ID: 1091025919

View in Genome Browser
Species Human (GRCh38)
Location 11:132141166-132141188
Sequence AAGAAGCAAAAGTGTCTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 1, 2: 5, 3: 31, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091025919_1091025920 -3 Left 1091025919 11:132141166-132141188 CCAAGCAGACACTTTTGCTTCTT 0: 1
1: 1
2: 5
3: 31
4: 317
Right 1091025920 11:132141186-132141208 CTTTTTTTCTTCCAATTCCCAGG 0: 1
1: 0
2: 6
3: 118
4: 1581

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091025919 Original CRISPR AAGAAGCAAAAGTGTCTGCT TGG (reversed) Intronic
901147160 1:7072987-7073009 AAGAAGCAAGAGTGTAGGCAGGG + Intronic
906013301 1:42550120-42550142 AAGAATCAAAGGTGACTCCTAGG - Intronic
906821232 1:48932272-48932294 AAGAAGGAAAACTGTGTTCTTGG + Intronic
908105381 1:60836342-60836364 AAAAAAAAAAAGAGTCTGCTTGG - Intergenic
909348519 1:74621244-74621266 CAGAGGCAAAAGTTTCTTCTTGG - Intronic
910544372 1:88397642-88397664 AAGAAGCAAAAGAGCTTCCTTGG + Intergenic
911653127 1:100412056-100412078 ATGAGGCCAAAGTCTCTGCTAGG + Intronic
911873030 1:103123443-103123465 AAAAAGCAAATGTGTCGGCAAGG + Intergenic
915353180 1:155239232-155239254 AAAAAAGAAAAGTGTCTGCTGGG + Intronic
915842528 1:159226574-159226596 AGGAAGCCATAGTGTGTGCTGGG + Intergenic
916314967 1:163438805-163438827 AAGATGCAAAAGTGGCTGACAGG + Intergenic
916497121 1:165356228-165356250 CAGAAGCAAAAGAGTCGCCTCGG + Intronic
917213974 1:172659156-172659178 AAGAAGTAAAACCGTTTGCTGGG + Exonic
918493215 1:185105302-185105324 AAGAAACAGAAGTGTCTGTGAGG + Intergenic
919372845 1:196752041-196752063 AAGAAGCAAATGTTTCTCTTTGG + Intergenic
919379289 1:196836723-196836745 AAGAAGCAAATGTTTCTCTTTGG + Intronic
919552506 1:199009072-199009094 ATGAAGCAAATGTGTGTACTAGG + Intergenic
919707706 1:200694053-200694075 AAGAAGCCCAAGTGTAGGCTGGG - Intergenic
920515093 1:206579362-206579384 AAGAGGCAAAACTGTCTGCTTGG + Intronic
921861885 1:220049329-220049351 AAAAAAGAATAGTGTCTGCTAGG + Intergenic
922584625 1:226724241-226724263 CAGAAGCAAGATGGTCTGCTGGG - Intronic
922702183 1:227768260-227768282 AAAAAGCAAAGCTGTCTGTTGGG + Intronic
923960183 1:239072274-239072296 AAAGAACAAAAGTCTCTGCTTGG + Intergenic
1063646444 10:7888236-7888258 AAGAAGCAAAAAAATGTGCTTGG - Intronic
1064134017 10:12735179-12735201 AAGAAACGAAAGTGTCGGCCGGG + Intronic
1065032150 10:21598451-21598473 TAGAAGCCAAAGTGGGTGCTAGG + Intronic
1065054670 10:21832551-21832573 AAGAAGTAAAAATGCCTACTTGG - Intronic
1066425585 10:35304790-35304812 AACAACCAAAAATGTCTCCTGGG + Intronic
1067355220 10:45517903-45517925 AACAAGCATAAGAGACTGCTAGG + Intronic
