163603020 TCTCTTCAATAAATGGTGCTGGG + Intergenic
965094978 3:164214764-164214786 TTTCATCAATAAATGGTGCTGGG + Intergenic
965111512 3:164430234-164430256 TATCTTCAATAAATGGTGCTGGG - Intergenic
965174585 3:165315547-165315569 TCTCTTCAATAAATGGTGCTGGG - Intergenic
965237704 3:166147548-166147570 TCTCTTCAATAAATGGTGCTGGG + Intergenic
965264232 3:166520057-166520079 TTTCTTCAATAAATGGTGCTGGG - Intergenic
965298543 3:166979603-166979625 TCTCTTCAATAAATGGTGCTAGG + Intergenic
965318460 3:167221426-167221448 TCTCTTCAATAAATGGTGCTGGG + Intergenic
965348934 3:167589169-167589191 TTTCTTCAATAAATGGTGCTGGG - Intronic
965380897 3:167986742-167986764 TCTCTTAAGTAAATGGTGCTGGG + Intergenic
965665171 3:171085896-171085918 TTACTTTAAAAAATGAATCTTGG + Intronic
965808660 3:172569522-172569544 TTTCTTCAATGAATGGTGCTTGG - Intergenic
965824932 3:172720655-172720677 GTACTTTAATAACTGGAACTGGG + Intergenic
966464039 3:180209728-180209750 TCTCTTCAATAAATGGTGCTGGG + Intergenic
966468610 3:180261702-180261724 TATCTTCAATAAATGGTGCTTGG + Intergenic
966601636 3:181781284-181781306 TTTCTTAAATACATAGAACTTGG - Intergenic
966630844 3:182073076-182073098 TCTCTTTAATAAATGGTGCTGGG - Intergenic
966730622 3:183148078-183148100 TGTCTTCAATAAATGGTGCTAGG + Intronic
966779307 3:183570205-183570227 TCTCTTCAATAAATGGTGCTGGG - Intergenic
966856689 3:184198886-184198908 TTCGTGAAATAAATGGGGCTGGG + Intronic
967335017 3:188334942-188334964 TCTCTTTAATAAATGGTGCTGGG - Intronic
967575219 3:191081828-191081850 TTCCCTATATAAATGGTGCTGGG + Intergenic
967609557 3:191487795-191487817 TCTCTTTAATAAATGGTGCTGGG + Intergenic
967748927 3:193091668-193091690 TTTCTTCAATAAATGGTGCTGGG + Intergenic
967848935 3:194067657-194067679 TCTCTTCAATAAATGGTGCTGGG + Intergenic
968004455 3:195230612-195230634 TCTCTTTAATAAATGAAGCTGGG - Intronic
968177423 3:196563051-196563073 TTATTTAAATATTTGGAGCCTGG - Intronic
968300555 3:197610304-197610326 TCTCGTTAATAAATGGAGCTGGG + Intergenic
969242509 4:5909738-5909760 TCCCTTCAATAAATGGTGCTAGG - Intronic
969905547 4:10391286-10391308 TCTCTTCAATAAATGGTGCTGGG - Intergenic
970244802 4:14049549-14049571 TTGCTGAAACAAAGGGAGCTGGG - Intergenic
970357759 4:15274344-15274366 TCTCTTCAATAAATGGTGCTGGG + Intergenic
970609761 4:17714242-17714264 TCACCTAAATGAAAGGAGCTAGG - Intronic
970946159 4:21694233-21694255 ACACCTAAATAAATGGAGATAGG - Intronic
971119062 4:23683504-23683526 TGAATTAAATAAATTGAGTTTGG - Intergenic
971665183 4:29474548-29474570 TTCCTTCAATAAATGGTGCTGGG + Intergenic
971710887 4:30111038-30111060 TCACTTCAATAAATGATGCTGGG + Intergenic
971891829 4:32534009-32534031 TCTCTTCAATAAATGGTGCTGGG + Intergenic
971923929 4:32981583-32981605 TCTATTAAATAAATGGTGCTGGG - Intergenic
972014289 4:34224916-34224938 CCTCTTAAATAAATGGTGCTGGG - Intergenic
972057490 4:34822473-34822495 TTTTTTAAATAAATGTAGCAAGG - Intergenic
972091078 4:35284601-35284623 TCACTTCAATAAATGGTGCTGGG - Intergenic
972384020 4:38546333-38546355 TATCTTCAATAAATGGTGCTGGG - Intergenic
972760934 4:42103110-42103132 TCTCTTCAATAAATGGTGCTGGG - Intergenic
972807069 4:42539703-42539725 CTTCTTCAATAAATGGTGCTGGG + Intronic
972996725 4:44888482-44888504 TCTCTTCAATAAATGGTGCTGGG - Intergenic
973156606 4:46962865-46962887 TCCCTTCAATAAATGGTGCTGGG + Intronic
973729304 4:53808339-53808361 TCTCTTCAATAAATGGTGCTGGG - Intronic
973762252 4:54128738-54128760 TCTCTTAAATAAATGGTGCTGGG - Intronic
973762836 4:54135560-54135582 TCTCTTCAATAAATGGTGCTGGG + Intronic
973776637 4:54248474-54248496 TTTATTTAATAAATGGTGCTGGG + Intronic
974167358 4:58220872-58220894 TCTCTTCAATAAATGGTGCTGGG + Intergenic
974193037 4:58533373-58533395 TCTCTTCAATAAATGGTGCTGGG - Intergenic
974221177 4:58973631-58973653 CTTATTAAATAAATGGTGCTGGG - Intergenic
974722922 4:65765369-65765391 TTTATTAAATAAATGGTGCTGGG - Intergenic
974812485 4:66962769-66962791 TTACTTAAAAAACTGGAATTAGG + Intergenic
974959974 4:68686260-68686282 TCTCTTTAATAAATGGTGCTGGG + Intergenic
975079918 4:70264815-70264837 TCTCTTCAATAAATGGTGCTGGG + Intergenic
975276740 4:72511035-72511057 TCTCTTCAATAAATGGTGCTGGG + Intronic
975335995 4:73175714-73175736 TCTCTTCAATAAATGGTGCTGGG + Intronic
975346495 4:73298378-73298400 TTACTTCAATAAATGGTGTTGGG + Intergenic
975388272 4:73784890-73784912 TCTCTTCAATAAATGGTGCTGGG + Intergenic
975445860 4:74464419-74464441 TTTCTTCAATAAATGGTGCTGGG - Intergenic
975463179 4:74678559-74678581 TTTCTTCAATAAATGGTACTGGG - Intergenic
975593355 4:76022217-76022239 GCATTTAAATAAATGGAGGTAGG + Intronic
975672991 4:76800786-76800808 TCTCTTCAATAAATGGTGCTGGG + Intergenic
975674761 4:76815336-76815358 TCTCTTCAATAAATGGTGCTGGG - Intergenic
975763904 4:77646923-77646945 TCTCTTCAATAAATGGTGCTGGG + Intergenic
975917767 4:79345209-79345231 TCTCTTCAATAAATGGTGCTTGG - Intergenic
976109538 4:81656472-81656494 TCTCTTCAATAAATGGTGCTGGG - Intronic
976227049 4:82802934-82802956 TTTCTTCAACAAATGGTGCTAGG - Intergenic
976742776 4:88374245-88374267 TCTCTTCAATAAATGGTGCTGGG + Intergenic
976881179 4:89926863-89926885 TCTCTTTAATAAATGGTGCTGGG - Intronic
976909593 4:90284865-90284887 TCTCTTCAATAAATGGTGCTGGG - Intronic
976984476 4:91275892-91275914 TCCCTTCAATAAATGGTGCTGGG - Intronic
977054923 4:92180500-92180522 TCTCTTCAATAAATGGTGCTAGG + Intergenic
977073982 4:92430335-92430357 TCTCTTCAATAAATGGTGCTGGG - Intronic
977087288 4:92618241-92618263 TCTCTTCAATAAATGGTGCTAGG - Intronic
977089719 4:92655123-92655145 CTTCTTCAATAAATGGTGCTTGG - Intronic
977166544 4:93705912-93705934 TCTCTTCAATAAATGGTGCTGGG - Intronic
977236441 4:94512966-94512988 TCTCTTTAATAAATGGTGCTGGG - Intronic
977341945 4:95770122-95770144 TCTCTTCAATAAATGGTGCTGGG + Intergenic
977432625 4:96950977-96950999 TTCCTTCAATAAATGATGCTAGG + Intergenic
977454129 4:97235994-97236016 TTACTGAAAGCAATGGAGCCTGG - Intronic
977821979 4:101482879-101482901 TCTCTTTAATAAATGGTGCTGGG - Intronic
977845845 4:101765792-101765814 TTTATTCAATAAATGGTGCTAGG - Intronic
978035692 4:103990703-103990725 TCTCTTCAATAAATGGTGCTGGG - Intergenic
978062739 4:104358241-104358263 TCTCTTCAATAAATGGTGCTGGG + Intergenic
978081704 4:104601086-104601108 TCTCTTCAATAAATGGTGCTGGG - Intergenic
978082472 4:104611068-104611090 TATCTTCAATAAATGGTGCTGGG - Intergenic
978085726 4:104650348-104650370 TCTCTTCAATAAATGGTGCTGGG + Intergenic
978098382 4:104807106-104807128 TCTCTTCAATAAATGGTGCTGGG + Intergenic
978187455 4:105873222-105873244 TTACTTAAATATATAGTTCTGGG + Intronic
978214146 4:106177561-106177583 TTTTTTTAATAAATGGTGCTGGG - Intronic
978262865 4:106782973-106782995 TCTCTTCAATAAATGGTGCTGGG + Intergenic
978280961 4:107013450-107013472 TCTCTTTAATAAATGGTGCTGGG + Intronic
978288085 4:107102021-107102043 TCTCTTCAATAAATGGTGCTGGG + Intronic
978410547 4:108419873-108419895 TTTCTTCAATAAATGGTGCTGGG + Intergenic
978519599 4:109602444-109602466 TTTCTTCAATAAATGGTGCCAGG - Intronic
978584659 4:110264259-110264281 TCTCTTCAATAAATGGTGCTGGG - Intergenic
978611003 4:110539561-110539583 TTTCTTAAATAAATTGAGATGGG + Intronic
978781393 4:112558703-112558725 TTAATTAATTAAATGGAGGAGGG - Intronic
978923936 4:114219561-114219583 TTTATTCAATAAATGGTGCTGGG + Intergenic
978966179 4:114744645-114744667 TCTCTTCAATAAATGGTGCTGGG + Intergenic
978968773 4:114775958-114775980 TCTCTTGAATAAATGGTGCTGGG - Intergenic
979041912 4:115809029-115809051 TCTCTTCAATAAATGGTGCTGGG + Intergenic
979258245 4:118626105-118626127 AAAATTAAATAAATGTAGCTAGG + Intergenic
979330104 4:119414463-119414485 AAAATTAAATAAATGTAGCTAGG - Intergenic
979372802 4:119909176-119909198 TCTCTTAAGTAAATGGAGCTGGG - Intergenic
979427453 4:120585246-120585268 TCTCTTCAATAAATGGTGCTGGG + Intergenic
979429036 4:120604366-120604388 TGTCTTTAATAAATGGTGCTGGG + Intergenic
