ID: 1091023917

View in Genome Browser
Species Human (GRCh38)
Location 11:132125130-132125152
Sequence CAAACGGATGGGCTCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091023906_1091023917 30 Left 1091023906 11:132125077-132125099 CCTGCCTTCCTCACACTGCCCGC 0: 1
1: 0
2: 0
3: 27
4: 446
Right 1091023917 11:132125130-132125152 CAAACGGATGGGCTCACAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1091023908_1091023917 22 Left 1091023908 11:132125085-132125107 CCTCACACTGCCCGCATATCTGT 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1091023917 11:132125130-132125152 CAAACGGATGGGCTCACAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1091023907_1091023917 26 Left 1091023907 11:132125081-132125103 CCTTCCTCACACTGCCCGCATAT 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1091023917 11:132125130-132125152 CAAACGGATGGGCTCACAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1091023910_1091023917 11 Left 1091023910 11:132125096-132125118 CCGCATATCTGTCTACACTCAGT 0: 1
1: 0
2: 0
3: 10
4: 171
Right 1091023917 11:132125130-132125152 CAAACGGATGGGCTCACAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1091023909_1091023917 12 Left 1091023909 11:132125095-132125117 CCCGCATATCTGTCTACACTCAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1091023917 11:132125130-132125152 CAAACGGATGGGCTCACAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091023917 Original CRISPR CAAACGGATGGGCTCACAGT GGG Intronic
902179470 1:14677081-14677103 CATACTGCTGGGCACACAGTTGG - Intronic
904081158 1:27873262-27873284 CACAGGGATGGGCACACAGCAGG + Intronic
904418035 1:30374711-30374733 CAAGGAGATGGGCTCAGAGTAGG - Intergenic
909020678 1:70427549-70427571 TAAAGGGATGGGGTCAAAGTAGG - Intronic
915946595 1:160156849-160156871 CAAACGGTTGGGATTACAGGTGG - Intronic
919054712 1:192555166-192555188 TAAACGGATTGGCTCATAGCTGG - Intergenic
921850310 1:219927379-219927401 CAAACGGATGGGCAAAGAGGGGG + Intronic
1067341090 10:45404442-45404464 CAGACAGATGTGGTCACAGTGGG - Intronic
1069917550 10:71796802-71796824 GAAAAGGATGGGTTGACAGTCGG + Intronic
1077716595 11:4587432-4587454 CAAAGCTATGTGCTCACAGTAGG - Exonic
1079920011 11:26421466-26421488 AAAACTGATGGGCTTAGAGTGGG - Intronic
1083578712 11:63811547-63811569 CAAACTGCTGGGATTACAGTTGG + Intergenic
1083764766 11:64836479-64836501 CAGACGGATGGGCCCCCAGCTGG - Exonic
1083900259 11:65640190-65640212 CAGAGGGCTGGGCCCACAGTTGG + Exonic
1085437101 11:76516165-76516187 CCAATGGATGGGCTCACTGTTGG - Exonic
1089698497 11:120230054-120230076 CAAATGGCTGAGCACACAGTAGG - Exonic
1091023917 11:132125130-132125152 CAAACGGATGGGCTCACAGTGGG + Intronic
1094151754 12:27292614-27292636 CAAAGTGATGAGCACACAGTAGG - Intronic
1100237470 12:92675004-92675026 CAAGCGGAGGGGATCACAGAGGG - Intergenic
1101306285 12:103530834-103530856 CAAAATGATGGGCTCACAATAGG - Intergenic
1106010688 13:25818781-25818803 CACACAGGTGGGCACACAGTAGG - Intronic
1107974478 13:45676032-45676054 CAAAGGGAAGGGTTCACAGGAGG + Intergenic
1110433274 13:75450862-75450884 CTAACGAGGGGGCTCACAGTGGG - Intronic
1115312027 14:31988360-31988382 CAAACGGATGAGGTCCCAGATGG + Intergenic
1125828146 15:42693069-42693091 GAAACTGAGGGGCTCACAGAAGG - Exonic
1128234426 15:66058138-66058160 CAATGAGATGGGCTCACAGATGG + Intronic
1132798243 16:1736766-1736788 CACACGGATGGTCACACAGACGG - Intronic
1139296038 16:65901748-65901770 CAAAAGGATGGACACACAGTAGG + Intergenic
1144284570 17:13761130-13761152 CAATCTGATTGGCTCACAGCTGG - Intergenic
1151989578 17:77565620-77565642 CACACGGTAGGGATCACAGTTGG + Intergenic
1153622416 18:6991173-6991195 CAAAAGGAGGTGCTTACAGTTGG - Intronic
