ID: 1091024510

View in Genome Browser
Species Human (GRCh38)
Location 11:132130113-132130135
Sequence AAATATTCTCAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 1, 2: 3, 3: 60, 4: 554}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091024505_1091024510 23 Left 1091024505 11:132130067-132130089 CCAGAGTCTGTTAGGACTTTGGG 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1091024510 11:132130113-132130135 AAATATTCTCAGAAGGAGAAGGG 0: 1
1: 1
2: 3
3: 60
4: 554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091024510 Original CRISPR AAATATTCTCAGAAGGAGAA GGG Intronic
902417832 1:16252031-16252053 AATTTTTGTTAGAAGGAGAAGGG + Intronic
903082002 1:20818006-20818028 AAAAATATTCAGAAGGATAATGG - Intronic
904397649 1:30233106-30233128 AAATATTCTCAAATACAGAAAGG - Intergenic
905756693 1:40516181-40516203 AAATATTCTCAAAGAGACAAGGG + Intronic
907061240 1:51428175-51428197 AAATATTCTCAGACAAACAAAGG + Intronic
908216864 1:61962927-61962949 AAATATCCTTAAAAGGAGGAAGG - Intronic
909027522 1:70500419-70500441 AAACATTCTCAAAATGACAATGG - Intergenic
909095946 1:71289645-71289667 AAATATTCTCAAATGAAGATTGG + Intergenic
909146738 1:71943843-71943865 AAACATTCTGAGAAGTAGATAGG + Intronic
909264086 1:73534377-73534399 GAATAGTCTCAGTAGGAAAATGG + Intergenic
909324550 1:74333661-74333683 AAATATGCTGACAAGGAGAATGG + Intronic
909796954 1:79752151-79752173 AAATATTATCATAATGAGATAGG - Intergenic
910026258 1:82658191-82658213 AAATATTCTAAATAGAAGAAAGG + Intergenic
912045742 1:105453196-105453218 AAATATTCTCTAAGGAAGAATGG + Intergenic
912114660 1:106390498-106390520 ATATATCCTCAGAAGGACATAGG - Intergenic
913064391 1:115237075-115237097 AAATAGTCTTAGAAGTAGCAAGG + Intergenic
913448285 1:118973025-118973047 GAATATTCTAAGATGGAAAAGGG + Intronic
913540595 1:119816618-119816640 AAATCCTATCAGCAGGAGAAAGG + Intergenic
914351983 1:146848005-146848027 AATAATTTTCAAAAGGAGAAGGG - Intergenic
914922074 1:151853910-151853932 GAATATTTCCAGAAGGATAAGGG + Intergenic
915486134 1:156222041-156222063 AAACATTTTAAGCAGGAGAAGGG - Intronic
915649953 1:157302453-157302475 AAATATTCTCCGCAGCAGAAAGG - Intergenic
915655480 1:157356190-157356212 AAATATTGTGTGAAGGAAAATGG + Intergenic
916158530 1:161884069-161884091 AAATAATCCTAGGAGGAGAATGG - Intronic
916241838 1:162648111-162648133 AAATAAACTCAGAAAGGGAAAGG - Intronic
916994008 1:170276116-170276138 AAATATTCTCACATAGAAAAGGG - Intergenic
917020910 1:170585832-170585854 AAATGTTCTCAGGGGAAGAATGG + Intergenic
917771536 1:178285009-178285031 AAAAATGCTGAGAAAGAGAAGGG - Intronic
918140997 1:181719830-181719852 AAATATTCTTAGAAGCCGGAGGG - Exonic
919229785 1:194759450-194759472 AAAGATTCACAGAAAGATAAGGG + Intergenic
919240570 1:194910968-194910990 AAGTATTGACAGAAGGAGGAAGG - Intergenic
921218164 1:212954254-212954276 GAATTGTCTCAGAAGGAGGAGGG - Intronic
921636781 1:217504959-217504981 AAAAATGCTCTGAAAGAGAATGG + Intronic
923079945 1:230643607-230643629 AAATATTATCAAAAAGAGATAGG - Intronic
923458247 1:234185126-234185148 AAATACTTGCAGAAGGAGGAGGG + Intronic
923689619 1:236179467-236179489 AAACAATCTCAGAGGGACAATGG - Intronic
923749266 1:236732390-236732412 AAATATTCACAGAGGGGAAAAGG - Intronic
923794948 1:237144618-237144640 AAATATTCTAAGAAAAAGGATGG + Intronic
924729814 1:246700917-246700939 AAATATTCTCAAAATGAGTAAGG - Intergenic
1062851436 10:745796-745818 AGATAGTCTCAGCAGAAGAATGG + Intergenic
1064065430 10:12177192-12177214 AAATAAGCTGAGAAGGGGAAGGG + Intronic
1065100670 10:22328656-22328678 AAAGTTTCTCAGAAGTAAAATGG + Exonic
1065133615 10:22646584-22646606 AACTATTCTCAGCAGAAGTAAGG - Intronic
1065146197 10:22770862-22770884 AATTATTTTCAGAGGGAGAGAGG + Intergenic
1065279935 10:24125844-24125866 AAATATCTTCAAAAGGATAAAGG - Intronic
1065478233 10:26164375-26164397 AAATCTCCTCTGAAGGAGGAGGG + Intronic
1065608655 10:27447904-27447926 AAATATTTTCTGCATGAGAAGGG + Intergenic
1066667650 10:37801463-37801485 AAATATTCTCATAAAGCCAAAGG + Intronic
1068234571 10:54216490-54216512 AACTGTTCACAGAAAGAGAAAGG + Intronic
1069323116 10:67198535-67198557 AAGAATTCTGAGAAGGAAAATGG + Intronic
1069770685 10:70897496-70897518 ATATTTACTTAGAAGGAGAAAGG + Intergenic
1070226556 10:74514381-74514403 AAATATCTCCAGAAGGTGAAGGG - Intronic
1070548984 10:77475778-77475800 AAATAATCTCAGAACTGGAAGGG + Intronic
1071025267 10:81105502-81105524 AAATATTTTAAGCTGGAGAAGGG - Intergenic
1071176400 10:82931410-82931432 TTATATACTCAGAAGGTGAAAGG - Intronic
1073245228 10:102085738-102085760 CATTATCCTCAGAAGGAGGAGGG + Intergenic
1073787290 10:106903697-106903719 CAACATTCTCAGTAGGACAAAGG + Intronic
1075528274 10:123203952-123203974 AAATATTGACAGAATGAGTAAGG + Intergenic
1078750517 11:14157176-14157198 AAATCATCCCAGAAGGAAAATGG - Intronic
1078763401 11:14270668-14270690 AAGTATTCACAGAAGGGAAAAGG + Intergenic
1078911400 11:15736000-15736022 CAATATTCTCAGAATGGGAAGGG + Intergenic
1081041190 11:38216221-38216243 AAGTATTTTCAGAATGAAAATGG + Intergenic
1081338234 11:41894715-41894737 ATATATTCTCATAAAGAGTATGG - Intergenic
1081343243 11:41952970-41952992 CAATTTTCTCAGAGGGAAAAAGG + Intergenic
1081440171 11:43072160-43072182 CAAGATACTCAGAAGGAGAAAGG + Intergenic
1082071720 11:47944648-47944670 AAACATTTTCAGAAGAATAAAGG + Intergenic
1082654494 11:55836843-55836865 AAATGTTCCCATCAGGAGAAGGG - Intergenic
1082796331 11:57380664-57380686 AACTGTTCCCAGCAGGAGAAAGG + Exonic
1082805852 11:57449644-57449666 AAATATTATCAATAGGAGATTGG - Intergenic
1084454526 11:69260402-69260424 AAATAGCTTCAGAAAGAGAAAGG - Intergenic