979551155 4:121992320-121992342 TTGCTTAAGTCAATGGAGTTGGG + Intergenic
979564591 4:122139935-122139957 TCTCTTCAATAAATGGTGCTGGG - Intergenic
979658431 4:123224150-123224172 ATAAATAAATAAATGGTGCTGGG - Intronic
979769407 4:124504130-124504152 TTAATGAAATATATGGAGCTAGG - Intergenic
979849790 4:125561534-125561556 TGTCTTTAATAAATGGTGCTGGG - Intergenic
979861423 4:125698079-125698101 TTTATTCAATAAATGGTGCTGGG + Intergenic
979946297 4:126836088-126836110 TCTCTTCAATAAATGGTGCTGGG + Intergenic
980413367 4:132452459-132452481 TCTCTTCAATAAATGGTGCTGGG + Intergenic
980449548 4:132952044-132952066 TTACTCAAATAACTGCATCTAGG - Intergenic
980620257 4:135292010-135292032 TCTCTTCAATAAATGGTGCTGGG - Intergenic
980697140 4:136373253-136373275 TCCCTTCAATAAATGGTGCTGGG - Intergenic
980868389 4:138581112-138581134 TCTCTTCAATAAATGGTGCTGGG - Intergenic
981575438 4:146199320-146199342 TTTCTTCAATAAATGGTGCTAGG - Intronic
981836494 4:149060693-149060715 TTTCTTCAATAAATGGTGTTGGG - Intergenic
982016249 4:151156582-151156604 TCTCTTCAATAAATGGCGCTGGG + Intronic
982241249 4:153301722-153301744 TCTCTTCAATAAATGGTGCTAGG - Intronic
982323040 4:154100276-154100298 TCTCTTCAATAAATGGTGCTGGG - Intergenic
982469677 4:155773172-155773194 TCACAAAAATACATGGAGCTTGG - Intronic
982608357 4:157541391-157541413 TATCTTCAATAAATGGTGCTGGG - Intergenic
982663616 4:158233997-158234019 ATAATAAAATAAATGCAGCTTGG + Intronic
982682953 4:158454141-158454163 TCTCTTCAATAAATGGTGCTGGG - Intronic
982822627 4:159962355-159962377 TTTCTTCAATGAATGGTGCTGGG - Intergenic
982898549 4:160966908-160966930 TCTCTTCAATAAATGGAGTTAGG - Intergenic
982903627 4:161040290-161040312 TTTCATCAATAAATGGTGCTGGG + Intergenic
982933106 4:161434314-161434336 TTTCTTCAATAAATGGTTCTGGG + Intronic
983333963 4:166368385-166368407 TCTCTTCAATAAATGGTGCTAGG - Intergenic
983348463 4:166557482-166557504 TCTCTTCAATAAATGGTGCTGGG - Intergenic
983411104 4:167399182-167399204 ATAATTTAATAAATGGTGCTGGG - Intergenic
983421514 4:167524465-167524487 TCTCTTCAATAAATGGCGCTGGG - Intergenic
983456083 4:167966872-167966894 TCTCTTCAATAAATGGTGCTGGG - Intergenic
983599069 4:169503628-169503650 TCTCTTCAATAAATGGTGCTGGG + Intronic
983786597 4:171739242-171739264 TTACTGTAATAAATGCAGTTTGG - Intergenic
983876684 4:172884852-172884874 TTTCTTCAATAAATGATGCTGGG - Intronic
983888972 4:173011609-173011631 TCTCTTTAATAAATGGTGCTGGG - Intronic
983921723 4:173353002-173353024 ATTTTTAAATAAATGGTGCTAGG + Intergenic
984079021 4:175219638-175219660 ACACTTCAATAAATGGTGCTGGG - Intergenic
984174651 4:176401565-176401587 ATACATAAATAAATGAAGCAGGG + Intergenic
984389812 4:179114767-179114789 TTAATTAAAGTAATGGAACTAGG - Intergenic
984747441 4:183236086-183236108 TCCCTTCAATAAATGGTGCTGGG - Intronic
985230000 4:187805226-187805248 TGTCTTCAATAAATGGTGCTGGG + Intergenic
985300468 4:188482933-188482955 TTATTTCAATAAATGGTGCTAGG - Intergenic
985697867 5:1351754-1351776 ATTCTTCAATAAATGGTGCTGGG - Intergenic
985751320 5:1678470-1678492 TCTCTTCAATAAATGGTGCTGGG - Intergenic
986084634 5:4432253-4432275 TATCTTCAATAAATGGTGCTGGG - Intergenic
986618262 5:9642637-9642659 TTACTAGAATAAATTGAGCAAGG - Intronic
986657179 5:10025795-10025817 TCTCTTAAATAAATGGTTCTGGG - Intergenic
987069692 5:14324118-14324140 TAACTAAAATAAATGGAACCAGG + Intronic
987084743 5:14458017-14458039 TTACTAAAATAAGTGGGCCTGGG + Intronic
987189415 5:15459070-15459092 TCTCTTCAATAAATGGTGCTGGG - Intergenic
987272078 5:16320911-16320933 TTATTGAAATAAATGGTACTGGG - Intergenic
987400540 5:17471383-17471405 TTTCTTCAATAAGTGGTGCTGGG + Intergenic
987433896 5:17869640-17869662 TCTCTTCAATAAATGGTGCTGGG - Intergenic
987573196 5:19692141-19692163 TGTCTTCAATAAATGGTGCTAGG + Intronic
987681986 5:21147738-21147760 TCTCTTTAATAAATGGTGCTGGG - Intergenic
987952159 5:24688865-24688887 TTACTTCAATAAGTGGTGCTGGG + Intergenic
987952870 5:24698625-24698647 TAACTTCAATAAACGGGGCTGGG - Intergenic
987992455 5:25231446-25231468 TCTCTTTAATAAATGGTGCTGGG + Intergenic
988236526 5:28552126-28552148 TCTCTTCAATAAATGGTGCTGGG - Intergenic
988345894 5:30036894-30036916 TCTCTTAAATAAATGGTGCTGGG + Intergenic
988353332 5:30141437-30141459 TCTCTTCAATAAATGAAGCTCGG - Intergenic
988719848 5:33866355-33866377 TTTAATAAATAAATGGTGCTGGG + Intronic
988836825 5:35041290-35041312 TTCATTAAATATTTGGAGCTAGG + Intronic
989081704 5:37629931-37629953 TTACTCATATAAATGGATCTTGG + Intronic
989111517 5:37911162-37911184 TTTCTTCAATAAATAGCGCTGGG + Intergenic
989240346 5:39196068-39196090 GTACTCAACTGAATGGAGCTTGG - Intronic
989354231 5:40523911-40523933 TCTCTTCAATAAATGGTGCTGGG + Intergenic
989669992 5:43905593-43905615 TTACTTACATAAAAGAAGGTAGG + Intergenic
989802139 5:45555966-45555988 TCTCTTCAATAAATGGTGCTGGG + Intronic
989991551 5:50773404-50773426 TCTCTTCAATAAATGGTGCTGGG - Intronic
990136210 5:52646455-52646477 TTATTTAAAAAAATAGACCTTGG + Intergenic
990628825 5:57644697-57644719 TTTATTCAATAAATGGTGCTGGG - Intergenic
990801003 5:59602944-59602966 TCTCTTCAATAAATGGTGCTGGG + Intronic
990922380 5:60981862-60981884 TCTCTTTAATAAATGGTGCTGGG + Intronic
990932483 5:61108692-61108714 TCTCTTCAATAAATGGTGCTGGG - Intronic
990963747 5:61422299-61422321 TCTCTTCAATAAATGGTGCTGGG - Intronic
990995085 5:61724937-61724959 TTACTAAGATAAATTCAGCTTGG - Intronic
991233360 5:64363325-64363347 TCTCTTCAATAAATGGTGCTCGG - Intronic
991238740 5:64431288-64431310 TCTCTTCAATAAATGGTGCTGGG + Intergenic
991241334 5:64464233-64464255 TCTCTTCAATAAATGGTGCTGGG + Intergenic
991318756 5:65343452-65343474 TATCTTCAATAAATGGTGCTGGG + Intronic
991537185 5:67682893-67682915 TCTCTTCAATAAATGGTGCTGGG - Intergenic
991932901 5:71772137-71772159 TTTTTTAAATAAATGGTGCTGGG - Intergenic
992012572 5:72543780-72543802 TCTCTTCAATAAATGGTGCTGGG - Intergenic
992036242 5:72780765-72780787 TTTCTTCAATAAATGGTGCCAGG + Intergenic
992224160 5:74603005-74603027 TGTCTTCAATAAATGGTGCTGGG + Intergenic
992248719 5:74856014-74856036 TCTCTTTAATAAATGGTGCTGGG - Intronic
992312640 5:75516876-75516898 TCTCTTCAATAAATGGTGCTGGG - Intronic
992659759 5:78947037-78947059 TCTCTTCAATAAATGGTGCTGGG + Intronic
992906516 5:81351512-81351534 TCTCTTCAATAAATGGTGCTGGG + Intronic
993207540 5:84902155-84902177 TTTATTAAATAAATGGCACTGGG + Intergenic
993367643 5:87052693-87052715 TCTCTTAAATAAATGGTGCTGGG + Intergenic
993579696 5:89644792-89644814 TTTCTTTAATAAATGGTGCTAGG + Intergenic
993672657 5:90780082-90780104 TTAATTAAATAAATGCAATTTGG + Intronic
993697502 5:91079179-91079201 TTATTTTCAGAAATGGAGCTTGG - Intronic
993820655 5:92611779-92611801 TTACTTAAATAAATTTATTTAGG - Intergenic
993950130 5:94164767-94164789 TCTCTTCAATAAATGGTGCTGGG + Intronic
994000033 5:94768162-94768184 TCTCTTCAATAAATGGGGCTGGG + Intronic
994053275 5:95386679-95386701 TCTCTTCAATAAATGGTGCTGGG + Intergenic
994068834 5:95575076-95575098 TCTCTTCAATAAATGGTGCTGGG - Intronic
994226638 5:97259484-97259506 TGTCTTCAATAAATGGTGCTGGG + Intergenic
994293157 5:98054295-98054317 TCTCTTCAATAAATGGTGCTGGG + Intergenic
994357316 5:98808206-98808228 TCTCTTCAATAAATGGTGCTGGG + Intergenic
994381245 5:99074223-99074245 TCTCTTTAATAAATGGTGCTGGG - Intergenic
994422939 5:99544983-99545005 CTAATTCAATAAATGGTGCTAGG - Intergenic
994470023 5:100191800-100191822 CCACTTCAATAAATGGTGCTGGG - Intergenic
994650427 5:102520197-102520219 TTATTTTAATAAACGGAGCCAGG - Intergenic
994671708 5:102769585-102769607 TCTCTTTAATAAATGGTGCTGGG - Intronic
994951474 5:106469147-106469169 TCTCTTCAATAAATGGTGCTGGG + Intergenic
995116758 5:108489646-108489668 TTTCTTCAATAAATGGTGCTGGG + Intergenic
995213282 5:109565419-109565441 TCGCTTCAATAAATGGTGCTGGG - Intergenic
995262299 5:110118855-110118877 TCTCTTCAATAAATGGTGCTGGG - Intergenic