1070652777 10:78249919-78249941 AAGAACCAAAAATGTCCCCTGGG - Intergenic
1070927701 10:80236515-80236537 AAGAAGGAAGATTGTCTGTTGGG - Intergenic
1072431722 10:95378326-95378348 AAGAAGCAAAACTGTCTTTGAGG - Intronic
1077646591 11:3930828-3930850 GAGATTCAAAACTGTCTGCTCGG - Intronic
1077868931 11:6245284-6245306 AAAAAGAAGAAGTATCTGCTCGG - Intergenic
1078200330 11:9176719-9176741 GAGAAGGAAATGTATCTGCTAGG + Intronic
1080184530 11:29465067-29465089 AAGAAGCACCAGTTTCGGCTGGG - Intergenic
1080554174 11:33401059-33401081 ATGAAGCAATTGTGTCTGATGGG + Intergenic
1082083833 11:48032920-48032942 TAGAAACAAAAGTGTAGGCTGGG + Intronic
1083111846 11:60417915-60417937 AAGAACCAAAAGAGTCAGCAAGG + Intergenic
1084351471 11:68603042-68603064 TAGGAGCACAAGTGTCTGCTGGG + Intronic
1085177681 11:74505207-74505229 AAAAAGAAACAGTGTCTGCCAGG + Intronic
1087299434 11:96414452-96414474 AAAGAACAAGAGTGTCTGCTTGG + Intronic
1087600884 11:100313930-100313952 AAGAGGGAAAAGTGCCTGTTTGG + Intronic
1088582521 11:111329976-111329998 AGGCAGCAACAGTCTCTGCTAGG - Intergenic
1088685132 11:112278884-112278906 AAGAAGCAAAAGTTGCTTCCTGG - Intergenic
1088767494 11:112997911-112997933 TCGAAGCAAAAGTGTCTTCGTGG - Intronic
1089311961 11:117564145-117564167 AAGAGGGAAAAGTGTAAGCTTGG + Intronic
1089622895 11:119732031-119732053 AAGAAGCAAGAGTGACTCCTGGG - Intergenic
1090097579 11:123758028-123758050 AGGCAGCAACAGTGTCTGCAGGG + Intergenic
1090305854 11:125690411-125690433 AAGAGGAAGAACTGTCTGCTTGG + Intergenic
1091025919 11:132141166-132141188 AAGAAGCAAAAGTGTCTGCTTGG - Intronic
1091100029 11:132863478-132863500 AAGAAGCAAAAGTTTCTCGCTGG + Intronic
1091107478 11:132936303-132936325 AAGAAGCATAAAGGTCTTCTAGG + Intronic
1091714238 12:2765716-2765738 CAAAAGCACAAATGTCTGCTTGG + Intergenic
1091979836 12:4855912-4855934 CAGAAGTAAAGGTGGCTGCTCGG + Intergenic
1092341955 12:7684583-7684605 AAAAAGTAAAACTTTCTGCTAGG - Intergenic
1092378844 12:7978420-7978442 AAGAAGCAAAAATTTTGGCTAGG - Intergenic
1092778909 12:11967330-11967352 AGGAAGGAAAAGTGTCTGGGAGG - Intergenic
1095514715 12:42993196-42993218 AAAAAGCAGAAGCGTCTTCTAGG - Intergenic
1095769360 12:45935483-45935505 AAGAAGTAAAAATGTGTGGTAGG + Intronic
1097427062 12:59458987-59459009 AAGAAGCAAAGGGGTTTTCTTGG + Intergenic
1097709041 12:62898325-62898347 ATTAATTAAAAGTGTCTGCTTGG - Intronic
1098483450 12:70993285-70993307 AATAAGCAAAAGTCTAGGCTAGG + Intergenic
1099257248 12:80329238-80329260 ATGAAGCAAAAGTGACTGCTGGG - Intronic
1101584811 12:106076440-106076462 AACAAGCAAAAATGCCAGCTAGG - Intronic
1103479807 12:121243837-121243859 AAGAAACAGAAGTGACTGCCTGG + Intronic