1084680845 11:70665433-70665455 GAAAATTCTCAGATGGAGCAGGG - Intronic
1084755495 11:71235954-71235976 CAGTTTTCTCAGCAGGAGAATGG - Intronic
1084775934 11:71375527-71375549 AAATTTGCCCAGAAGGAGAAAGG + Intergenic
1086194013 11:84115411-84115433 AAATATACTCCTAAGGGGAATGG - Intronic
1086460758 11:87003307-87003329 AGAGATTCTCAGAATGGGAAGGG + Intergenic
1086890249 11:92249254-92249276 AACGATGATCAGAAGGAGAATGG + Intergenic
1087470786 11:98571599-98571621 AAATATTCCCTGCAGGAGAAGGG + Intergenic
1087767636 11:102173518-102173540 AACTATTCTAAGAAAGAGTAGGG + Intronic
1087879391 11:103397505-103397527 AAACATTCTCAAAAGATGAATGG - Intronic
1088034763 11:105298067-105298089 AAATATTCTCATTAGTATAAAGG - Intergenic
1089652002 11:119920589-119920611 CAATATTCTCAGAATGGAAAAGG - Intergenic
1090406453 11:126478422-126478444 AAAGAATCTCAGAAGGGGAGTGG + Intronic
1090542047 11:127717191-127717213 GAATAAACTGAGAAGGAGAATGG + Intergenic
1090743231 11:129685661-129685683 AAATATCCTCAGTAAGTGAAAGG + Intergenic
1091024510 11:132130113-132130135 AAATATTCTCAGAAGGAGAAGGG + Intronic
1092044252 12:5417525-5417547 CAAGATTCACTGAAGGAGAAGGG - Intergenic
1092770154 12:11889314-11889336 AAAGATTTTCAGTAAGAGAAAGG + Intronic
1092837113 12:12501040-12501062 AATAATTCACAGAAGCAGAATGG + Intronic
1093133814 12:15424720-15424742 GAATATTCCCAGATGAAGAAAGG + Intronic
1093771762 12:23026345-23026367 AAATATTTTCAGAAGAAAATAGG - Intergenic
1094250679 12:28356710-28356732 AAATATTATCTGATTGAGAAAGG - Intronic
1094468539 12:30780183-30780205 ACAGATTTTCAGAAGTAGAAGGG + Intergenic
1095835023 12:46628453-46628475 AAAAATTTTAAGAAGGATAATGG + Intergenic
1095888783 12:47216195-47216217 AAAGATGGTCAGAAGGGGAAAGG - Intronic
1097217136 12:57423058-57423080 AAATATTTGAAGAAGGAGAGGGG + Intronic
1097351888 12:58557583-58557605 AAATATTTTCAGAAGGAACATGG + Intronic
1097427250 12:59461681-59461703 ATGTTTTGTCAGAAGGAGAAAGG + Intergenic
1097494048 12:60307749-60307771 TAATATTTTCAGCAGGAGAAGGG - Intergenic
1098046438 12:66405704-66405726 AAATATTCCTAGAAGCAGGATGG - Intronic
1098356088 12:69614308-69614330 AAATATTCTAAGAATAAGAAAGG + Intergenic
1099109420 12:78538865-78538887 AAACCATCTCAGAAGGAGAATGG + Intergenic
1099289921 12:80763801-80763823 AAATATAGTCAGATGGAAAATGG + Intergenic
1099388827 12:82052447-82052469 AAATAATGGCAGAAGGATAATGG - Intergenic
1099606063 12:84802498-84802520 AAATGTTCTCATATGGAGATAGG - Intergenic
1100075356 12:90774499-90774521 AAATATTCTAAGTAGGAGAGTGG - Intergenic
1100084054 12:90885820-90885842 AAATATTGTCAGAAGCTGAAAGG - Intergenic
1100144122 12:91656456-91656478 GAATGTTCTTAGATGGAGAATGG - Intergenic
1100443761 12:94642017-94642039 AAATAAATTCAGAAGAAGAATGG + Intronic
1100910291 12:99353081-99353103 AAAGATTCTAATTAGGAGAAGGG - Intronic
1101411918 12:104476516-104476538 AAATATTCAACAAAGGAGAATGG - Intronic
1102635380 12:114319142-114319164 GAATACTCTCAGAAGAAAAATGG + Intergenic
1102900987 12:116636684-116636706 AAATATTTTCCCAAGGAGCATGG - Intergenic
1104276210 12:127330378-127330400 AAAGATTCTTAGAATGAAAATGG + Intergenic
1104553963 12:129782896-129782918 CAATATTCTGAGGAGGAGACAGG + Intronic
1104709535 12:130975939-130975961 AAACATTCACAGAGGGAGGAAGG - Intronic
1105309740 13:19195746-19195768 AAAAATTTTCAGAAGGAGGTCGG + Intergenic
1105329416 13:19401275-19401297 AAACAAATTCAGAAGGAGAAGGG - Intergenic
1105594376 13:21822705-21822727 AAAATATCTAAGAAGGAGAATGG - Intergenic
1106625951 13:31421165-31421187 CAACATTCCCAGAAGAAGAATGG - Intergenic
1107295162 13:38900004-38900026 ACATATTCTCAGAAATAAAAAGG + Intergenic
1107729393 13:43333184-43333206 AAAAATTCTTAGCAGTAGAAAGG + Intronic
1107949640 13:45450507-45450529 AAATATTTACAGAAGGAGAGTGG + Intergenic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1108639890 13:52373251-52373273 AAATATTCCAAGAAATAGAATGG - Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1109365298 13:61347882-61347904 AAATATTATCAGCAGATGAATGG - Intergenic
1109509195 13:63346845-63346867 AAATATTCTGAGAGGAAGAAGGG + Intergenic
1109532768 13:63673466-63673488 AAATATTCTCGATAGGAGTAAGG + Intergenic
1110346260 13:74451214-74451236 AAATATTGTCTGAAGGCCAAGGG + Intergenic
1110592126 13:77275526-77275548 AAAGACTCTCAGAAGGAGCTGGG + Intronic
1110879403 13:80552822-80552844 AAATATTCCCAGAAAAATAAGGG - Intergenic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1111693403 13:91592928-91592950 AGACATTCTCAGAGGGAGATGGG + Intronic
1111761564 13:92472260-92472282 AAATATTCCTGGAAAGAGAAGGG - Intronic
1113508675 13:110834138-110834160 AAACATTTTCATAAGGAGGAAGG - Intergenic
1113667971 13:112154074-112154096 GAAGCTTCTCAGATGGAGAAAGG - Intergenic
1114204866 14:20559789-20559811 AAATGTTCTTGGAAGAAGAATGG + Intronic
1114273097 14:21116374-21116396 AAAAATTCTTAGAAGCAGAATGG - Intergenic
1115174344 14:30545409-30545431 AAATAGTAACAAAAGGAGAATGG - Intergenic
1115571812 14:34673863-34673885 AAATGTCCTCAGTAGGTGAATGG + Intergenic
1116360575 14:43991396-43991418 AAATTACCTTAGAAGGAGAATGG + Intergenic
1116761482 14:49020443-49020465 TAATGTTCTAAGAAGGATAAGGG - Intergenic
1116973149 14:51089139-51089161 AAATCAACTCACAAGGAGAATGG - Intronic
1117211525 14:53505744-53505766 AGATTTTCTCAGCAAGAGAAAGG - Intergenic
1118179677 14:63480016-63480038 AAATATACTCAAAAGTAGAAAGG + Intronic
1118847865 14:69561531-69561553 AAAACTTCTCATAAGAAGAATGG - Intergenic
1119194413 14:72706404-72706426 CAATATGCTTGGAAGGAGAAAGG - Intronic
1119311776 14:73652954-73652976 AAATTCTCTCAAAAGGAAAATGG + Intronic