995289639 5:110436689-110436711 TCTCTTCAATAAATGGTGCTGGG - Intronic
995292905 5:110480179-110480201 TTACTTAAATAAATAGCAGTGGG + Intronic
995295916 5:110521684-110521706 TCTCTTCAATAAATGGTGCTAGG - Intronic
995364343 5:111339459-111339481 TTTCATTAATAAATGGTGCTGGG - Intronic
995415119 5:111902207-111902229 TCTCTTAAATAAATGGTGCTGGG + Intronic
995515040 5:112945961-112945983 TCTCTTCAATAAATGGTGCTGGG + Intergenic
995535712 5:113134301-113134323 TCTCTTCAATAAATGGTGCTGGG - Intronic
995813696 5:116141158-116141180 TCTCTTTAATAAATGGTGCTGGG - Intronic
995891111 5:116952693-116952715 TTCCTTACAAAAATAGAGCTGGG - Intergenic
996027206 5:118659493-118659515 TCTCTTCAATAAATGGTGCTGGG - Intergenic
996040424 5:118803625-118803647 TCTCTTTAATAAATGGTGCTTGG + Intergenic
996073116 5:119157554-119157576 TTTCTTCAAAAAATGGTGCTGGG - Intronic
996103008 5:119464420-119464442 TCTCTTCAATAAATGGTGCTGGG - Intronic
996144744 5:119960323-119960345 TTTCTTTAATAAATGGTGCTGGG + Intergenic
996521550 5:124432481-124432503 TCTCTTCAATAAATGGTGCTGGG + Intergenic
996829392 5:127722691-127722713 TCTCTTCAATAAATGGTGCTGGG - Intergenic
997099286 5:130950616-130950638 TCTCTTCAATAAATGGTGCTTGG - Intergenic
997143671 5:131409661-131409683 TCTCTTCAATAAATGGTGCTGGG + Intergenic
997158347 5:131581235-131581257 TTACTTAAATTAATCTGGCTTGG + Intronic
997403284 5:133619372-133619394 CTACTTAAATCAATTGAGTTGGG + Intergenic
997541148 5:134663650-134663672 TTATTTAAAAAAATAGAGATGGG - Intronic
997709185 5:135989454-135989476 TCAGTTCAATAAATGGTGCTGGG - Intergenic
998010639 5:138692766-138692788 TCTCTTCAATAAATGGTGCTGGG - Intronic
998047144 5:138997365-138997387 TCTCTTCAATAAATGGTGCTGGG - Intronic
998058354 5:139098351-139098373 TCTCTTCAATAAATGGTGCTGGG + Intronic
998581510 5:143381690-143381712 TCTCTTCAATAAATGGTGCTGGG + Intronic
998746700 5:145268372-145268394 TCTCTTCAATAAATGGTGCTGGG - Intergenic
998793273 5:145789407-145789429 TCTCTTCAATAAATGGTGCTGGG + Intronic
998883638 5:146671396-146671418 TTGCATAAACAAATAGAGCTGGG + Intronic
999022355 5:148181473-148181495 TCTCTTCAATAAATGGTGCTGGG - Intergenic
999028735 5:148265674-148265696 TATCTTCAATAAATGGTGCTGGG + Intergenic
999455406 5:151711808-151711830 TCTCTTCAATAAATGGTGCTGGG - Intergenic
999485048 5:151986690-151986712 TCTCTTAAATAAATGGTGCTAGG - Intergenic
999650350 5:153760938-153760960 TCTCTTCAATAAATGGTGCTGGG + Intronic
999919163 5:156299172-156299194 TCTCTTCAATAAATGGTGCTGGG - Intronic
999999950 5:157128309-157128331 TCTCTTCAATAAATGGTGCTGGG + Intronic
1000497007 5:161996886-161996908 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1000549404 5:162641122-162641144 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1000583831 5:163069820-163069842 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1000773938 5:165393333-165393355 TATCTTCAATAAATGGTGCTAGG + Intergenic
1000895554 5:166850863-166850885 TTAAATAAATAAATGGATGTAGG - Intergenic
1001417950 5:171561131-171561153 CCACTTAAATACATGAAGCTTGG - Intergenic
1002766454 6:243747-243769 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1003053515 6:2800011-2800033 ATACATAAGTAAATGGAGCTGGG + Intergenic
1003267437 6:4578362-4578384 TTTCTCCACTAAATGGAGCTAGG + Intergenic
1003510519 6:6775900-6775922 TTATTTAGAGAAATGGAGATAGG - Intergenic
1003769085 6:9277298-9277320 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1004912166 6:20297115-20297137 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1005280249 6:24266102-24266124 TCTCTTCAATAAATGGTGCTGGG + Intronic
1005769763 6:29056003-29056025 TTGATTCAATAAATGGTGCTGGG - Intergenic
1005872994 6:29990419-29990441 TCTCTTAAATAAATGGTGCTGGG + Intergenic
1005877943 6:30028609-30028631 TTTCTTCAATAAATGATGCTGGG - Intergenic
1005897827 6:30192885-30192907 TCTCTTTAATAAATGGTGCTAGG - Intronic
1006071654 6:31501664-31501686 TCTCTTCAATAAATGGTGCTGGG - Intronic
1006619146 6:35350481-35350503 TCTCTTCAATAAATGGTGCTTGG - Intronic
1007022507 6:38535766-38535788 TATCTTCAATAAATGGTGCTGGG + Intronic
1007212006 6:40200648-40200670 TTTCTTCAATAAATGGTGCTGGG - Intergenic
1007564523 6:42839314-42839336 TTATTTTAAAAAATAGAGCTGGG + Intronic
1007893315 6:45317599-45317621 TCTCTTCAATAAATGGTGCTGGG + Intronic
1008017378 6:46536104-46536126 TTTCTTCAATAAATGGTGTTGGG - Intergenic
1008018261 6:46546046-46546068 TATCTTCAATAAATGGTGCTGGG + Intergenic
1008108862 6:47470945-47470967 TTTCTTCAATAAATGGTGCTGGG + Intergenic
1008170521 6:48199896-48199918 TCTCTTCAATAAATGGTGCTAGG - Intergenic
1008191729 6:48466894-48466916 TTTCTTCAATAAATAGTGCTTGG + Intergenic
1008226964 6:48932277-48932299 TGTCTTCAATAAATGGTGCTGGG - Intergenic
1008232933 6:49007288-49007310 GTTCTTTAATAAAAGGAGCTAGG - Intergenic
1008331974 6:50256385-50256407 TTTATTCAATAAATGGTGCTGGG - Intergenic
1008678875 6:53850987-53851009 TGACTTAATTGAATGGAGCTGGG + Intronic
1008731433 6:54487277-54487299 TTTCTTCAATAAATGGTGCTGGG - Intergenic
1008858435 6:56119816-56119838 TTTCTTCAAGAAATGGTGCTAGG + Intronic
1009206428 6:60807161-60807183 TTACTTCAATAAATGATGCTAGG - Intergenic
1009454563 6:63840770-63840792 TGTCTTCAATAAATGGTGCTGGG - Intronic
1009540855 6:64956349-64956371 TTTGTTCAATAAATGGTGCTGGG + Intronic
1009635148 6:66255825-66255847 TTTCTTCAATAAATGGTGCTGGG + Intergenic
1009696256 6:67107768-67107790 TTTCTTCAATAAATGGTGCTGGG + Intergenic
1009712239 6:67339275-67339297 TCTCTTCAATAAATGGTGCTAGG + Intergenic
1009718845 6:67437584-67437606 TTTCCTAAATAAATGGTCCTGGG - Intergenic
1009783882 6:68305863-68305885 TGTCTTCAATAAATGGTGCTGGG + Intergenic
1009789117 6:68377844-68377866 TCTCTTCAATAAATGGTGCTAGG - Intergenic
1009803638 6:68573822-68573844 TTTCTTCAATAAATGCTGCTGGG + Intergenic
1009824048 6:68843930-68843952 TCTCTTCAATAAATGGTGCTGGG + Intronic
1009858925 6:69299614-69299636 TTTCTTCAATTAATGGTGCTGGG - Intronic
1010088206 6:71946540-71946562 TTTCTTCAATAAATGGTGCTGGG + Intronic
1010156915 6:72805392-72805414 TCTCTTCAATAAATGGTGCTGGG - Intronic
1010252006 6:73717010-73717032 TCTCTTCAATAAATGGTGCTAGG - Intronic
1010280720 6:74019760-74019782 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1010313619 6:74419086-74419108 CTTCTTCAATAAATGGTGCTGGG - Intergenic
1010316947 6:74462658-74462680 TGTCTTCAATAAATGGTGCTGGG - Intergenic
1010328364 6:74591844-74591866 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1010333390 6:74651302-74651324 TTTATTCAATAAATGGTGCTGGG - Intergenic
1010481845 6:76364665-76364687 TCTCTTCAATAAATGGCGCTGGG - Intergenic
1010539937 6:77080538-77080560 TTTCTTCAATAAATGGTTCTGGG + Intergenic
1010638868 6:78296939-78296961 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1010647848 6:78414165-78414187 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1010848313 6:80740153-80740175 TCTCTTAAATAAATGGTACTGGG - Intergenic
1011116796 6:83902252-83902274 CTTCTTCAATAAATGGTGCTGGG - Intronic
1011153578 6:84303052-84303074 CGACTTAAATAAATGGTGTTGGG - Intergenic
1011190108 6:84719542-84719564 GTACTTTAATAACTGGAACTGGG - Intronic
1011341387 6:86318841-86318863 CCACTTCAATAAATGGTGCTGGG + Intergenic
1011359294 6:86505384-86505406 TTTCTTCAATAAATAGTGCTAGG - Intergenic
1011369686 6:86622276-86622298 TGTCTTCAATAAATGGTGCTGGG - Intergenic
1011447495 6:87457576-87457598 TCTCTTCAATAAATGGTGCTGGG + Intronic
1011914211 6:92482701-92482723 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1011969681 6:93207552-93207574 TTCCTTCAATAAATAGCGCTGGG + Intergenic
1012000323 6:93646541-93646563 TTACTTAAAGCAATGTAACTTGG + Intergenic
1012132057 6:95508384-95508406 TTTATTCAATAAATGGTGCTAGG + Intergenic
1012134215 6:95535924-95535946 TTCAATAAATAAATGGTGCTGGG - Intergenic