1103780929 12:123398457-123398479 AAGAAGCAAGAGTTTGTGCTGGG + Intronic
1104519316 12:129458255-129458277 AAGGAGCAAAAGTCTCAGCTGGG + Intronic
1105670851 13:22613732-22613754 AAGAAGTGAAATTGTCTGTTTGG - Intergenic
1106538464 13:30668888-30668910 AAGAAGCAAAGGTGGCTGAAAGG + Intergenic
1107736616 13:43405595-43405617 AAGAATCAACAGTGACTCCTAGG - Intronic
1108436079 13:50402905-50402927 ATGAGGCAAAACTGTCAGCTTGG + Intronic
1109044700 13:57394471-57394493 AAGAAGCAAAATTATCTGAGTGG - Intergenic
1110015597 13:70397345-70397367 AAGAGGCAAGAGTGTCTGAAAGG - Intergenic
1110719530 13:78745880-78745902 AAGAAGCAATAATGTTAGCTTGG + Intergenic
1111817237 13:93169267-93169289 AAGAAGCAAAGGTGTCTACCTGG + Intergenic
1112007080 13:95262928-95262950 AAGAAGGCAGAGTGTCAGCTGGG - Intronic
1112161631 13:96874316-96874338 CAGAAGTAAGAGTGTCTGCAAGG + Intergenic
1112407299 13:99132533-99132555 AAGAAGCACAACTGAATGCTTGG + Intergenic
1112649977 13:101385358-101385380 AAGGACCAAAACTGTCTGCTTGG - Intronic
1112777596 13:102862345-102862367 AAGATGTAAAAGTGTGTGCTGGG + Exonic
1112792272 13:103016041-103016063 GAGAAGCAAAAGTATAGGCTAGG + Intergenic
1112975875 13:105316290-105316312 AAGAAACAAAAATGTTTTCTAGG - Intergenic
1113290312 13:108898708-108898730 AATACGAAACAGTGTCTGCTTGG - Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114341563 14:21750759-21750781 AAGAAGCAAAACAGCCTCCTTGG - Intergenic
1114648592 14:24269317-24269339 AGGAAGCTTAAGTGTCTGATGGG - Intronic
1118112085 14:62733119-62733141 AAGAAGCAGCAGATTCTGCTTGG - Intronic
1118152632 14:63206072-63206094 AACCAGCATGAGTGTCTGCTTGG + Intronic
1118203222 14:63696989-63697011 AAGAAAAAAAAGTGTTTGGTAGG + Intronic
1121921115 14:97882548-97882570 AAAGAGCAAAAGTCTCAGCTTGG - Intergenic
1122197417 14:100099195-100099217 AAAAAGAAAAAGTGTGTACTGGG + Intronic
1122225575 14:100275951-100275973 AAGAAGCAAGAGGGTCTCCAAGG - Intronic
1125826200 15:42678542-42678564 AAGCAGCAACAGTGTCTCCCAGG - Intronic
1126200209 15:45976927-45976949 AACAAGCAAGAGTCTTTGCTTGG + Intergenic
1127000999 15:54505140-54505162 AAGATGCAACAGTCCCTGCTAGG + Intronic
1127255530 15:57289201-57289223 AAGAAGCAAAATGTTCTGTTAGG - Intronic
1128975647 15:72151193-72151215 AAGAATCAAACTTGACTGCTAGG - Intergenic
1130367430 15:83253140-83253162 AAGAACCAAATGTGTCTTTTTGG + Intergenic
1130739209 15:86579932-86579954 AAGAAGGAAAACTGTCTTGTGGG + Intronic
1132328987 15:100997882-100997904 AAGAAACCAACATGTCTGCTGGG + Intronic
1132561423 16:596281-596303 AAGAGGCAAAAGTACCTGCGAGG - Intronic
1134302546 16:13004627-13004649 AAAAAGAAACAGGGTCTGCTAGG + Intronic