1120399418 14:84009836-84009858 AAATATTCGCAGACTGAAAAGGG - Intergenic
1120842823 14:89101336-89101358 GAATAGTTTCAGAAGGAGAATGG + Intergenic
1120914506 14:89698950-89698972 AAATATTTAAAGAAGGATAAAGG + Intergenic
1121506831 14:94484080-94484102 AAGGCTTCTGAGAAGGAGAAGGG + Intergenic
1123495537 15:20821080-20821102 AAATATTTTAAAAAGGGGAAAGG + Intergenic
1123552025 15:21390195-21390217 AAATATTTTAAAAAGGGGAAAGG + Intergenic
1123757642 15:23409287-23409309 AAATATTCACAGAAGGCGGCTGG + Intergenic
1123817924 15:23998500-23998522 AAATATTCAAACAAGAAGAACGG - Intergenic
1125311494 15:38383743-38383765 AAATATTGAAAGAAGGAAAAAGG + Intergenic
1125513593 15:40305908-40305930 AACCATTCCTAGAAGGAGAAGGG + Intronic
1126269226 15:46793429-46793451 AGATGTTCTCAAAAGGGGAATGG + Intergenic
1126286090 15:47012612-47012634 ATAAAATCTCAGAAGGAAAAAGG + Intergenic
1126779991 15:52131208-52131230 AAATATTCTAAAAAAGAAAAAGG + Intronic
1128092770 15:64930363-64930385 AAATAGTCTCAGGAGGACAGAGG + Intronic
1128446206 15:67763424-67763446 ACATGTTATCAGAAGGAGAAAGG - Intronic
1128851436 15:70961499-70961521 AGATGTCCTCAGAAGGTGAATGG + Intronic
1130069837 15:80637074-80637096 AAATGTTATCATAAGGAGTAAGG + Intergenic
1132183859 15:99786114-99786136 AAATATTCCTAGAAAGAGAAGGG + Intergenic
1202960371 15_KI270727v1_random:117411-117433 AAATATTTTAAAAAGGGGAAAGG + Intergenic
1133451804 16:5910195-5910217 AAAGGTTCTCAGAATGAGAAGGG + Intergenic
1133788398 16:8990483-8990505 AAAGAATCTCAGCAGGAAAACGG - Intergenic
1133916021 16:10110701-10110723 AAATATTCCCAGGAGGAAAACGG - Intronic
1137509717 16:49088367-49088389 GAAGTGTCTCAGAAGGAGAATGG - Intergenic
1137859881 16:51835858-51835880 TGATTTTCTCAGAAGGTGAAGGG - Intergenic
1137927720 16:52557117-52557139 AAATATGGTCCCAAGGAGAAGGG - Intergenic
1138404931 16:56783834-56783856 GAATATTCCCAGAAAGAAAATGG + Intronic
1139062603 16:63271970-63271992 AAATATTAAAAGAAGTAGAAAGG - Intergenic
1139891790 16:70257809-70257831 AAACATTCCCAGGAGGAAAAGGG - Intronic
1139982050 16:70867531-70867553 AATAATTTTCAAAAGGAGAAGGG + Intronic
1140575555 16:76164045-76164067 AAAATTTCTGAGCAGGAGAATGG - Intergenic
1140820685 16:78660200-78660222 AAATATTGTCAGCAGGAGGGAGG + Intronic
1140980728 16:80106462-80106484 AAATATTATCAAAAGAAGAGGGG + Intergenic
1141554554 16:84828242-84828264 GAATTTACTCAGGAGGAGAAGGG + Intronic
1142870031 17:2814101-2814123 AAATATTCACAGAAGAAAAGGGG + Intronic
1144042605 17:11426192-11426214 AAATAGTGACAGAAGGTGAAAGG + Intronic
1145791358 17:27629447-27629469 AAATGTTCACCAAAGGAGAAGGG - Intronic
1145806922 17:27740994-27741016 AAATGTTCACCAAAGGAGAAGGG - Intergenic
1148394969 17:47300464-47300486 ACACATTCTCTGAAGGAGAGAGG - Exonic
1148985256 17:51615254-51615276 AAATATTTTCAAGAGGAGACTGG - Intergenic
1149073544 17:52572574-52572596 AAATATTCTTAAAAGGTCAAAGG + Intergenic
1149084037 17:52693014-52693036 AAATAGGCTAAGAAGGAGGAGGG - Intergenic
1149256149 17:54829000-54829022 ATAAAGTCACAGAAGGAGAATGG + Intergenic
1149900544 17:60473440-60473462 AAATATTTTTAGATGGAAAATGG - Intronic
1150110183 17:62492380-62492402 AAATAGTCTCAGAATAAGGATGG + Intronic
1150111836 17:62507996-62508018 AATTATTATCAGCAGGAGACAGG + Intronic
1150517750 17:65831807-65831829 AATTACTCACAGAAGGAAAAAGG + Intronic
1151069240 17:71189479-71189501 AGAAATTTTCAGAAGCAGAAGGG - Intergenic
1153078451 18:1192859-1192881 AAATTTTCTGAGAAGGTGAGAGG + Intergenic
1153204873 18:2688025-2688047 AAATATTGTCTGAAGAATAATGG - Intronic
1153269802 18:3308799-3308821 AAATATTTACAAAAGCAGAAGGG - Intergenic
1153549887 18:6251357-6251379 CAATTTTCTCAGTAAGAGAAAGG + Intronic
1154086922 18:11314454-11314476 AAATACTCAGAGATGGAGAAGGG + Intergenic
1154452939 18:14493562-14493584 AAATATTTTAAAAAGGGGAAAGG + Intergenic
1154934495 18:21038406-21038428 AAATTGTCTAAGGAGGAGAAAGG - Intronic
1155039701 18:22054631-22054653 AAATATTATCAGAGAAAGAAAGG - Intergenic
1155548676 18:26941455-26941477 AAATATGGTCAGCATGAGAATGG - Intronic
1156085400 18:33393169-33393191 AAATATTCTCATAGGTATAAAGG - Intronic
1156271732 18:35541188-35541210 AAGGATTCTCAGAAGGTGAGGGG - Intergenic
1156276618 18:35589498-35589520 AAACATTAACAGAAGCAGAAGGG - Intronic
1156785238 18:40904634-40904656 AAATAGACTCACAAAGAGAAAGG - Intergenic
1156972869 18:43178226-43178248 ACCTATTCTGAGAATGAGAAGGG - Intergenic
1157144945 18:45152648-45152670 AAATATCCTCAGAGAGATAATGG - Intergenic
1157367389 18:47078057-47078079 AAACATTCTCAGAACTATAAAGG - Intronic
1158716485 18:59884809-59884831 TAAGCTTCTCAGAAGGAGAATGG - Intergenic
1158764617 18:60434610-60434632 AAATATCCTCACAAGAAGATGGG + Intergenic
1159034188 18:63261415-63261437 AGATATTCACTGAAGGAGTAAGG + Intronic
1159251420 18:65882381-65882403 AATTATTTTTAAAAGGAGAAAGG - Exonic
1159893176 18:73972066-73972088 AACTATTCACAGTAGGGGAAGGG - Intergenic
1159995366 18:74959419-74959441 AAATTGTCCCAGAAGCAGAAGGG - Intronic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
1161745093 19:6053152-6053174 AAATTTTTTCAGAAGAAGAAAGG + Intronic
1165141698 19:33703673-33703695 AAATATTGTGAGAAGGAGAGGGG - Intronic
1165692556 19:37874891-37874913 AAATTCTCTCAGGAAGAGAACGG - Intergenic
1166237949 19:41470056-41470078 TAATATTCACAGGGGGAGAAGGG - Intergenic
1166566446 19:43768423-43768445 AAATGGTCTCAGCAGAAGAAGGG + Intronic
1168166349 19:54550775-54550797 AAATATTCTAAGTCAGAGAATGG - Intergenic
1168469700 19:56630222-56630244 AAAAAATCTCAGAAAGAGGAGGG + Intergenic
925529859 2:4847428-4847450 AAATATTATGAAAAGGAGACAGG + Intergenic