1158009930 18:52716912-52716934 GAAGAGGATGGGCTCACAGATGG + Intronic
1158441926 18:57483176-57483198 CAAACTGATGGGGAGACAGTGGG + Exonic
1162657935 19:12145939-12145961 CACATGAATGGGCTCACACTGGG - Exonic
1166076927 19:40419124-40419146 CATAGGGATAGGCACACAGTAGG + Intergenic
1167353733 19:48991480-48991502 CACACGCTTGGGCCCACAGTGGG - Exonic
929592161 2:43154406-43154428 CAAATGGATAGACTCACAGATGG + Intergenic
930336042 2:50047071-50047093 CAAAAGGATAGTCTGACAGTTGG + Intronic
932608989 2:73184622-73184644 CAAGAGAATGGGATCACAGTGGG + Intergenic
932849293 2:75168641-75168663 CAAACGTATTGTCTTACAGTTGG - Intronic
935085049 2:99836979-99837001 GAAAAGGACGGGCTCACAGAGGG + Intronic
939635245 2:144574506-144574528 CAAACTGCTGGGATTACAGTAGG - Intergenic
939977965 2:148741833-148741855 CAAAAGGAGGGGTTCACAGATGG - Intronic
941251796 2:163174292-163174314 GAAAAAGCTGGGCTCACAGTTGG - Intergenic
941325868 2:164113116-164113138 CATAGTGCTGGGCTCACAGTAGG + Intergenic
942112204 2:172693609-172693631 AAAACGGATGGGGTCAGAGTTGG + Intergenic
942300671 2:174558553-174558575 CAAACGTCTGGGCTTACAGATGG - Intergenic
942459447 2:176159315-176159337 CAAAAGGATGGGCTCGTAGACGG + Intronic
1169196832 20:3687736-3687758 CTCAGGGATGAGCTCACAGTTGG + Exonic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1171306827 20:24113870-24113892 TAAACACATGGGCTCACAGATGG + Intergenic
1175811134 20:61857840-61857862 CAAACGGGTGGGATCCTAGTAGG - Intronic
1178580577 21:33834777-33834799 TAAACGGCTGGGGTCTCAGTAGG + Intronic
1180158014 21:45987379-45987401 CACACGGATGGACGCACAGGCGG - Intronic
1184531074 22:45056160-45056182 CAAACGGGTGGGCTCAGCCTGGG - Intergenic
953584109 3:44184524-44184546 CAAACGGTGGGGCTGCCAGTTGG - Intergenic
957153941 3:76522359-76522381 CAGACACATGGGCACACAGTTGG - Intronic
957244690 3:77702291-77702313 CAGAGGGATGGCCTGACAGTGGG + Intergenic
962413563 3:135162304-135162326 CAAACGGTTTGCCTCCCAGTAGG + Intronic
963586650 3:147199640-147199662 CCAAGTGATGGGCTCACAGCAGG - Intergenic
969894555 4:10291195-10291217 CAGACGGATGGGCTCAGTGCTGG + Intergenic
975935766 4:79578098-79578120 AAAAGGGATTGGCACACAGTAGG - Intergenic
976215431 4:82711277-82711299 CAAATGTAGGGGGTCACAGTGGG - Intronic
980692363 4:136311687-136311709 TAAACGAATTGGCTCACAGTGGG - Intergenic
985144274 4:186878523-186878545 CAAACGGATGGCATGACAGTTGG + Intergenic
990126846 5:52529411-52529433 CCAAGGGCTGGGCTGACAGTGGG - Intergenic
994509411 5:100684723-100684745 CTACTGGATGGGCTCAAAGTTGG - Intergenic
996649195 5:125852924-125852946 CAGTCGAATGGGCTCACAGTAGG + Intergenic
1006715636 6:36118184-36118206 CAGATGGATGGGGACACAGTAGG - Intergenic
1006745039 6:36335723-36335745 GAATCAGATGGGCTAACAGTGGG + Intronic
1007462959 6:42031224-42031246 CCTACGGATGGGCACAGAGTGGG - Intronic
1009789544 6:68384646-68384668 CAAAAAGATGGGCATACAGTGGG - Intergenic
1010103257 6:72135858-72135880 TAAACAGATGGGGTCACCGTGGG - Intronic
1017816515 6:158020142-158020164 CATACAGATGGAGTCACAGTTGG - Intronic
1017816556 6:158020458-158020480 CATACAGATGGAGTCACAGTTGG - Intronic
1022798615 7:33753453-33753475 CAAACGGATTGGAACCCAGTGGG - Intergenic
1037930513 8:22877572-22877594 CACACGGGCGGGCTCACTGTTGG + Intronic
1048150543 8:131889345-131889367 CATACTGATGGGCTCACACATGG - Intergenic
1053186904 9:36023904-36023926 CCAAGGGCTTGGCTCACAGTAGG - Intergenic
1055683682 9:78745429-78745451 CAAAAGGATGTGCTCACTTTGGG + Intergenic
1058853155 9:109032923-109032945 CAAACAGCTGGGTTCACAGGCGG + Intronic
1059734918 9:117091306-117091328 CAGGGGGATGGGCTCATAGTAGG - Intronic
1190824232 X:54002189-54002211 CCAACAGATGGTCTCAAAGTTGG + Exonic