1134332828 16:13265726-13265748 AAGAAGGAAAAGTGTCTCATTGG - Intergenic
1134847769 16:17455107-17455129 AAGAGGCAAAAGTACCTGGTGGG + Intronic
1135193149 16:20371319-20371341 AAGAAGCAAAAGTGGAAGCAGGG + Intronic
1137811231 16:51354678-51354700 AAGAAGTAAAAGAGACAGCTTGG - Intergenic
1138167451 16:54816345-54816367 AAGAAGCAAAACATTCTCCTGGG - Intergenic
1138774548 16:59705869-59705891 AAGAAGAGAAGGTGTCTGCCAGG + Intergenic
1140996223 16:80262128-80262150 AAGGAGACAAAGTATCTGCTAGG + Intergenic
1141452966 16:84117704-84117726 AAGACACAAAACTGTCTGATCGG - Intergenic
1141650351 16:85389471-85389493 AAAAAAAAAAAGTGGCTGCTAGG + Intergenic
1142726741 17:1820822-1820844 AAGAAAGAAAAGTGTGTGCTTGG + Intronic
1143129846 17:4671323-4671345 CAGAAGCTCAAGTGTCTGCTGGG - Intergenic
1143413702 17:6729263-6729285 AGGAACCATAAGTGCCTGCTTGG - Intergenic
1143415031 17:6740886-6740908 AAGAAGCAAAGATGTCTCCAAGG - Intergenic
1144129879 17:12236142-12236164 AATAAGCAAAAATGTTTACTGGG - Intergenic
1144719600 17:17459381-17459403 AAGATGCAAAAGTGTATGAGTGG + Intergenic
1147499822 17:40952209-40952231 CAGAAGCCACAGTGTCTCCTAGG - Intergenic
1147804677 17:43122533-43122555 TAGAAGATAAAGTGTGTGCTGGG + Intronic
1148044849 17:44737100-44737122 CAGGAGCCAAAGTGTCTGCATGG - Intronic
1148190899 17:45678027-45678049 CAGAAGAAAATGTGTCAGCTGGG - Intergenic
1148409588 17:47453290-47453312 TAGAAGCCAAAGTGGGTGCTAGG - Intergenic
1148644830 17:49213725-49213747 AAACAGGAAAAGTGTCTGCTTGG - Intronic
1149692439 17:58589265-58589287 AAGAAAAAAAAGTGTAGGCTGGG + Intronic
1152254832 17:79232240-79232262 AAGAAAAAAAAATGCCTGCTGGG - Intronic
1153510826 18:5850090-5850112 AAGAAGGAAAAGTCTCTAATGGG - Intergenic
1153928951 18:9861259-9861281 AAGATGCAAAACTCTCAGCTAGG - Exonic
1154018682 18:10643673-10643695 AAGAAACAAAAGTCACTGTTGGG + Intergenic
1154185546 18:12179749-12179771 AAGAAACAAAAGTCACTGTTGGG - Intergenic
1155381792 18:25230860-25230882 AAGATGCAAATGTGTGTGCATGG + Intronic
1156187055 18:34675412-34675434 AAGTAGCTAAAATTTCTGCTTGG + Intronic
1157264673 18:46207950-46207972 AAGAAGCAAGAGTGTATGCAAGG - Intronic
1157933185 18:51845543-51845565 AAGAAGCGAAAGTATGAGCTGGG - Intergenic
1157981217 18:52382861-52382883 TAGAAGTAAAAGTGACTGATAGG - Intronic
1159021059 18:63143551-63143573 AAGCTGCAAAAGTGTCTGACCGG - Intronic
1159589641 18:70319767-70319789 AAGAAGGAAGAGTGTCTCCAGGG + Intronic
1159668425 18:71193216-71193238 AAGAAGCAACATTTCCTGCTTGG + Intergenic
1163812959 19:19445598-19445620 AAGTAGAATAAGTGGCTGCTGGG - Intronic
1164818665 19:31226926-31226948 AAAAAGAAAAAGTATCTGCAAGG - Intergenic