925574017 2:5341435-5341457 AAATATCCTCATAAGAAGATGGG + Intergenic
925881991 2:8360544-8360566 AAATATTCTCATAACAAAAAGGG + Intergenic
926562274 2:14430702-14430724 GAATATTAGAAGAAGGAGAAAGG - Intergenic
926666665 2:15531899-15531921 AAATAATCAGAGATGGAGAATGG - Intronic
927271942 2:21220501-21220523 AAGAAATCTCAGAATGAGAAAGG - Intergenic
927460421 2:23293944-23293966 CCTTGTTCTCAGAAGGAGAAAGG - Intergenic
927531254 2:23804830-23804852 AAATATTTTCAAAGTGAGAAAGG - Intronic
927688685 2:25191719-25191741 AACTATTCCCAGAAGGTGCATGG - Intergenic
928183788 2:29091023-29091045 AAATTTTCTCTGAGGCAGAATGG + Intergenic
928686716 2:33757497-33757519 AAATACTCTCAGAAGAAGAATGG + Intergenic
929793973 2:45044332-45044354 AAGAATTACCAGAAGGAGAATGG - Intergenic
931477064 2:62598984-62599006 AAATATTCTAAAAAAGAGAAAGG - Intergenic
931896557 2:66737684-66737706 AAATATTACCAGAATGAGAAAGG + Intergenic
931978661 2:67670637-67670659 ATAAATTTTCAGAAGGAGGATGG + Intergenic
933044884 2:77523155-77523177 GAATATCCTCAGAATTAGAAGGG + Intronic
933379520 2:81525124-81525146 AATTATTCTGAGAAGGAGGATGG - Intergenic
933473176 2:82754010-82754032 AATGATACTCAGAAGGAAAAGGG + Intergenic
934034113 2:88074618-88074640 AAATATGTTAAGAAGGAGCAAGG + Intronic
934604804 2:95686655-95686677 AAATATTTGCAGAGGGAGTATGG - Intergenic
935149491 2:100420935-100420957 AAATATTTTCAGATGGAGACTGG + Intergenic
935202783 2:100872610-100872632 AAATAGCCTCAGTAGGAAAAGGG - Intronic
936476002 2:112840387-112840409 AAATAATCCCAGAAGCAGAAGGG - Intergenic
936644433 2:114352163-114352185 AAGAGTTCTAAGAAGGAGAATGG - Intergenic
936816084 2:116462786-116462808 AAATATGCCCAAAAGGAGAATGG + Intergenic
939664073 2:144928984-144929006 AAATATGCTCAGAAAGCTAAAGG - Intergenic
939938118 2:148316747-148316769 AAATATTTTTAAAAGGAAAAAGG + Intronic
940377871 2:152977184-152977206 CAAGATTCTCTGGAGGAGAAGGG - Intergenic
940484520 2:154280420-154280442 AAAAATTCTCAAGAGGAGACAGG + Intronic
940579909 2:155565176-155565198 AAATATTATATGAAGGAGGATGG - Intergenic
941189204 2:162355911-162355933 AAGTGTTTTCAGAAGCAGAAGGG - Intronic
941302289 2:163817652-163817674 AAACATACTGAGAAGGAAAATGG - Intergenic
941937344 2:170994874-170994896 AAATATTCTCAGGAGGTAACTGG + Intronic
942143952 2:173007309-173007331 AAATATTCTGAGCAAGAAAATGG + Intronic
942809622 2:179982429-179982451 AAAGTTTCTCAGTAGGAGAGTGG + Intronic
942853400 2:180517907-180517929 TAATATTCTTAAAAGGAGAAGGG + Intergenic
943525813 2:189015968-189015990 GAATATACTCAGAAGGTGAATGG - Intergenic
944027430 2:195188085-195188107 AGATATTTTCAGAAAGTGAAGGG + Intergenic
944083189 2:195813174-195813196 AAATATCCTCAACAGTAGAATGG + Intronic
944280183 2:197886601-197886623 AAAAATTATCAGAAAGAGTATGG + Intronic
945504358 2:210620237-210620259 AAATATTCACAGACTGAGATGGG + Intronic
945510749 2:210699753-210699775 AAATCATTTCATAAGGAGAAGGG - Intergenic
946387295 2:219392176-219392198 AGATTTTCTCAGAAGGCCAAGGG - Intronic
946913615 2:224491558-224491580 TAATATACTAAGAAGAAGAAAGG - Intronic
947317045 2:228871465-228871487 ATATCTTCTCAGGAGAAGAATGG - Intronic
1169608570 20:7352318-7352340 AAATATAATCAGAAGGAGCCTGG - Intergenic
1169644597 20:7795891-7795913 AAATATTTTCAGAAAAAGAATGG + Intergenic
1170169689 20:13396707-13396729 AAATATCAACAGAATGAGAAAGG + Intronic
1170418701 20:16171266-16171288 AAATATTTGAAGAAGGAGAGAGG + Intergenic
1170485637 20:16813185-16813207 AAATGTTTTCAGGAGGAAAAAGG - Intergenic
1170543096 20:17408460-17408482 AAAGATTCTCAGTGGGAAAAAGG + Intronic
1170761971 20:19258911-19258933 AATTATTGCCAGAAGGAGATAGG - Intronic
1171335966 20:24385873-24385895 AAATGTTCTCAGAAGGAACTTGG + Intergenic
1172085610 20:32379940-32379962 AAATATTCTAAACAGGAAAAGGG - Intronic
1172675774 20:36670676-36670698 AAATGTTATCTGAAGGAAAATGG - Intronic
1173021655 20:39272536-39272558 AAATATTTACAGGAAGAGAAAGG + Intergenic
1173090426 20:39965388-39965410 AAATAATTTCAAATGGAGAAAGG - Intergenic
1173690329 20:44955975-44955997 AGATTGTCTCAGAAGGAGAAAGG - Intronic
1173767377 20:45625126-45625148 AAATCATGTCAGAAGGCGAAGGG + Intronic
1174551617 20:51366534-51366556 AAATCGACTCAGATGGAGAAAGG + Intergenic
1174876164 20:54228540-54228562 TAATATTATCAACAGGAGAATGG + Intergenic
1174999481 20:55611381-55611403 TCATATTCTTAGAATGAGAAAGG + Intergenic
1175333815 20:58182086-58182108 AAAAGATCTCACAAGGAGAAGGG - Intergenic
1176443098 21:6794721-6794743 AAATATTTTAAAAAGGGGAAAGG - Intergenic
1176686311 21:9851327-9851349 GAATATTTTCAGAAGAAGGAAGG - Intergenic
1176821264 21:13659766-13659788 AAATATTTTAAAAAGGGGAAAGG - Intergenic
1177369319 21:20180813-20180835 AAATATTATCAAAAGTATAATGG - Intergenic
1177756530 21:25355530-25355552 AAATGTTATCTGAAGGAGAGAGG + Intergenic
1178973301 21:37200371-37200393 AAATATTTTCAAAATAAGAAAGG + Intronic
1179013769 21:37576582-37576604 AAATTTTCTAAAAAAGAGAATGG + Intergenic
1179096123 21:38316108-38316130 AAAAAATCCCAGAAAGAGAATGG + Intergenic
1179159628 21:38883373-38883395 AAATATTCTTAAAAGCAGAGAGG - Intergenic
1181297768 22:21854768-21854790 AAATGTTATCATAAGCAGAATGG + Intronic
1182186021 22:28403333-28403355 TAATATTCTGAGGAGGAAAACGG - Intronic
1182858651 22:33540116-33540138 AAATATTCATAGAAAGAGAAGGG - Intronic
1183168527 22:36166367-36166389 ATATACTCTCAGAGGGAGAGCGG - Intergenic
1184589012 22:45468612-45468634 AAATAATGGCAGAAGGTGAAGGG + Intergenic
1184971354 22:48023118-48023140 AATTCTTCTCAGTAGAAGAAAGG + Intergenic
949820256 3:8108627-8108649 AAAAATTCTGAGGAGGAAAAAGG + Intergenic
950802107 3:15561167-15561189 AAGTACACTCAGAAGGAGAAGGG + Intronic