1012300657 6:97583489-97583511 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1012696765 6:102393777-102393799 TCTATTTAATAAATGGAGCTGGG + Intergenic
1012711228 6:102608640-102608662 TCTCTTCAATAAATGGCGCTAGG + Intergenic
1012744711 6:103071004-103071026 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1012782948 6:103586319-103586341 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1013058371 6:106607159-106607181 TTTCTTCAATAAATGGTGCTGGG + Intronic
1013723895 6:113067958-113067980 TTATTTAAAAAAATAAAGCTTGG + Intergenic
1013776200 6:113681120-113681142 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1013784376 6:113763616-113763638 TTACTTCCAAAAATGGAGATTGG + Intergenic
1014275452 6:119382758-119382780 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1014390966 6:120863766-120863788 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1014566237 6:122952465-122952487 ATACTTCAATAAATGGTTCTGGG + Intergenic
1014797447 6:125742428-125742450 TTTGTTATATAAATGGAGTTTGG + Intergenic
1014838753 6:126191677-126191699 TTTCTTTAATAAATGGTTCTGGG - Intergenic
1015030720 6:128591946-128591968 TGTCTTCAATAAATGGTGCTGGG + Intergenic
1015125940 6:129754680-129754702 TTACTAAAATAAATTGAGACTGG - Intergenic
1015172763 6:130272217-130272239 ATTATTAAATAAATGGAGATGGG - Intronic
1015345928 6:132159489-132159511 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1015393150 6:132706414-132706436 TTTTTTCAATAAATGGTGCTGGG + Intronic
1015675972 6:135749292-135749314 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1015711848 6:136150441-136150463 TCTCTTCAATAAATGGTGCTGGG - Intronic
1015735542 6:136395788-136395810 TCTCTTCAATAAATGGTGCTGGG - Intronic
1015743116 6:136480252-136480274 TCTCTTCAATAAATGGTGCTGGG + Intronic
1015907634 6:138133884-138133906 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1015959890 6:138637155-138637177 TCTCTTCAATAAATGGCGCTGGG + Intronic
1016423309 6:143908010-143908032 TTTATTTAATAAATGGTGCTGGG - Intronic
1016542818 6:145185249-145185271 TTTCTTCAATGAATGGTGCTAGG + Intergenic
1016728587 6:147403370-147403392 TCCCTTCAATAAATGGTGCTGGG - Intergenic
1016835938 6:148476973-148476995 TCTCTTCAATAAATGGTGCTGGG + Intronic
1017004138 6:150017764-150017786 CTAATTCAATAAATGGTGCTGGG - Intergenic
1017018652 6:150122252-150122274 TTTCTTCAATAAATGGTGTTGGG - Intergenic
1017033956 6:150250604-150250626 TTAATTAAATGAAAGGAGCATGG - Intergenic
1017059962 6:150473729-150473751 TTTATTCAATAAATGGTGCTGGG - Intergenic
1017356447 6:153514975-153514997 TTTCTTTAATAAATGGGGCTGGG - Intergenic
1017397770 6:154022782-154022804 TCTCTTCAATAAATGGTGCTGGG - Intronic
1017509202 6:155097888-155097910 TCTCTTCAATAAATGGTGCTGGG - Intronic
1017536935 6:155357212-155357234 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1017579374 6:155845726-155845748 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1017623362 6:156322029-156322051 TCTCTTCAATAAATGGGGCTGGG - Intergenic
1017661146 6:156674885-156674907 TTTCTTTAATAAATGGTCCTGGG + Intergenic
1018074212 6:160196449-160196471 TTTCTTCAATAAATGGTGCTGGG + Intronic
1018144222 6:160867869-160867891 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1018559376 6:165085660-165085682 TTACTAAAAAAAATTGAGGTGGG - Intergenic
1018571757 6:165218910-165218932 GTACTTGAATAGAGGGAGCTGGG + Intergenic
1018574267 6:165242907-165242929 TCAACTAAACAAATGGAGCTGGG - Intergenic
1018661836 6:166095024-166095046 AAAATTAAATAAATGGTGCTGGG - Intergenic
1019090229 6:169524689-169524711 TCTCTTCAATAAATGGTGCTGGG + Intronic
1019382700 7:733012-733034 TTTCTTCAATAAATGGTGCTGGG - Intronic
1020475809 7:8593037-8593059 TGAGTTAAAGAAATGGACCTTGG - Intronic
1020570970 7:9860715-9860737 TTTCTTCAATAAATGGTACTGGG + Intergenic
1020573779 7:9899637-9899659 CTTCTTCAATAAATGGTGCTGGG + Intergenic
1020737936 7:11975186-11975208 TTTATTCAATAAATGGTGCTTGG + Intergenic
1020761667 7:12274747-12274769 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1020776646 7:12462333-12462355 TCACTTCAAGAAATGGTGCTGGG + Intergenic
1020916007 7:14193455-14193477 TCTCTTCAATAAATGGTGCTAGG + Intronic
1020925668 7:14320954-14320976 TTCCTTAAATAAATCTAACTTGG - Intronic
1020947685 7:14634319-14634341 TTATTTGAATAAATAGAGCCTGG - Intronic
1021004794 7:15380941-15380963 CTAATTCAATAAATGGTGCTGGG + Intronic
1021060914 7:16110704-16110726 TTTTTTCAATAAATGGTGCTGGG + Intronic
1021306924 7:19043754-19043776 TTTATTCAGTAAATGGAGCTGGG - Intronic
1021472282 7:21018084-21018106 TTTTTTCAATAAATGGTGCTAGG - Intergenic
1021504274 7:21364027-21364049 TTAAATAAATAAATGGGGCCAGG - Intergenic
1021595081 7:22306786-22306808 TCTCTTTAATAAATGGTGCTGGG - Intronic
1021752865 7:23821885-23821907 CCACTTCAATAAATGGTGCTGGG - Intronic
1021797734 7:24274211-24274233 GTATTTAAATAAATGGTGCTGGG - Intergenic
1022085158 7:27060103-27060125 TGTCTTCAATAAATGGTGCTGGG + Intergenic
1022166109 7:27764113-27764135 TTTCTTAAATAAATGTACCATGG - Intronic
1022254136 7:28639017-28639039 TTAATGAAATATATTGAGCTGGG + Intronic
1022348663 7:29544745-29544767 TATCTTCAATAAATGGTGCTAGG + Intergenic
1022366558 7:29725673-29725695 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1022541566 7:31140886-31140908 TCTCTTCAATAAATGGTGCTAGG - Intergenic
1023203259 7:37721232-37721254 TTAGTTGAAGAAATGAAGCTCGG - Intronic
1023400231 7:39787399-39787421 AAAATTAAATAAATGTAGCTAGG + Intergenic
1023716594 7:43050935-43050957 TTTCTTCAATAAATGGTGCTGGG + Intergenic
1023885816 7:44354763-44354785 CTAATTCAATAAATGGTGCTGGG - Intergenic
1024050438 7:45618138-45618160 TCTCTTCAATAAATGGTGCTGGG + Intronic
1024073160 7:45803150-45803172 AAAATTAAATAAATGTAGCTAGG + Intergenic
1024316321 7:48021168-48021190 TCTCTTCAATAAATGGTGCTGGG + Intronic
1024320084 7:48056861-48056883 TTTCTTCAATAAATGATGCTGGG - Intronic
1024513651 7:50223738-50223760 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1024590504 7:50878338-50878360 TCGATTAAATAAATGGTGCTGGG + Intergenic
1024895936 7:54262245-54262267 CTTTTTCAATAAATGGAGCTGGG - Intergenic
1025029335 7:55544144-55544166 TCTCTTCAATAAATGGTGCTGGG - Intronic
1025183428 7:56837291-56837313 TTAATAAAATAAATGCAGGTAGG - Intergenic
1025688497 7:63739676-63739698 TTAATAAAATAAATGTAGGTAGG + Intergenic
1025730987 7:64107457-64107479 TTAATTAAATAGTTGGAGGTTGG + Intronic
1025973187 7:66347409-66347431 TCTCTTCAATAAATGGTGCTGGG - Intronic
1026176181 7:67999432-67999454 TTACTTACATATATGGTGCTTGG + Intergenic
1026505604 7:70980032-70980054 TCAGTTAATTAAATGGAGATGGG + Intergenic
1027407275 7:77874853-77874875 TCTCTTCAATAAATGGTGCTGGG - Intronic
1027541607 7:79473728-79473750 TTTATTTAATAAATGGTGCTGGG - Intergenic
1027641465 7:80738477-80738499 TTACATAATTAAATGGAGATGGG - Intergenic
1027680949 7:81221485-81221507 TTTCTTTAATAAATAGTGCTAGG - Intergenic
1027850215 7:83442239-83442261 TTAATTAAAGAAATGGAAATAGG - Intronic
1028176234 7:87662485-87662507 TCTCTTCAATAAATGGTGCTGGG - Intronic
1028183872 7:87757912-87757934 TCTCTTCAATAAATGGTGCTGGG + Intronic
1028196532 7:87913847-87913869 TTACCCAAGTAAATGGAGATTGG + Intergenic
1028206699 7:88025599-88025621 TTTCTTCAATAAATGGTGCTGGG - Intronic
1028264288 7:88704057-88704079 TCTCTTCAATAAATGGGGCTGGG - Intergenic
1028266087 7:88727623-88727645 TTTCTTCAATAAATGGTGCTGGG - Intergenic
1028335588 7:89650319-89650341 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1028514560 7:91662346-91662368 TCACTTCAATAAAGGGTGCTGGG - Intergenic
1028700162 7:93768705-93768727 TCTCTTCAATAAATGGTGCTTGG + Intronic
1028721402 7:94036423-94036445 TTAATTATATAAATGGAATTTGG + Intergenic
1029320561 7:99755378-99755400 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1029793471 7:102869709-102869731 TCTCTTCAATAAATGGTGCTGGG - Intronic