1165005108 19:32798503-32798525 AAGGAGGAAAAGTGTCTGGTTGG + Intronic
1165679443 19:37761360-37761382 CAGAAGCAAAAGTTTTTTCTCGG + Intronic
924972860 2:145907-145929 AAGAAGTAAAAGTGTCTGCTTGG - Intergenic
928035814 2:27822089-27822111 AAGAAGAAGAAGAGTCTGCTGGG + Intronic
928111782 2:28516566-28516588 AAAAAGCAAAAGTGTTATCTGGG - Intronic
931206369 2:60149434-60149456 ACAAAGCAAAAGTGTGTGTTTGG + Intergenic
932261300 2:70330033-70330055 AAGATTCAAAAGTGCCGGCTGGG + Intergenic
933097993 2:78211580-78211602 AAAAAGCAATAGTCTCTGCCTGG + Intergenic
933177176 2:79188405-79188427 AAGAGGCAGAAGTGTCACCTGGG + Intronic
935391947 2:102562129-102562151 AAGAAGCAGAAATGTGAGCTTGG + Intergenic
935493980 2:103755162-103755184 AAGAAGCTAAACTGTAGGCTAGG + Intergenic
935782097 2:106517392-106517414 AAGAAACAAAAATGTCAGCAGGG - Intergenic
936646151 2:114375292-114375314 AAGAAGTAACAGTGTTGGCTGGG - Intergenic
936934019 2:117820449-117820471 GAGAACCAAAAATGTCTCCTAGG - Intronic
937742749 2:125375602-125375624 AAGAAGCAGCAAAGTCTGCTTGG - Intergenic
937975800 2:127581534-127581556 AAGGAGCAAGAGAGTGTGCTGGG - Intronic
939761363 2:146185035-146185057 AAAAAGCAAAAGTTTGTGCTCGG - Intergenic
940261537 2:151785091-151785113 ATGAAGCAAGGCTGTCTGCTGGG + Intergenic
941181658 2:162266470-162266492 AAGAAGCAAATATCTGTGCTGGG + Intergenic
941387305 2:164869077-164869099 AGGTAGGAAATGTGTCTGCTTGG + Intergenic
941559622 2:167028395-167028417 AGAGAGCAAAAGTGTCTGCCTGG + Intronic
942029993 2:171949895-171949917 AAGACTCAAAAGTGTCTGAAAGG - Intronic
942377931 2:175356045-175356067 AAGAAGCAAATGTGCCTCCTGGG - Intergenic
943135061 2:183899678-183899700 AGGAAGCAAAATTGTCTCATAGG + Intergenic
945038562 2:205725487-205725509 AAGAAGCAAAAGTGCCTCCTGGG + Intronic
945369555 2:209000058-209000080 AAGAAGTAAATGTGCCTGGTGGG + Intergenic
946067272 2:216998749-216998771 AAGAAGAAAAAGTGGCTTCATGG - Intergenic
946077683 2:217088661-217088683 AAGAAGGAAAATTTCCTGCTTGG - Intergenic
947507827 2:230723555-230723577 AAGGAGCAAAAGGGTCTGGGAGG - Intronic
948937794 2:241179109-241179131 AAAAACCAAAAGAGTCTGCCAGG + Intronic
1170138622 20:13103009-13103031 AAGAAGCAAAGGGATCTTCTTGG - Intronic
1170612122 20:17923298-17923320 AAAAAGGAAAAGGGTCTTCTGGG + Intergenic
1172885540 20:38228414-38228436 AGGAAGCAAAAGGCTCTGCCTGG - Intronic
1173451216 20:43165679-43165701 TAGAAGCAACAGTTTCGGCTTGG + Intronic
1173623602 20:44455259-44455281 AAAAAACAAAAGTGTCTCCTTGG + Intronic
1174822858 20:53742530-53742552 AAAAACCAAAAGTATATGCTAGG + Intergenic
1175202700 20:57289168-57289190 AAACAGCAAAGGTGTCAGCTTGG - Intergenic