951556276 3:23923677-23923699 ATAAATTCTTAGAAGTAGAATGG + Intronic
952038143 3:29229096-29229118 AAATATTCTTAAATAGAGAAAGG - Intergenic
952145596 3:30528546-30528568 AAGAATTCTGAGAAGGAGATAGG - Intergenic
952227412 3:31392525-31392547 AACAATTCTCAGCAGGAGCAAGG - Intergenic
952271813 3:31840261-31840283 AAATGTTCTCAGAATGACATTGG - Intronic
952572644 3:34735448-34735470 AAATAGTTTCAGAAGAAAAATGG - Intergenic
952688142 3:36173011-36173033 AATGATTATCAGAAGGAGAAAGG - Intergenic
953146490 3:40280894-40280916 TGAGATTCTCAGAAGGGGAATGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953368649 3:42368518-42368540 AAGTATTCTCAGATTGTGAAAGG - Intergenic
953485497 3:43290720-43290742 AAAAATCCTGAGCAGGAGAATGG - Intronic
953735543 3:45491325-45491347 TAATATTATCTGAAGGAGCAAGG + Intronic
954252036 3:49375383-49375405 AAATATTCTAACATGGAAAATGG + Intronic
955536358 3:59927976-59927998 ATATATTCTGACAAGGAAAAAGG - Intronic
955893034 3:63670384-63670406 AAAGATTATCAGAATGGGAAGGG - Intronic
956508385 3:69967635-69967657 AAATTGTCTCTTAAGGAGAAGGG - Exonic
957131431 3:76227140-76227162 ATATACTTTCAGAAAGAGAAAGG - Intronic
957546711 3:81647382-81647404 AAACATATTCAGATGGAGAAAGG - Intronic
957921094 3:86749135-86749157 AAATAATTACACAAGGAGAAGGG - Intergenic
957997044 3:87704239-87704261 AAAAGTTCTTATAAGGAGAAAGG + Intergenic
958068790 3:88582120-88582142 ATATATTCTAAAAAGGAGATTGG - Intergenic
958131437 3:89430328-89430350 AAATTTTCTAAGACTGAGAAAGG + Intronic
958149077 3:89667176-89667198 AAATATGCTAAAAAGAAGAAAGG - Intergenic
958634125 3:96721000-96721022 AAATCTTCAGAGATGGAGAAAGG + Intergenic
958736436 3:98015127-98015149 AAATCTTTTCAGATGGAAAATGG + Intronic
959048501 3:101501097-101501119 AAATCATCACAGAAGGAAAAAGG - Exonic
959378177 3:105610369-105610391 AAAGATTCTCAGAAAGAAAAAGG - Intergenic
959672896 3:108999156-108999178 AAGTATTTTCAAAAGGAAAAGGG - Intronic
960411213 3:117327480-117327502 GAATATTCTTTAAAGGAGAATGG - Intergenic
960982280 3:123241141-123241163 AACTGTACTCAGAATGAGAAAGG + Intronic
961065214 3:123869552-123869574 AAATATTCTAGGCAGGAAAAGGG + Intronic
961091179 3:124114030-124114052 AAATATTTTTAAAAGGAGAAAGG + Intronic
961693641 3:128688716-128688738 ATATATACTCTGAAGGAGGAAGG + Intergenic
961853039 3:129840743-129840765 AAATCATCGCAGAAGGTGAAGGG - Intronic
961981295 3:131081857-131081879 AAAGAAGCTCAGAAGGAAAAGGG + Intronic
963880932 3:150527430-150527452 AATGAATCTGAGAAGGAGAATGG + Intergenic
963952345 3:151216745-151216767 AAACAGGCTCATAAGGAGAAAGG - Intronic
965587653 3:170333232-170333254 AAAAATTATCAGAAGGTGAGAGG + Intergenic
965685746 3:171300410-171300432 AAATTTTCTCAGAAAGAGAAAGG + Intronic
966299839 3:178465763-178465785 AAATATGCTCAGCATGACAAAGG - Intronic
966905688 3:184524224-184524246 AAATTTTCACAGCAGGAGAATGG + Intronic
967071115 3:185963101-185963123 AAAGCTTCTAAGAGGGAGAATGG - Intergenic
967296952 3:187974560-187974582 ATATGTTCTCAGAAGGCGAGGGG + Intergenic
967734109 3:192934035-192934057 AGATATTTACAGAAGGAGTATGG + Intergenic
967864965 3:194182466-194182488 AAAAAAGCTGAGAAGGAGAAAGG + Intergenic
968001031 3:195206944-195206966 AAATATCCACAGAAGGAGAGAGG - Intronic
969194900 4:5553176-5553198 AAATCATGGCAGAAGGAGAAGGG + Intronic
969367696 4:6708417-6708439 AAATACTCTCAGAAGAGAAATGG - Exonic
970349755 4:15190425-15190447 ACATGTTCTCAGAAGAAGAGTGG + Intergenic
970519978 4:16873058-16873080 AAAGATGCTGTGAAGGAGAATGG + Intronic
970846734 4:20548412-20548434 AGTGATTCTTAGAAGGAGAAGGG - Intronic
971214811 4:24653008-24653030 AAATATTCTCAGAATGAGAAGGG + Intergenic
971820770 4:31551288-31551310 AAATAATCTCAAAAGCAGTAAGG + Intergenic
972974433 4:44616338-44616360 AAATATTCACGGAAGCTGAAGGG - Intergenic
973312654 4:48726273-48726295 CATTATGCCCAGAAGGAGAAGGG - Intronic
973692447 4:53451431-53451453 AAATATTCTCAGTAATAAAAAGG - Intronic
973731972 4:53831626-53831648 AAATCATGTCAGAAGGTGAAGGG - Intronic
974211972 4:58789845-58789867 ACATATTCTCATTAGGATAATGG + Intergenic
974731238 4:65868961-65868983 AAATATTCTCAGAAAACTAAAGG + Intergenic
974966427 4:68766108-68766130 AGATATTCTTATAAGGAGAAAGG - Intergenic
975805926 4:78112137-78112159 AAGAATTCTCCAAAGGAGAAAGG + Intronic
975972180 4:80053011-80053033 AATTATACTGGGAAGGAGAAAGG - Intronic
976376249 4:84348892-84348914 TATTATTATCAGAAGGAGACTGG + Intergenic
976580970 4:86736853-86736875 ATATATTATTAGAAGGAGTAGGG - Intronic
976659754 4:87527684-87527706 AAAAATTCTCTGAAAGAAAAAGG + Intronic
977129676 4:93219823-93219845 AATTTTTCTTAGATGGAGAAAGG - Intronic
977480955 4:97574736-97574758 AAAAATCCACAGAAGCAGAAAGG - Intronic
978062940 4:104360571-104360593 AAAAATGCTCAGAAACAGAAAGG + Intergenic
978607265 4:110494437-110494459 TAATACTGTCAGAAGAAGAATGG - Intronic
979811184 4:125038219-125038241 TGATATTCACAGAAAGAGAAAGG + Intergenic
979848705 4:125549522-125549544 AAATATTTAGAGAAGGAGGAAGG + Intergenic
980213571 4:129821677-129821699 AATTATTCTGAGATGGAGAAAGG - Intergenic
980381309 4:132021845-132021867 AAATATTCTTAAAATTAGAAGGG + Intergenic
981097216 4:140793836-140793858 AAATATTTTCTGAAATAGAAAGG - Intergenic
981192830 4:141883570-141883592 AATTTTTCTGAGAATGAGAAAGG - Intergenic
981322457 4:143408649-143408671 AAATTTTATCAGCAGGATAATGG - Intronic
982039903 4:151386772-151386794 AAATATTCTTAGCAGCAGACAGG + Intergenic
982861839 4:160462035-160462057 ATATATTCTTAGAAAGAGCATGG + Intergenic
983278428 4:165648699-165648721 GAATATTCTTAGAATAAGAAAGG + Intergenic