1029848328 7:103436702-103436724 TCTCTTCAATAAATGGTGCTGGG + Intronic
1030266556 7:107628083-107628105 TCTCTTCAATAAATGGTGCTGGG - Intronic
1030285121 7:107817954-107817976 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1030341169 7:108382422-108382444 TTAATTAAAAAAATAGAGATGGG - Intronic
1030351545 7:108494024-108494046 TCAGTTAAATAAATGGAGCTGGG + Intronic
1030370084 7:108689433-108689455 TTTCTTCAATAAATGGTGCTGGG - Intergenic
1030389900 7:108914682-108914704 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1030407839 7:109137228-109137250 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1030476401 7:110038717-110038739 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1030522511 7:110615826-110615848 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1030593891 7:111512860-111512882 GTTCTTCAATAAATGGTGCTTGG + Intronic
1030669809 7:112323652-112323674 TTTCTTAAATAAATGTTCCTTGG + Intronic
1030679261 7:112417416-112417438 TCTCTTTAATAAATGGTGCTGGG + Intergenic
1030739653 7:113093105-113093127 TTATTTAAATAAATACAGCATGG + Intergenic
1031078501 7:117235825-117235847 TCTCTTCAATAAATGGCGCTGGG - Intergenic
1031215761 7:118888529-118888551 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1031243623 7:119277847-119277869 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1031287094 7:119884446-119884468 TTTCTTTAGTAAATGGTGCTGGG - Intergenic
1031394517 7:121256340-121256362 TTTATTCAATAAATGGTGCTGGG + Intronic
1031465805 7:122109557-122109579 TCTCTTCAATAAATGGTGCTGGG + Intronic
1031490025 7:122375490-122375512 TTTCTTCAATAAATAGTGCTGGG + Intronic
1031566409 7:123303045-123303067 TTTCTTCAATAATTGGTGCTGGG + Intergenic
1031653438 7:124320946-124320968 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1031904284 7:127443715-127443737 TTGCTTAAGTGAATGGTGCTTGG + Intergenic
1032050547 7:128646844-128646866 AAAATTAAATAAATGTAGCTAGG + Intergenic
1032891074 7:136195651-136195673 CTTCTTCAATAAATGGTGCTGGG - Intergenic
1033056165 7:138056804-138056826 TTAATTTAATAAATGGTGCTGGG - Intronic
1033708987 7:143918758-143918780 TTTCTTCAATAAATGGTGCTAGG - Intergenic
1033772791 7:144572011-144572033 CTACTTAATAAATTGGAGCTGGG - Intronic
1034142856 7:148838707-148838729 TTGCTTAAATCAGTGGATCTGGG + Intronic
1034199459 7:149274301-149274323 TTATTTCAATAAATGGTGCCAGG - Intronic
1034216591 7:149412073-149412095 TCTATTAAATAAATGGTGCTGGG + Intergenic
1034612373 7:152382936-152382958 TTACTTAAATAAATGATTCATGG - Intronic
1035710191 8:1707432-1707454 TTATTTAAATGAGTGGGGCTGGG - Exonic
1036099881 8:5768045-5768067 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1036394361 8:8355684-8355706 TCTCTTTAATAAATGGTGCTGGG + Intronic
1037376006 8:18229523-18229545 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1037444257 8:18948495-18948517 TTTCTCAAAAAAATGGAGGTGGG + Intronic
1037798971 8:22021151-22021173 CTTCTTTAATAAATGGTGCTGGG + Intergenic
1038860671 8:31386011-31386033 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1038893225 8:31751311-31751333 TTCATTAAATAAATGGCCCTTGG + Intronic
1039005597 8:33033168-33033190 TATCTTCAATAAATGGTGCTGGG + Intergenic
1039006375 8:33042227-33042249 TTTCTCGAATAAATGGAGTTAGG - Intergenic
1039241832 8:35565798-35565820 CTAATTCAATAAATGGTGCTGGG - Intronic
1039678438 8:39700580-39700602 TTAGTTAAATAAAAAGAGGTTGG - Intronic
1039706998 8:40017627-40017649 TTTAATAAATAAATGGTGCTGGG - Intergenic
1040349886 8:46554065-46554087 TCTCTTAAATAAACGGTGCTGGG + Intergenic
1040363922 8:46694286-46694308 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1040367885 8:46738184-46738206 TCTCTTCAATAAATGGTGCTAGG - Intergenic
1040424218 8:47268752-47268774 TTAAAAAAATCAATGGAGCTGGG - Intronic
1040510923 8:48093778-48093800 CTTCTTCAATAAATGGTGCTGGG - Intergenic
1040518543 8:48154463-48154485 TCATTTAAATATATGGTGCTGGG - Intergenic
1040525544 8:48220732-48220754 TTTTTTAAAAAAATGGAGATGGG - Intergenic
1040628342 8:49178376-49178398 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1040666286 8:49638053-49638075 ATACTTAAATAAATAGAATTAGG - Intergenic
1040707043 8:50141189-50141211 TTACTTAAATATATGGGAATAGG + Intronic
1040725110 8:50373249-50373271 TTCCTTAAATAAGAGGATCTGGG - Intronic
1040793370 8:51260779-51260801 TTTCTTTAATAAATGGTGCTGGG - Intergenic
1040893582 8:52341908-52341930 TTCCTTAAATACAAGGAGGTGGG - Intronic
1040973111 8:53159049-53159071 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1041023773 8:53663690-53663712 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1041078970 8:54196762-54196784 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1041161431 8:55049194-55049216 TCTCTTCAATAAATGGAGCTGGG + Intergenic
1041563726 8:59250648-59250670 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1041582697 8:59480721-59480743 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1041882924 8:62773289-62773311 ATTCTTCAATAAATGGTGCTGGG - Intronic
1041902738 8:62999864-62999886 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1041955085 8:63549878-63549900 TTAGTTACATATATGGATCTTGG + Intergenic
1041996421 8:64065284-64065306 TTTCTTCAATAAATGGTCCTAGG + Intergenic
1042082091 8:65065579-65065601 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1042138105 8:65651533-65651555 TCTCTTCAATAAATGGTGCTGGG - Intronic
1042605048 8:70536898-70536920 TCTCTTCAATAAATAGAGCTGGG - Intergenic
1042608498 8:70571703-70571725 TCTCTTCAATAAATGGTGCTAGG + Intergenic
1042634516 8:70858765-70858787 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1042680094 8:71373896-71373918 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1042855946 8:73267624-73267646 AAACCTTAATAAATGGAGCTTGG + Intergenic
1042933996 8:74040566-74040588 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1043035933 8:75199233-75199255 CTTCTTCAATAAATGGTGCTGGG - Intergenic
1043056962 8:75451575-75451597 TCTCTTCAATAAATGGTGCTGGG - Intronic
1043110727 8:76177466-76177488 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1043145302 8:76646841-76646863 TATCTTCAATAAATGGTGCTGGG + Intergenic
1043290734 8:78596914-78596936 TCTCTTCAATAAATGGTGCTGGG - Intronic
1043612048 8:82076910-82076932 TTTTTTAAATAAATGGTCCTGGG - Intergenic
1043710851 8:83416918-83416940 TCACTTAAAATAATGGTGCTTGG - Intergenic
1043770973 8:84199728-84199750 TTTCTTTAATAAATGGTGCTGGG - Intronic
1044119159 8:88373114-88373136 TCTCTTCAATAAATGGTGCTAGG - Intergenic
1044160272 8:88904998-88905020 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1044394486 8:91694041-91694063 CCTCTTAAATAAATGGTGCTGGG - Intergenic
1044513874 8:93116096-93116118 TCAGTTAAAGAGATGGAGCTGGG - Intergenic
1044793927 8:95877033-95877055 TTATTCAAATAAATAGTGCTAGG + Intergenic
1044850937 8:96426946-96426968 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1045095768 8:98796399-98796421 TTAATTCAATAAATGGTGCTGGG + Intronic
1045127500 8:99108509-99108531 TCTCTTCAATAAATGGTGCTGGG - Intronic
1045480491 8:102587727-102587749 TTCATTGAATGAATGGAGCTGGG + Intergenic
1045727465 8:105191385-105191407 TCTCTTCAATAAATGGTGCTGGG - Intronic
1045735178 8:105287694-105287716 TTTTTTAAACAAATGGTGCTAGG - Intronic
1045777056 8:105817041-105817063 TCTCTTCAATAAATGGTGCTTGG - Intergenic
1045856943 8:106775396-106775418 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1045991278 8:108311362-108311384 TCTCTTCAATAAATGGTGCTGGG + Intronic
1046215177 8:111136168-111136190 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1046346211 8:112931354-112931376 TCTCTTCAATAAATGGTGCTGGG + Intronic
1046371538 8:113315426-113315448 TACGTTAAATAAATGGATCTTGG + Intronic