1176886887 21:14267372-14267394 AAGAATCAAAAGTGGCTGTGAGG - Intergenic
1177134410 21:17293603-17293625 AAGAAGCAAAACTGTCTTCAAGG + Intergenic
1178081544 21:29071758-29071780 AAGAAGCAAGAGTGTAAGCCAGG - Intronic
1178832368 21:36067023-36067045 AAGAATCATAAATGTCTGATGGG - Intronic
1180245971 21:46547538-46547560 AAGAAGCAAAATTCTCTTCCTGG - Intronic
1181901764 22:26161766-26161788 AAGAAGAAAACGTCTGTGCTTGG + Intergenic
950202912 3:11057502-11057524 AAGGGGCTAAAGGGTCTGCTGGG + Intergenic
953061455 3:39431436-39431458 AAGAAAAAAAAATGTCAGCTAGG - Intergenic
954582771 3:51712009-51712031 AAGAAGGAAAAGTTTCCCCTAGG - Intronic
954990490 3:54836807-54836829 AAGAAACATAAGTGTCTGGGAGG + Intronic
955262225 3:57404418-57404440 AAGAAACAAAAGTTTCGGCCAGG + Intronic
957475655 3:80720010-80720032 AAGAAGAAGAAATGTGTGCTAGG + Intergenic
957785990 3:84884228-84884250 AAAAAGAAAAAGTGTCTGTGAGG - Intergenic
958745157 3:98125393-98125415 AAGAAGCAAAATTTTCTAGTGGG + Intergenic
959746768 3:109784379-109784401 AGGAAGCAAAAGTATGAGCTGGG + Intergenic
960449897 3:117793798-117793820 AAGAAGCAAAAGTGCCTTCATGG + Intergenic
960525758 3:118707909-118707931 AAGAAAAAAAAATGTCTCCTGGG + Intergenic
960922479 3:122761472-122761494 AAAAAGCAAAACTGTCAGCCAGG + Intronic
960926241 3:122797206-122797228 AAGAAGCAAAATAGTTTGATAGG + Intronic
962275283 3:134008665-134008687 GAGAAGCAAATGTATCTGATTGG - Intronic
965034345 3:163417764-163417786 AATAAGAAAAATTATCTGCTAGG + Intergenic
966491204 3:180530194-180530216 AAGAAACAAGACTGTCTGCCCGG + Intergenic
966495837 3:180579453-180579475 AAGAAGCAAAAGTTTTTATTGGG + Intergenic
967433584 3:189418269-189418291 AGGAAGAAAAAGTGGCTTCTGGG + Intergenic
967531802 3:190556315-190556337 AATAAGCTAAAGTTTTTGCTTGG - Intronic
967946320 3:194806950-194806972 AAGAAGAAAGAGAGTCTGCCTGG - Intergenic
967990851 3:195129432-195129454 AAGAGGCAAAAATGGTTGCTTGG - Intronic
968276665 3:197445623-197445645 AAGAAGGAACAGGGCCTGCTGGG - Intergenic
968735080 4:2291097-2291119 AAGCAGCAAAAGCGCCTGCAAGG - Intronic
969271010 4:6101911-6101933 AAAAAAAAAAAGAGTCTGCTGGG + Intronic
970210474 4:13704684-13704706 AAGCAGAAAAAGTTCCTGCTGGG + Intergenic
971058286 4:22938155-22938177 AAGAAGCATAAATTTCTACTAGG - Intergenic
971690449 4:29827477-29827499 AAAAAGCAAGAGTCTCTGTTTGG + Intergenic
972666146 4:41167067-41167089 AAGAAACATAAGTGTCTTCCTGG - Intronic
972697583 4:41463267-41463289 AAAAAGAAAAAGTGACTCCTAGG - Intronic
973763351 4:54140608-54140630 AAAAAATAAAAGTGTCTGCCTGG + Intronic
973850278 4:54955083-54955105 AAGAAGTCAAAGTGGCTCCTGGG + Intergenic
975508988 4:75171509-75171531 ACTAAGCAAATGTGACTGCTTGG + Intergenic