983313360 4:166094672-166094694 AAAAATTCTCAGAATAATAAAGG - Intronic
983437004 4:167729055-167729077 GAATATTCTGAGAAGGACATTGG - Intergenic
984072877 4:175138024-175138046 AAACAGTTTCAGAAGGAAAATGG - Intergenic
985381080 4:189395565-189395587 AAATAGAGTCAGAAAGAGAAGGG - Intergenic
986436546 5:7738053-7738075 AAATTATGTCAGAAGGAAAAAGG + Intronic
986456095 5:7920627-7920649 AAATATTTTCAGAAAAAGAAAGG - Intergenic
986547655 5:8916394-8916416 AACTATGCACAGAAGTAGAAAGG - Intergenic
986626556 5:9728484-9728506 AAATATTCAAGGTAGGAGAAAGG + Intergenic
986950907 5:13083869-13083891 AAATTTACTCACATGGAGAAAGG + Intergenic
987060013 5:14233523-14233545 AAATATTTACTAAAGGAGAAGGG - Intronic
987263279 5:16225348-16225370 AAATCTTCTCAGCAAAAGAAAGG + Intergenic
987341610 5:16944305-16944327 AAAGCCTCTCAGAAGGAGATAGG + Intergenic
987593167 5:19959664-19959686 ACAGATTTCCAGAAGGAGAAGGG + Intronic
987668092 5:20971592-20971614 AAATATTTTAAAAAGTAGAATGG + Intergenic
988355884 5:30173708-30173730 AAACGTTCTCAGCAGAAGAAAGG - Intergenic
988484625 5:31658373-31658395 AAATTTTCTCAGAAGCAGGAAGG - Intronic
988570115 5:32356948-32356970 AAATATTCTCACAAGTATGATGG + Intronic
988997563 5:36728729-36728751 AAATATGCTCAGCAAAAGAAAGG - Intergenic
989711380 5:44401570-44401592 AAGTATTCCTAGAAGAAGAAAGG - Intergenic
989727286 5:44601641-44601663 AAATATTTGCAGAAGCAAAAAGG - Intergenic
990150184 5:52809145-52809167 AATGGTTCTCAGAAGAAGAAAGG - Intronic
990568421 5:57053477-57053499 AAATGTTTTTAGAAAGAGAATGG - Intergenic
992809034 5:80367727-80367749 ATAAATTCTCAGAAGTGGAATGG - Intergenic
992921865 5:81532714-81532736 AAATATTATCATAAGAAGCAGGG + Intronic
993516500 5:88842683-88842705 AAAAATTCGCAGTAGGAAAAAGG + Intronic
993936640 5:94012823-94012845 AAATCTCCTCACAAGGAGACAGG + Intronic
994235444 5:97357228-97357250 AAATAGCCTCAACAGGAGAATGG - Intergenic
994470376 5:100196761-100196783 AAATATTCTTAGAAATAAAATGG - Intergenic
994660840 5:102652085-102652107 AAATATTATCAGAAGTTAAAAGG - Intergenic
994698325 5:103100943-103100965 ACATATTCTCTGAAGGTAAAGGG - Intronic
994726801 5:103445757-103445779 ATTTCTTCTCAGAGGGAGAAAGG - Intergenic
994758823 5:103827975-103827997 AAAGATTGTAAGAAGGAGAGTGG - Intergenic
995123011 5:108555119-108555141 AAATATTCTCAGAAATATACTGG + Intergenic
995404874 5:111783600-111783622 AAACTTCCTCAGATGGAGAAGGG - Intronic
995981704 5:118112285-118112307 AAATCATCACAGAAGGAGAAAGG - Intergenic
996136211 5:119845616-119845638 AAGTGTTCTGAGAAGGAGAGAGG - Intergenic
996228975 5:121037851-121037873 CAATTTTTTTAGAAGGAGAAAGG + Intergenic
996703275 5:126471195-126471217 AAAAATTCTTATAAGGAGAATGG - Intronic
998408537 5:141889101-141889123 AAATATAGTCAGAAGGAGTTTGG - Intergenic
998609179 5:143669339-143669361 AAATATTCTGTCAAGGTGAAGGG - Intergenic
998890839 5:146744126-146744148 AAATATTATGAAAAGGAGGAAGG - Intronic
999331907 5:150679271-150679293 TCACATTCTCAGAAGAAGAAAGG - Exonic
999582286 5:153052303-153052325 AATTATTAACAGAAGGAGGAAGG + Intergenic
999922711 5:156339787-156339809 ATATATACTTAGAATGAGAAAGG + Intronic
1000043957 5:157506108-157506130 ATATATGTTCAGAAGAAGAATGG - Intronic
1000132368 5:158312396-158312418 TAAGATTCTCAGAAGGATAAAGG - Intergenic
1000630068 5:163582824-163582846 AAACATTTTTATAAGGAGAATGG + Intergenic
1000736097 5:164902510-164902532 AATTTTTCTGAGAAGGAGGAAGG - Intergenic
1000827150 5:166059069-166059091 AAATAGTCTGAGAAAGAAAAGGG - Intergenic
1000911103 5:167023091-167023113 TAAAATTCTCAGAAGGGGGATGG - Intergenic
1001624516 5:173119760-173119782 AAATTTTCTCAAAATGATAAAGG - Intronic
1001956496 5:175851389-175851411 AAACAGTCACACAAGGAGAAAGG + Intronic
1002938573 6:1696389-1696411 GAAAATTCTCAGGAGGAAAATGG - Intronic
1003573623 6:7272470-7272492 AAATGCTCTCAGATAGAGAACGG + Intronic
1003573625 6:7272511-7272533 AAATGCTCTCAGATAGAGAACGG + Intronic
1003573668 6:7273672-7273694 AAATGCTCTCAGATAGAGAACGG + Intronic
1003620557 6:7695701-7695723 AAATATTTTAAGAATGAGAAGGG - Intergenic
1003746201 6:9005208-9005230 AAATATCCTCCAAAAGAGAAGGG - Intergenic
1004173135 6:13314679-13314701 AAGTGTTCTCAGAAGCTGAAGGG + Intronic
1006262923 6:32891930-32891952 GAATATGCTAAGAAGGAGGAAGG + Intergenic
1007543702 6:42674297-42674319 AATTATACTCAGAAGGGGTAAGG - Intronic
1007811917 6:44492266-44492288 CAATCTTGGCAGAAGGAGAAAGG - Intergenic
1008319200 6:50086559-50086581 AAATGTGATCAGAAGGAGTACGG - Intergenic
1008589717 6:52981917-52981939 TGGAATTCTCAGAAGGAGAATGG + Intronic
1008697686 6:54059901-54059923 AAATATTTTGAGAACTAGAAAGG - Intronic
1009221764 6:60991988-60992010 AAAGCCTCTCAGAAGGAGACAGG + Intergenic
1009553797 6:65135237-65135259 AAATATTCTAAGAATTAAAAAGG - Intronic
1010000446 6:70943779-70943801 AAATATTATCAGGAGAAAAAAGG + Intronic
1010045920 6:71443109-71443131 AAATATCCTCAGAAAGAAGATGG - Intergenic
1010082279 6:71877761-71877783 AACAATTCTGAAAAGGAGAAAGG + Intergenic
1010327692 6:74583998-74584020 AAAAATGATCAGAAGGAGGAAGG + Intergenic
1010555870 6:77278599-77278621 AAATAGGCTCAGTAGCAGAATGG + Intergenic
1010661829 6:78580487-78580509 AAATAATCTAAGAAAGGGAAGGG + Intergenic
1010760553 6:79717595-79717617 AGATTTTCACAGAAGGAAAACGG + Intergenic
1010982610 6:82386140-82386162 AAATATTCTCAGAATGCCAGAGG + Intergenic
1011164408 6:84430305-84430327 AAACAGTCTCACATGGAGAAAGG - Intergenic
1011580826 6:88862270-88862292 ACATCTTCTAGGAAGGAGAACGG + Intronic
1011631221 6:89326548-89326570 AAATATTCTAGGAGGTAGAATGG + Intergenic
1012275485 6:97269375-97269397 AAATATTCTTAGAAGTAGAGTGG - Intronic