1046480956 8:114818031-114818053 TAACAAAAATAAATGGAGCATGG + Intergenic
1046684717 8:117212216-117212238 TTAATTCAATAAATGGTGCTGGG + Intergenic
1047001141 8:120573762-120573784 TCTCTTCAATAAATGGTGCTGGG - Intronic
1047123280 8:121930668-121930690 TTATTTAAAGAATTGCAGCTGGG + Intergenic
1047172950 8:122511963-122511985 GGACTTAAATAAATGGGACTGGG - Intergenic
1047182005 8:122597506-122597528 TTATTTAAAAATATGGGGCTGGG + Intergenic
1047217675 8:122890190-122890212 TCTCTTCAATAAATGGCGCTGGG - Intronic
1047341753 8:123987754-123987776 TCTCTTCAATAAATGGTGCTGGG - Intronic
1047352004 8:124083457-124083479 TCTCTTCAATAAATGGTGCTGGG - Intronic
1047525462 8:125629997-125630019 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1047934066 8:129759120-129759142 TCTCTTCAATAAATGGTGCTGGG + Intronic
1047935954 8:129778366-129778388 TTCATTCAATAAATGGTGCTGGG + Intronic
1047936342 8:129784000-129784022 TCTCTTCAATAAATGGTGCTGGG + Intronic
1048109237 8:131449212-131449234 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1048235048 8:132681765-132681787 TTTCTTAAACTAATGGAGATGGG - Intergenic
1048262889 8:132960720-132960742 TCACTTAAAGAACTGGAGATTGG - Intronic
1048515545 8:135106379-135106401 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1048752059 8:137689446-137689468 TTTCTTCAATAAATGGTGCCAGG - Intergenic
1048796821 8:138158208-138158230 CTTTTTAAATAAATGGTGCTGGG + Intronic
1048916022 8:139183361-139183383 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1049067724 8:140331229-140331251 TCTCTTCAATAAATGGTGCTGGG + Intronic
1050018119 9:1257009-1257031 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1050134806 9:2450967-2450989 TTTCTTCAATAAATGGTGTTGGG - Intergenic
1050202260 9:3157698-3157720 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1050248591 9:3718921-3718943 TATCTTCAATAAATGGAGCTAGG + Intergenic
1050278962 9:4030657-4030679 TCTCTTCAATAAATGGTGCTTGG - Intronic
1050356638 9:4790015-4790037 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1050409339 9:5346580-5346602 TTCCTTCAATAAATGGTGCTGGG + Intergenic
1050510711 9:6392147-6392169 TCTCTTTAATAAATGGTGCTAGG + Intergenic
1050516551 9:6450307-6450329 TTATTTAAATAAATGGGGGGGGG - Intronic
1050618094 9:7423981-7424003 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1050759333 9:9047656-9047678 TCTCTTCAATAAATGGTGCTGGG + Intronic
1050806916 9:9692359-9692381 TCTCTTCAATAAATGGTGCTGGG - Intronic
1050823861 9:9918810-9918832 TATCTTTAATAAATGGTGCTAGG + Intronic
1050878323 9:10669204-10669226 TCTATTAAATAAATGGTGCTTGG - Intergenic
1050922192 9:11217690-11217712 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1050937910 9:11422334-11422356 TAACTTAAATTAAGGCAGCTAGG + Intergenic
1050948277 9:11553479-11553501 TTTCTTCAACAAATGGTGCTGGG - Intergenic
1050974760 9:11923977-11923999 TCAGTTCAATAAATGGTGCTGGG - Intergenic
1050989444 9:12130347-12130369 TTTATTCAATAAATGGTGCTAGG - Intergenic
1051047672 9:12894460-12894482 TAACTTCAATAAATGGTGCTGGG + Intergenic
1051131712 9:13869179-13869201 CTTCTTCAATAAATGGTGCTAGG - Intergenic
1051227204 9:14912242-14912264 TTAATTATATACATGAAGCTTGG + Intergenic
1051589631 9:18763717-18763739 TTTCTTCAATGAATGGTGCTTGG - Intronic
1051651857 9:19334426-19334448 TTACTCAAACAAATGGAACATGG + Intronic
1051704750 9:19865608-19865630 TCTCTTGAATAAATGGTGCTGGG + Intergenic
1051729791 9:20128718-20128740 TCTCTTCAATAAATGGTGCTTGG + Intergenic
1051833979 9:21313711-21313733 TATCTTCAATAAATGGTGCTGGG + Intergenic
1051862432 9:21641597-21641619 TTTCTTCAACAAATGGTGCTGGG + Intergenic
1051897890 9:22007375-22007397 ATAAATAAATAAATAGAGCTTGG + Intronic
1051943209 9:22534004-22534026 TTTATTTAATAAATGGTGCTGGG + Intergenic
1051984690 9:23069685-23069707 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1052219227 9:25999089-25999111 TTACTTAAATCAATCAAGCCTGG + Intergenic
1052302322 9:26966898-26966920 TTTCTTCAATAAATGGTACTGGG - Intronic
1052379428 9:27754106-27754128 TTTATTTAATAAATGGTGCTGGG + Intergenic
1052420720 9:28240551-28240573 TCTCTTCAATAAATGGTGCTGGG + Intronic
1052525054 9:29606702-29606724 TTTCTTTAATAAATGGTGCTGGG + Intergenic
1052578897 9:30328478-30328500 TCTCTTCAATAAGTGGAGCTGGG - Intergenic
1052733231 9:32313919-32313941 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1052771228 9:32692440-32692462 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1053087503 9:35238856-35238878 TTACTTAAATAAATTATGGTAGG - Intronic
1053336250 9:37274883-37274905 TTTATTCAATAAATGGTGCTGGG - Intronic
1053520528 9:38773394-38773416 TTTCTTTAATACATGGTGCTTGG - Intergenic
1053617666 9:39785073-39785095 TATCTTTAATAAATGGTGCTGGG - Intergenic
1053875848 9:42544440-42544462 TATCTTTAATAAATGGTGCTGGG - Intergenic
1053896805 9:42750197-42750219 TATCTTTAATAAATGGTGCTGGG + Intergenic
1054235851 9:62557282-62557304 TATCTTTAATAAATGGTGCTGGG + Intergenic
1054266495 9:62922359-62922381 TATCTTTAATAAATGGTGCTGGG + Intergenic
1054549991 9:66591809-66591831 TATCTTTAATAAATGGTGCTGGG + Intergenic
1054733347 9:68724103-68724125 TTTCTTTAATAAATAGTGCTGGG - Intronic
1054798500 9:69324937-69324959 TTACTTAAATATTTGGGGCAGGG + Intronic
1055070530 9:72161352-72161374 TTTCTTCAATAACTGGTGCTTGG + Intronic
1055227736 9:74020517-74020539 TGTCTTCAATAAATGGTGCTGGG + Intergenic
1055243374 9:74211867-74211889 TTTCTTCAATGAATGGAGCTGGG - Intergenic
1055304627 9:74916686-74916708 TTTCTTCAATAAATGGTGCCAGG + Intergenic
1055579622 9:77693989-77694011 TTTCTTCAACAAATGGTGCTGGG - Intergenic
1055653062 9:78425965-78425987 CTTCTTCAATAAATGGTGCTGGG - Intergenic
1055821740 9:80273315-80273337 TCTCTTAAATAAGTGGTGCTGGG + Intergenic
1055885782 9:81062045-81062067 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1055908763 9:81323504-81323526 TTTGTTCAATAAATGGTGCTGGG - Intergenic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1056174183 9:84018001-84018023 GTTCTTCAATAAATGGTGCTGGG - Intergenic
1056201329 9:84279748-84279770 TTAATAAAATAAATGGGGCCGGG - Intronic
1056224248 9:84479996-84480018 TTAGTTAAGTGAAAGGAGCTGGG + Intergenic
1057241164 9:93410832-93410854 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1057288654 9:93783685-93783707 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1057689385 9:97269861-97269883 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1058102639 9:100934330-100934352 CCTCTTAAATAAATGGTGCTGGG - Intergenic
1058116976 9:101095430-101095452 TTGCCTGTATAAATGGAGCTTGG + Intronic
1058232882 9:102452064-102452086 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1058252816 9:102722794-102722816 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1058267044 9:102914159-102914181 TCTCTTCAATAAATGGAGCTAGG + Intergenic
1058363525 9:104179197-104179219 TTTCTTCAATAAATGGTGCTGGG + Intergenic
1058395374 9:104547088-104547110 TCTCTTAAATGAATGGTGCTGGG + Intergenic
1058406392 9:104680134-104680156 TCTCTTCAATAAATGGTGCTAGG + Intergenic
1058488650 9:105469992-105470014 TCTCTTCAATAAATGGTGCTAGG - Intronic
1058522375 9:105823533-105823555 TGTCTTCAATAAATGGTGCTGGG - Intergenic
1058652196 9:107186732-107186754 CTTCTTTAATAAATGGTGCTAGG + Intergenic
1058712696 9:107694660-107694682 ATACTTAAACCAATGGAGCATGG + Intergenic
1058821644 9:108736808-108736830 TCACCTCAATAAATGGTGCTGGG + Intergenic
1059086801 9:111311946-111311968 TCTCTTCAATAAATGGGGCTGGG - Intergenic
1059297757 9:113287242-113287264 TTTCTGGAATAAATGGAGCTAGG - Intronic
1059611819 9:115906155-115906177 GTATTTAAATAAATGGTGTTGGG - Intergenic
1059924270 9:119192010-119192032 TCTCTTCAATAAATGGTGCTAGG + Intronic
1059975689 9:119714431-119714453 TCTCTTCAATAAATGGCGCTGGG + Intergenic
1060324487 9:122599784-122599806 TTTATTCAATAAATGGTGCTGGG - Intergenic