975594347 4:76033834-76033856 AAAAAGTAAAAGTGATTGCTAGG + Exonic
976761841 4:88557759-88557781 AAGAACTAAAAGTGGATGCTGGG + Intronic
978031036 4:103939908-103939930 AGGAAGCAAGAGTCTCTGCCTGG + Intergenic
979855260 4:125624278-125624300 AAGGAGCAATGGTTTCTGCTAGG + Intergenic
982817592 4:159905739-159905761 AGGAAGCAATAATGTCTGCTAGG + Intergenic
984182829 4:176506498-176506520 AACAAACAAAACTGTCTTCTTGG - Intergenic
984902323 4:184596287-184596309 AACAAGCCAAAGCGTGTGCTAGG - Intergenic
985508272 5:297310-297332 AAGAAGCATAAGTTTCTGCTAGG - Intronic
985739768 5:1608360-1608382 AAGAAGCATAAGTTTCTGTTAGG + Intergenic
985804911 5:2036055-2036077 AAGAAGATATAGTATCTGCTGGG - Intergenic
987106478 5:14644829-14644851 AGGAAGCACCAGGGTCTGCTGGG + Intergenic
987632604 5:20494335-20494357 AAGAAGCAGTAATGTCTGCAGGG + Intronic
990876589 5:60493514-60493536 AAGAAAGAACAGAGTCTGCTTGG + Intronic
991459173 5:66838737-66838759 AGGAAGCAACAGTGTGTGCAAGG + Intronic
992972180 5:82072687-82072709 AAGGACCAAAAGTGTCTTATTGG + Intronic
993235946 5:85310221-85310243 AAGAAGTGAGAGTGTCTGATGGG - Intergenic
993461185 5:88184173-88184195 AAGAATCAAAACTGCCTCCTTGG + Intergenic
993762701 5:91815987-91816009 AAGATGCAGAAGTGGCTACTAGG + Intergenic
994283018 5:97928596-97928618 AAGAAGTATATTTGTCTGCTAGG + Intergenic
994385028 5:99121051-99121073 AAGAGACAAAAGTGTCTGGTTGG + Intergenic
994531046 5:100971510-100971532 AAGAAAACAAAGTATCTGCTTGG + Intergenic
995060948 5:107811354-107811376 AAGCAGCAAAACAGTTTGCTGGG + Intergenic
995492306 5:112706373-112706395 AACAAGAAGAAGTGTCTTCTAGG + Intergenic
996915727 5:128710239-128710261 AAAATGCAAAATTGTCTTCTTGG - Intronic
998195070 5:140061639-140061661 AAAAAAAAAAAGTGCCTGCTAGG + Intergenic
998799486 5:145854910-145854932 AAGAAGAATAAGGGTCAGCTGGG + Intergenic
998811663 5:145972643-145972665 AGGAAGAGCAAGTGTCTGCTGGG + Intronic
999122872 5:149223376-149223398 GAGAAACAAAATTGCCTGCTGGG + Intronic
999837149 5:155386509-155386531 GAGAGGCAGAAGTGTGTGCTAGG - Intergenic
1001666197 5:173435503-173435525 AGGAAACAAAAGAGTCTGATTGG - Intergenic
1003609522 6:7597439-7597461 AAGAAATAAAAGTAGCTGCTTGG + Intronic
1004854680 6:19737059-19737081 AATAAGCAAAAGTTTCAGGTAGG - Intergenic
1005560822 6:27039220-27039242 AAGAAGCAGATGTTTCTGGTTGG + Intergenic
1006175512 6:32119053-32119075 AAGAAGAAAGAGTATCTGCAGGG - Exonic
1006426186 6:33964313-33964335 AAGAAGCGATCTTGTCTGCTGGG - Intergenic
1006540746 6:34737758-34737780 AAGAAAAAAAAGTTTATGCTGGG + Intergenic
1007829821 6:44629664-44629686 TAGAAGGAACAGGGTCTGCTGGG + Intergenic