1012505351 6:99940352-99940374 AAAAATTCTCAACAGCAGAACGG - Intronic
1012828553 6:104178623-104178645 AAATCTTCTTAGAAGTAGATGGG - Intergenic
1014714153 6:124844198-124844220 AAATATCTTCAGTAGCAGAATGG - Intergenic
1015379988 6:132556098-132556120 GAATCTTCTCACTAGGAGAATGG - Intergenic
1015449181 6:133344333-133344355 AAATATTTTCAAAAGGAAAGGGG - Intronic
1015492030 6:133837511-133837533 AAATACACTTAGAAGGGGAACGG + Intergenic
1015507703 6:134006691-134006713 AAACACACTTAGAAGGAGAACGG - Intronic
1016170681 6:141011962-141011984 GAATATTCTCAGAAGAAGTAGGG - Intergenic
1016320678 6:142842075-142842097 AAATATTCTAAGGAATAGAATGG - Intronic
1016446767 6:144141228-144141250 AAGTTTTCTGTGAAGGAGAATGG - Intergenic
1017069962 6:150567121-150567143 AAATGTTTTCAGAAGAAAAAGGG - Intergenic
1017219518 6:151949836-151949858 AAATACTCTCAAGATGAGAAAGG - Intronic
1017484750 6:154892200-154892222 ACATATTCTCAGGAAGAGACAGG + Intronic
1017571943 6:155754500-155754522 AAATATTCCAAGAAAAAGAAGGG + Intergenic
1017579770 6:155850824-155850846 CCATTTGCTCAGAAGGAGAAAGG + Intergenic
1017728465 6:157293181-157293203 ATTTATACTCAGAAGAAGAAAGG - Intronic
1018133960 6:160760415-160760437 CAATATTGGCAGAAGGTGAAGGG + Intergenic
1018679043 6:166248541-166248563 AAATATTCACAAAAGGACAATGG - Intergenic
1018827267 6:167418192-167418214 AAAGACTGTCAAAAGGAGAATGG - Intergenic
1018928576 6:168224080-168224102 TGATAATCTCAGAAGCAGAAGGG + Intergenic
1019065676 6:169294668-169294690 AAATTTTATCAAAAGGTGAATGG - Intergenic
1020971371 7:14945090-14945112 AAATATTCACATCAGAAGAACGG + Intronic
1021682604 7:23149439-23149461 CAATATTCCCAGTAAGAGAAAGG - Intronic
1023296322 7:38718453-38718475 AAGTGTTCTCAGATGCAGAATGG + Intergenic
1023300890 7:38769837-38769859 AAAGATTCTCTGATGGAGATGGG - Intronic
1023349046 7:39301039-39301061 AAAAATCCTGAGAAGAAGAAAGG - Intronic
1023854667 7:44175429-44175451 AAATCATGGCAGAAGGAGAAGGG + Intronic
1024682027 7:51700668-51700690 AAATATAAAGAGAAGGAGAAAGG + Intergenic
1024698846 7:51884836-51884858 AAATACTCTCAAAAAGACAAAGG + Intergenic
1024968790 7:55050047-55050069 AAATATTTTCAAAAAGAGAGAGG - Intronic
1025595301 7:62915971-62915993 AAATATTCTCAGATAGAAACTGG + Intergenic
1026170848 7:67952688-67952710 CAATATTCTTAGAAACAGAAGGG + Intergenic
1026293052 7:69026019-69026041 AAATATTGTCATAAGGAGGTGGG - Intergenic
1027549850 7:79577070-79577092 CAATATACTCATAAGGTGAAAGG + Intergenic
1027979392 7:85197865-85197887 AATTATTCTCAACAGTAGAATGG + Intergenic
1028216250 7:88137268-88137290 ACAATTTCTCAGCAGGAGAATGG - Intronic
1028235414 7:88355300-88355322 AACAATACTCAGAAGGATAAAGG + Intergenic
1028445133 7:90913547-90913569 ATATATTCTTATTAGGAGAAAGG + Intronic
1028481458 7:91310861-91310883 AAATATTCTTCGAAAAAGAATGG - Intergenic
1028574202 7:92328618-92328640 AAATATTCTTAAAAAGATAAAGG + Intronic
1029669714 7:102021140-102021162 ACATTGTCTCCGAAGGAGAAAGG + Intronic
1030380664 7:108807702-108807724 AAAGAGCCTCGGAAGGAGAAAGG + Intergenic
1030778260 7:113563970-113563992 AAATATTCTCAGAAAAAGGATGG - Intergenic
1031480602 7:122274145-122274167 CAATGTTCGCAGAAGGTGAAGGG + Intergenic
1031776889 7:125916991-125917013 AAAGCTTTTCAGTAGGAGAAAGG + Intergenic
1032039200 7:128544689-128544711 AAATAGTCTCAGAATAAGGATGG + Intergenic
1032041036 7:128561910-128561932 AATTATTATCAGCAGGAGACGGG + Intergenic
1032526764 7:132583708-132583730 AAATAGGGCCAGAAGGAGAATGG - Intronic
1032621507 7:133538382-133538404 AAATATTTTAAGAACCAGAAAGG - Intronic
1032788521 7:135221467-135221489 AAAAATTATCACAAAGAGAAGGG + Intergenic
1032887949 7:136162669-136162691 AGAGATTCTCATAAGGAGTAAGG + Intergenic
1034115952 7:148583804-148583826 AAATATTCTCAGAAAGGGCTGGG + Intergenic
1034407481 7:150914811-150914833 TAAATTTCTCAGAAGGAGAAGGG - Intergenic
1035204560 7:157286780-157286802 AAATATTTTAAGAAAGATAAAGG - Intergenic
1035333820 7:158113132-158113154 AAGAATTCCAAGAAGGAGAAGGG + Intronic
1036012166 8:4738393-4738415 AAATGGTGGCAGAAGGAGAAGGG + Intronic
1036573577 8:10003342-10003364 AAAAATTCTCACAAAAAGAAGGG + Intergenic
1037111877 8:15172534-15172556 AAATATTCTGAGACTTAGAATGG - Intronic
1037459987 8:19099280-19099302 ATATACTCTGAGAAGGAAAAAGG - Intergenic
1038079139 8:24112808-24112830 AAATATTCCCAAAAGAATAATGG - Intergenic
1039149597 8:34489419-34489441 AAATCATCCCAGAAAGAGAAAGG + Intergenic
1039314437 8:36356073-36356095 AAATGTTCATTGAAGGAGAAAGG + Intergenic
1039416533 8:37399640-37399662 AAACACTATCAGAAGAAGAAAGG - Intergenic
1039464619 8:37775614-37775636 AACTCTTCTCAGAAGGAAAAGGG + Intronic
1039674746 8:39649814-39649836 GAATTTCCTCACAAGGAGAAAGG - Intronic
1040881043 8:52204871-52204893 AAATATTATCACAAGGATATTGG - Intronic
1041585718 8:59515587-59515609 TTATAATCTCAGAATGAGAAAGG - Intergenic
1042094473 8:65198265-65198287 CAGCATTATCAGAAGGAGAAAGG - Intergenic
1042425279 8:68640787-68640809 AAATTTTCTTTGAAAGAGAACGG - Intronic
1043268193 8:78293376-78293398 AAATATTATTAGAAGTAGAAAGG + Intergenic
1043348236 8:79325346-79325368 ATATATTCTCAGAAACACAATGG - Intergenic
1043784728 8:84384535-84384557 AAAAACTCTCAGAAGTATAATGG - Intronic
1044233224 8:89802842-89802864 GATTATTCTTAGTAGGAGAAGGG - Intergenic
1044287584 8:90427142-90427164 ACATAGTCTCAGAAGGTGACAGG + Intergenic
1044429315 8:92090060-92090082 CAAATTTCTCAGAAGGCGAAGGG - Intronic
1044705395 8:95003696-95003718 GAATGTTTGCAGAAGGAGAAAGG - Intronic
1044985160 8:97750600-97750622 AAAGCTTCTCTGAAGGAAAAAGG + Intergenic
1045082331 8:98640544-98640566 AGATATTTTCATAAGAAGAATGG - Intronic