1061638712 9:131934034-131934056 TCCCTTCAATAAATGGTGCTGGG + Intronic
1061749447 9:132766887-132766909 TCTCTTCAATAAATGGAGCTGGG + Intronic
1062739501 9:138160713-138160735 TTACTTAAAAAAATTGATCAAGG + Intergenic
1185847362 X:3450536-3450558 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1186404019 X:9285812-9285834 ATACTTAACAAAATGGTGCTGGG - Intergenic
1186462112 X:9756169-9756191 TTTATTCAATAAATGGTGCTGGG + Intronic
1186735521 X:12459204-12459226 TTACTTAAAAAAAAGGATCCTGG - Intronic
1186807937 X:13158852-13158874 TTAGTACAAAAAATGGAGCTGGG - Intergenic
1186915829 X:14219343-14219365 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1186924450 X:14317282-14317304 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1186927363 X:14349801-14349823 TATCTTCAATAAATGGTGCTGGG + Intergenic
1186937313 X:14464413-14464435 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1187116585 X:16358532-16358554 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1187178709 X:16921650-16921672 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1187844027 X:23517728-23517750 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1187845317 X:23530315-23530337 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1187856456 X:23641028-23641050 TCACTTCAATAAATGGTGTTGGG + Intergenic
1188014093 X:25088794-25088816 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1188027668 X:25227430-25227452 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1188076188 X:25777945-25777967 TCTCTTCAATAAATGGTGCTTGG - Intergenic
1188218691 X:27513003-27513025 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1188222016 X:27552528-27552550 TTTCTTCAATAAATGTTGCTTGG - Intergenic
1188265967 X:28074830-28074852 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1188633484 X:32398996-32399018 GTCCTTCAATAAATGGTGCTGGG + Intronic
1188745288 X:33833826-33833848 TCTCTTCAATAAATGGTGCTAGG - Intergenic
1188814920 X:34701057-34701079 TCTGTTCAATAAATGGAGCTGGG + Intergenic
1188832024 X:34910280-34910302 TGTCTTCAATAAATGGTGCTAGG - Intergenic
1188915595 X:35905811-35905833 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1188957572 X:36451621-36451643 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1189013013 X:37065626-37065648 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1189147968 X:38674470-38674492 TTACCTGAATAACTGGAGCCTGG - Intronic
1189405138 X:40715321-40715343 TTTCTTTAATAAATGGTGATGGG + Intronic
1189421178 X:40859472-40859494 TGTCTTCAATAAATGGTGCTGGG - Intergenic
1189441630 X:41041379-41041401 TCCCTTTAATAAATGGTGCTGGG + Intergenic
1189453726 X:41164163-41164185 TTATTAAAATAAATGGGGCCAGG - Intronic
1189657489 X:43261012-43261034 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1189889727 X:45588012-45588034 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1190277620 X:48909305-48909327 TATCTTGAATAAATGTAGCTGGG - Intronic
1190364820 X:49682102-49682124 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1190587116 X:51956857-51956879 TTTCTTCAATAAATGGTGCTGGG - Intergenic
1190842229 X:54155938-54155960 TTTTTTAAATAAATAGAGATGGG + Intronic
1190893373 X:54591233-54591255 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1190973249 X:55373403-55373425 TCTCTTAAATAAATGGTGCTGGG - Intergenic
1191051022 X:56192720-56192742 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1191057087 X:56253442-56253464 TCTCTTCAATAAATGGTGCTGGG - Intronic
1191201594 X:57788558-57788580 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1191650753 X:63535298-63535320 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1191919122 X:66235429-66235451 CTAATTGAATAAATGGTGCTAGG - Intronic
1191922222 X:66269315-66269337 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1191926983 X:66323637-66323659 TCTGTTCAATAAATGGAGCTGGG + Intergenic
1191932482 X:66389414-66389436 TTCCCTATATAAATGGTGCTGGG - Intergenic
1191957474 X:66660743-66660765 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1191961191 X:66703956-66703978 TTTCTTCAATATATGGTGCTGGG + Intergenic
1192029799 X:67497362-67497384 TTTCTTCAATAAATGGTCCTGGG + Intergenic
1192074137 X:67973651-67973673 TCTCTTCAATAAATGGTGCTAGG + Intergenic
1192135591 X:68596376-68596398 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1192137893 X:68621438-68621460 TCCCTTCAATAAATGGTGCTGGG - Intergenic
1192153898 X:68728745-68728767 TTTCTTCAATAAATGCTGCTGGG + Intergenic
1192375007 X:70550150-70550172 TCTCTTCAATAAATGGTGCTGGG + Intronic
1192395328 X:70775098-70775120 TCTCTTCAATAAATGGTGCTAGG + Intronic
1192475913 X:71442894-71442916 CTAATTTAATAAATGGTGCTGGG - Intronic
1192506274 X:71685533-71685555 TTTCTTAAAGAAATGGTGCTAGG + Intergenic
1192520423 X:71796015-71796037 TTTCTTAAAGAAATGGTGCTAGG - Intergenic
1192524347 X:71828601-71828623 TTTCTTAAAGAAATGGTGCTAGG + Intergenic
1192549676 X:72043987-72044009 ATACAGAAATAAATGAAGCTTGG + Intergenic
1192635868 X:72816733-72816755 TCTCTTCAATAAATGGTGCTGGG - Intronic
1192645846 X:72904070-72904092 TCTCTTCAATAAATGGTGCTGGG + Intronic
1192671360 X:73145527-73145549 TCATTTCAATAAATGGTGCTGGG - Intergenic
1192710131 X:73573176-73573198 TCTATTCAATAAATGGAGCTGGG - Intronic
1192770619 X:74185784-74185806 TTACTCAAGTAAATGGATGTAGG - Intergenic
1192935705 X:75856873-75856895 TTACTTAAATCAATGTGGCCTGG - Intergenic
1192990181 X:76444055-76444077 TATCTTCAATAAATGGTGCTAGG - Intergenic
1193031417 X:76902580-76902602 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1193153227 X:78146431-78146453 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1193175747 X:78390047-78390069 TTTCTTCAATAAATGGTGCTGGG + Intergenic
1193243654 X:79203347-79203369 TGTCTTCAATAAATGGTGCTGGG + Intergenic
1193279973 X:79636021-79636043 TTGCTTCCATAAATGGTGCTAGG - Intergenic
1193335759 X:80286830-80286852 TTTCTTCAATAAATGGTGCTGGG + Intergenic
1193375065 X:80750000-80750022 TTTCTTCAATAAGTGGTGCTGGG + Intronic
1193377784 X:80782265-80782287 TCTCTTCAATAAATGGTGCTAGG + Intronic
1193390190 X:80917212-80917234 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1193403120 X:81069415-81069437 TCTATTTAATAAATGGAGCTGGG + Intergenic
1193421532 X:81289184-81289206 TCACTTCAATAGATGGTGCTGGG + Intronic
1193489888 X:82135657-82135679 TGTCTTCAATAAATGGTGCTGGG + Intergenic
1193528685 X:82626383-82626405 TTTCTTCAATTAATGGTGCTGGG + Intergenic
1193529288 X:82636481-82636503 TTTCTTCAATAATTGGTGCTGGG - Intergenic
1193594376 X:83428242-83428264 TTCCTTCAATAAATGGTGCTGGG + Intergenic
1193664924 X:84304370-84304392 TTTCTTCAATAAATGATGCTGGG + Intergenic
1193670663 X:84381610-84381632 TTTCTTCAATAAATGGTGCTGGG + Intronic
1193671498 X:84392148-84392170 TCTCTTTAATAAATGGTGCTTGG - Intronic
1193683247 X:84547626-84547648 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1193692632 X:84666217-84666239 TTTCTTCAGTAAATGGTGCTGGG - Intergenic
1193742716 X:85237473-85237495 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1193767342 X:85546051-85546073 TCAATTCAATAAATGGTGCTGGG - Intergenic
1193778439 X:85672961-85672983 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1193832273 X:86304130-86304152 CTGCTTCAATAAATGGTGCTAGG + Intronic
1193842472 X:86423916-86423938 TTTCTTCAATAAATAGTGCTAGG - Intronic
1193887497 X:87000913-87000935 TCACTTAAATAAATGGTGCTGGG + Intergenic
1193934826 X:87605000-87605022 TTTCTTCAATAAATGGTGTTGGG - Intronic
1194042508 X:88959861-88959883 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1194109983 X:89821856-89821878 CTTATTAAATAAATGGAGCAGGG - Intergenic
1194111544 X:89840121-89840143 TCCATTAAATAAATGGTGCTGGG + Intergenic
1194263592 X:91729035-91729057 TTTATTTAATAAATGGTGCTGGG - Intergenic