1045659182 8:104418826-104418848 AAATATTCTCAGCCTAAGAAGGG - Intronic
1045757230 8:105557877-105557899 ACATATTATGAGAAGTAGAAGGG - Intronic
1045999905 8:108407312-108407334 GAGTAATCTCAGAAGGAAAAAGG - Intronic
1046317993 8:112531728-112531750 AAATGTTCTCTGAAGAAGGATGG + Intronic
1046549877 8:115702445-115702467 AAATATTTTCAAGAGGGGAAAGG - Intronic
1046699751 8:117386842-117386864 AAATGTCTTCAGAAGGTGAAAGG - Intergenic
1046870654 8:119202530-119202552 TTAGAGTCTCAGAAGGAGAAGGG - Intronic
1046897983 8:119493853-119493875 AAATATTCTCAGACTGAAATTGG - Intergenic
1046930416 8:119836403-119836425 AAACAGTATAAGAAGGAGAAAGG + Intronic
1046978650 8:120312252-120312274 AACTATTCTTACAAGGAGCATGG - Intronic
1047513115 8:125530537-125530559 AAATGTTCTCAGATGGATCATGG - Intergenic
1047896801 8:129375109-129375131 AAAGATTCTAAGAAGGTGAGAGG - Intergenic
1047946088 8:129882162-129882184 AATTATTTTCAGTAGGAAAAAGG + Intronic
1048697895 8:137048883-137048905 AAATGTCCTCTGAAGTAGAAAGG + Intergenic
1048972110 8:139650939-139650961 AAATATTCTCAGAGTTGGAAGGG - Intronic
1049035602 8:140073587-140073609 AAATGTTCTACGAGGGAGAAGGG + Intronic
1049727575 8:144156303-144156325 AAAAATTCTCAAGAAGAGAAGGG - Intronic
1050842610 9:10171424-10171446 AAATCATGTCAGAAGGTGAAAGG - Intronic
1050863658 9:10469643-10469665 ATATATACTCAGCAGTAGAATGG - Intronic
1050900712 9:10945387-10945409 AAATATGATAAGAAAGAGAAAGG + Intergenic
1050958955 9:11703167-11703189 AATTATTGTCATAAGGACAAAGG + Intergenic
1051542530 9:18235830-18235852 AAAAATTCTCAGCAAGAGGATGG - Intergenic
1052458753 9:28735440-28735462 AAGTATACTTAAAAGGAGAAAGG - Intergenic
1052780815 9:32780940-32780962 AAATATTCTCAGTTGGCAAATGG + Intergenic
1053047139 9:34929128-34929150 AAATATTCAGATAGGGAGAAGGG - Intergenic
1054925745 9:70587265-70587287 AAATACTCAGAGAAGCAGAAAGG + Intronic
1055556341 9:77477426-77477448 CCATATTCTCAGCAGGGGAATGG - Intronic
1055664884 9:78543387-78543409 AAAAAGTCACAGAAGGAAAAAGG - Intergenic
1055727915 9:79251237-79251259 AGATTTCCTGAGAAGGAGAAAGG - Intergenic
1056911590 9:90706100-90706122 AAATAATCACAGGAGGAAAAAGG + Intergenic
1058797784 9:108515382-108515404 AAATATTTTCAGAAGCAGCAGGG + Intergenic
1058797817 9:108515698-108515720 AAATCATGGCAGAAGGAGAAGGG + Intergenic
1058825327 9:108770810-108770832 AAAAATACTCAGAAGAAAAATGG + Intergenic
1059215573 9:112558493-112558515 AAATATTCAAAGAAGTAGAGAGG - Intronic
1059805900 9:117800103-117800125 AAATCTCCTTAGAAGCAGAATGG + Intergenic
1059859516 9:118443339-118443361 AATAATTGTCAGAAGAAGAATGG + Intergenic
1059894788 9:118850503-118850525 AGATATTCTTAGTAGGTGAATGG + Intergenic
1060037338 9:120266941-120266963 AAATATTCTCAGAATGATTGTGG + Intergenic
1060306886 9:122421727-122421749 AAGATTTCTCAGATGGAGAATGG - Intergenic
1060509312 9:124220667-124220689 TAAAATTCTGAGAAGGAGAGCGG - Intergenic
1203526104 Un_GL000213v1:89810-89832 AAATATTTTAAAAAGGGGAAAGG + Intergenic
1185797655 X:2980776-2980798 ACATGGTCTCAGAAGGAGATGGG + Intergenic
1186682285 X:11887743-11887765 AAATATTCTCGGAGAGACAAAGG - Intergenic
1186890728 X:13956933-13956955 AGATTTTATCAGAAGGAAAAAGG + Intergenic
1186983521 X:14985168-14985190 GAATATTTTCAGAAAGAGAGAGG + Intergenic
1187256930 X:17651809-17651831 AAATATGCTCAGAACAATAAGGG + Intronic
1187570855 X:20499916-20499938 CACTATGCTCTGAAGGAGAAGGG + Intergenic
1187666928 X:21623781-21623803 GCATATTGTCAGAAGAAGAAAGG + Intronic
1187754587 X:22508468-22508490 AAATGTGCACAGAAGTAGAATGG - Intergenic
1187845243 X:23529051-23529073 AACTATTCTCAAAGAGAGAAGGG + Intergenic
1188303212 X:28530661-28530683 AAATATTATGAGAAGGTGTAGGG - Intergenic
1189095031 X:38129463-38129485 AAAAATACTCAGAAGTGGAATGG - Intronic
1189835282 X:45014455-45014477 AAAGATGCCCAGAAGGATAAAGG + Intronic
1190100844 X:47521868-47521890 ATATATACTCAGAAGTAAAATGG - Intergenic
1190691679 X:52917942-52917964 AAAGATTCTCATAAAAAGAAGGG - Intergenic
1190694304 X:52937850-52937872 AAAGATTCTCATAAAAAGAAGGG + Intronic
1192373080 X:70531835-70531857 AGATATTCAGAGAAAGAGAAGGG + Intronic
1193140176 X:78018823-78018845 AAATCTTGGCAGAAGGTGAAGGG + Intronic
1193571091 X:83144606-83144628 AAACCATCTCAGAAAGAGAAAGG - Intergenic
1194053541 X:89101929-89101951 AAATATTCTTAAAAGGTGAAGGG - Intergenic
1194362616 X:92972758-92972780 AAATATTGACAGAATGAAAAGGG - Intergenic
1195885818 X:109636341-109636363 AAATCATATCAGAAGGTGAAGGG - Intronic
1196093789 X:111776569-111776591 AGATATTCTCAGATGGAGAAAGG - Exonic
1196164427 X:112522904-112522926 AAACAGACTAAGAAGGAGAAAGG - Intergenic
1197546808 X:127835795-127835817 AAATTTTCAAAGAAAGAGAAAGG + Intergenic
1197627638 X:128820520-128820542 AAATATTCTTACACAGAGAAAGG - Intergenic
1197780643 X:130156343-130156365 AAATTTTTCCAAAAGGAGAAAGG + Intronic
1198177390 X:134170586-134170608 AAATTTTCTTAGATGGAGAGGGG - Intergenic
1198238067 X:134755712-134755734 AAAAAGTCTCAGGAGGAAAATGG - Intronic
1198659678 X:138954523-138954545 AAATATTGTCATAAGGATTATGG + Intronic
1198692758 X:139302293-139302315 AAAGGTTCTCATAAGGAGAAAGG + Intergenic
1198764856 X:140070132-140070154 AAATGTGCTCAGTGGGAGAATGG - Intergenic
1199277298 X:145961498-145961520 AAGTACACTCAGAAGGGGAATGG + Intergenic
1200050244 X:153425512-153425534 AATTATTCTAAGAATGACAAAGG + Intergenic
1200670870 Y:6088978-6089000 AAATATTGACAGAATGAAAAGGG - Intergenic
1200816972 Y:7543375-7543397 TTATATTCTCATAAGGAGCAAGG + Intergenic
1202345374 Y:23917804-23917826 AATTATTTTCTGAAGGAGGAGGG - Intergenic
1202525396 Y:25752285-25752307 AATTATTTTCTGAAGGAGGAGGG + Intergenic