1194285230 X:92002133-92002155 TTTCTTCAATAAATGGTGCTGGG - Intronic
1194300907 X:92184740-92184762 TGTCTTCAATAAATGGTGCTGGG + Intronic
1194306235 X:92253174-92253196 TCTCTTCAATAAATGGTGCTGGG - Intronic
1194336756 X:92657508-92657530 TTACCTAAATAAATAGCGTTTGG + Intergenic
1194371886 X:93083743-93083765 TTACTGAAAGAATTGGGGCTTGG - Intergenic
1194389457 X:93298702-93298724 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1194396386 X:93392450-93392472 TTTATTTAATAAATGGTGCTGGG + Intergenic
1194418354 X:93640797-93640819 TCTCTTAAATAAATGATGCTGGG + Intergenic
1194537454 X:95122476-95122498 TCTCTTTAATAAATGGTGCTGGG + Intergenic
1194546756 X:95245054-95245076 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1194559808 X:95406071-95406093 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1194606087 X:95980242-95980264 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1194837871 X:98703588-98703610 CTCCTTCAATAAATGGTGCTGGG - Intergenic
1194848581 X:98843079-98843101 TGTCTTCAATAAATGGTGCTGGG - Intergenic
1194891922 X:99389732-99389754 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1194921607 X:99773213-99773235 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1195074923 X:101317597-101317619 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1195133176 X:101875081-101875103 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1195312743 X:103648844-103648866 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1195528766 X:105926725-105926747 TGTCTTCAATAAATGGTGCTGGG - Intronic
1195539898 X:106051499-106051521 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1195562878 X:106304598-106304620 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1195662575 X:107394754-107394776 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1195772987 X:108372207-108372229 TTACTGAGATTAAGGGAGCTAGG - Intronic
1195804924 X:108753677-108753699 TATCTTTAATAAATGGAGCTGGG - Intergenic
1195807248 X:108788380-108788402 TCCCCTAAATAAATGGTGCTGGG - Intergenic
1195814001 X:108865728-108865750 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1195848774 X:109259173-109259195 TGTCTTAAATAAATGGTGTTAGG - Intergenic
1195976100 X:110528752-110528774 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1196008453 X:110860480-110860502 TCTCTTTAATAAATGGTGCTAGG + Intergenic
1196157244 X:112444174-112444196 TCTCTTAAATAAATGGTGCTGGG - Intergenic
1196248899 X:113434684-113434706 TCTCTTCAATAAATGGTGCTTGG + Intergenic
1196361617 X:114867738-114867760 TTTCTTCAATAACTGGTGCTGGG - Intronic
1196395062 X:115251389-115251411 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1196485335 X:116200191-116200213 TCTCTTCAATAAATGGTGCTAGG - Intergenic
1196517904 X:116634789-116634811 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1196547730 X:116983338-116983360 TTTCTTCAATAAATAGTGCTGGG + Intergenic
1196552836 X:117050293-117050315 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1196598867 X:117577913-117577935 TCTCTTCAATAAATGGTGCTTGG - Intergenic
1196620595 X:117819226-117819248 TCTCTTCAATAAATGGCGCTGGG + Intergenic
1196883096 X:120217712-120217734 TTTCTTCAATAAATGATGCTGGG + Intergenic
1196961887 X:121012644-121012666 TCCCTTCAATAAATGGTGCTGGG - Intergenic
1196967234 X:121069970-121069992 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1196985781 X:121268891-121268913 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1196993780 X:121358302-121358324 TCTCTTCAATAAATGGTGCTAGG - Intergenic
1197011880 X:121573926-121573948 TCTCTTCAATAAATGGGGCTGGG + Intergenic
1197028173 X:121781136-121781158 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1197079080 X:122390145-122390167 TCACTTCAATAAATGGTGTTGGG - Intergenic
1197094793 X:122580899-122580921 TTTATTCAATAAATGGTGCTGGG + Intergenic
1197113289 X:122801253-122801275 TCCCTTCAATAAATGGTGCTGGG + Intergenic
1197139756 X:123104388-123104410 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1197269041 X:124405995-124406017 TATATTAAATAAATGGAGCCTGG - Intronic
1197411162 X:126118296-126118318 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1197435187 X:126419315-126419337 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1197440406 X:126481571-126481593 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1197468841 X:126841339-126841361 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1197548267 X:127855077-127855099 CTTATTAAATAAATGGTGCTGGG - Intergenic
1197561063 X:128023024-128023046 TTTCCTCAATAAATGGTGCTGGG + Intergenic
1197587120 X:128362475-128362497 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1197623133 X:128773768-128773790 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1197670151 X:129267904-129267926 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1197670814 X:129274923-129274945 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1197810610 X:130439076-130439098 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1197846930 X:130813291-130813313 TCTCTTCAATAAATGGTGCTGGG + Intronic
1197986850 X:132275444-132275466 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1198430372 X:136560005-136560027 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1198695281 X:139330331-139330353 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1198702169 X:139408761-139408783 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1198785062 X:140278178-140278200 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1199040278 X:143106861-143106883 TCACTTCAATAAATGATGCTAGG + Intergenic
1199050943 X:143236269-143236291 TTTCTTCAATAATTGGTGCTAGG - Intergenic
1199075840 X:143524632-143524654 TGTCTTCAATAAATGGTGCTGGG - Intergenic
1199111186 X:143936875-143936897 TTTCTTCAATAAATGGTGCTAGG + Intergenic
1199146721 X:144377680-144377702 TCTATTAAATAAATGGTGCTAGG - Intergenic
1199189897 X:144958687-144958709 TCACTTCAATAAATGGTGATAGG + Intergenic
1199210940 X:145209617-145209639 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1199227068 X:145389442-145389464 TCTCTTTAATAAATGGTGCTGGG - Intergenic
1199259668 X:145757154-145757176 TCATTTCAATAAATGGTGCTAGG + Intergenic
1199404937 X:147445661-147445683 TTTCTTCAATAAATGGTGCTGGG - Intergenic
1199434711 X:147800605-147800627 TCTCTTCAATAAATGGCGCTGGG + Intergenic
1199439558 X:147853455-147853477 TTTCTTCAATAAATGGTGCTGGG - Intergenic
1199441444 X:147872788-147872810 TTTCTTCAATAAATGGTGCTGGG + Intergenic
1199547715 X:149024525-149024547 TTTCTTCAAAAAATGGTGCTGGG - Intergenic
1199581012 X:149359914-149359936 TCTCTTCAATAAATGGTGCTGGG - Intergenic
1199748009 X:150787457-150787479 TTTATTCAATAAATGGTGCTGGG - Intronic
1199755535 X:150861519-150861541 TCTCTTTAATAAATGGTGCTGGG + Intronic
1199926150 X:152466429-152466451 TCTCTTCAATAAATGGTGCTTGG + Intergenic
1200280363 X:154772319-154772341 TCTCTTCAATAAATGGTGCTGGG - Intronic
1200353552 X:155524931-155524953 TTTTTTAAATAAATGGTGTTGGG + Intronic
1200464209 Y:3494927-3494949 TCCATTAAATAAATGGTGCTGGG + Intergenic
1200602798 Y:5226675-5226697 TTTCTTCAATAAATGGTGCTGGG - Intronic
1200679928 Y:6197776-6197798 TTACTGAAAGAATTGGGGCTTGG - Intergenic
1201060494 Y:10039841-10039863 ATACATAAACAAATGAAGCTGGG - Intergenic
1201192895 Y:11463296-11463318 TCTCTTCAATAAATGGTGCTGGG + Intergenic
1201396088 Y:13550655-13550677 TTTCTTCAATAAATGGTGCTGGG - Intergenic
1201728800 Y:17184276-17184298 TTACTGAAATATAAGGAGTTCGG - Intergenic
1201978140 Y:19875162-19875184 TCTCTTAAACAAATGGTGCTGGG + Intergenic
1202297342 Y:23373891-23373913 TTTCTTCAATAAATGCTGCTGGG - Intergenic
1202573465 Y:26296706-26296728 TTTCTTCAATAAATGCTGCTGGG + Intergenic