1007850063 6:44794131-44794153 TGGAAGCAAAAGAGTCTGCTGGG - Intergenic
1008009708 6:46453049-46453071 AAGACACATAAGGGTCTGCTGGG - Intronic
1009371283 6:62906072-62906094 AAAAAACAAAGGTCTCTGCTTGG + Intergenic
1009521129 6:64683065-64683087 CAGCAGCTAAAGTCTCTGCTGGG - Intronic
1010693901 6:78945885-78945907 CAAAAACAACAGTGTCTGCTAGG + Intronic
1011103387 6:83749721-83749743 ACAAAGCAAGAGTGTCTCCTAGG + Intergenic
1011472879 6:87725463-87725485 AAACATAAAAAGTGTCTGCTAGG - Intergenic
1012264186 6:97120859-97120881 AAAAAGAAAAAGTAACTGCTGGG - Intronic
1013465980 6:110417487-110417509 ATGCAGCTGAAGTGTCTGCTAGG - Intergenic
1013562482 6:111319472-111319494 AAAAAAAAAAAGTTTCTGCTAGG + Intronic
1014216708 6:118758801-118758823 AGGAGGGAAAAGTGTCTGCCAGG - Intergenic
1014335025 6:120122643-120122665 AAGAGGCCAAAGTGTCCCCTGGG + Intergenic
1017507052 6:155078364-155078386 AAAAAGCACAAGTGACAGCTTGG + Intronic
1018673614 6:166200014-166200036 AAGCATCATAAGTGTCAGCTGGG - Intergenic
1020879349 7:13739456-13739478 AAGAAGAAGAAATGACTGCTGGG - Intergenic
1022607465 7:31829715-31829737 AAGAAGCCATTGTGTCCGCTGGG - Intronic
1023177566 7:37448536-37448558 AGGAAACAAAAGTGTCTCCGCGG + Intronic
1024909443 7:54428471-54428493 AAGAATCAAAAGCATCTCCTTGG + Intergenic
1026072508 7:67134629-67134651 AAGCAGAAAAAGTTTCTGCTAGG + Intronic
1026704389 7:72677614-72677636 AAGCAGAAAAAGTTTCTGCTAGG - Intronic
1027569007 7:79838819-79838841 AAGAAACCAAAGTCACTGCTTGG + Intergenic
1027729109 7:81847057-81847079 GAGAAGCAAAAGTTTGTACTAGG - Intergenic
1027775536 7:82459993-82460015 AAGAAGAAGAATTGTCTTCTTGG + Intergenic
1028103575 7:86850724-86850746 AAGAAGTCAAAGTTTCTGTTTGG + Intronic
1028284554 7:88980623-88980645 AAGAAACAAAAGTCTCTGCCTGG - Intronic
1028380861 7:90196958-90196980 AAGATGCAAAGTTGTCTGCTGGG - Intronic
1028453125 7:91008011-91008033 AAGAAGCAGAAGTCTTTTCTGGG - Intronic
1029272957 7:99387903-99387925 AAAAAAAAAAAGTGCCTGCTGGG + Intronic
1030623694 7:111819956-111819978 AGGAAGAAAAAGTTTCCGCTTGG - Intronic
1031025673 7:116677083-116677105 AAGAAGGAAAATTGTCTGAATGG - Intronic
1031176954 7:118364450-118364472 AAGAAGGAAAAGTAAGTGCTTGG + Intergenic
1031322748 7:120353484-120353506 AAAAAGCAATAGTGACTCCTAGG + Intronic
1031820931 7:126500429-126500451 CAGAAGCAAAAGTTGCTGTTGGG - Intronic
1032528818 7:132603208-132603230 AAGAAGCAACATAGACTGCTGGG + Intronic
1033151014 7:138915148-138915170 ATGAAGAGAAAGTGTCTTCTGGG - Intronic
1033238373 7:139656443-139656465 AAGAAGAAAAAGTGACTGTGAGG - Intronic
1033273575 7:139954774-139954796 CAGAAGGAAAAGTGTCTGGCAGG - Intronic
1034398193 7:150843202-150843224 AAGAAAAAAGAGTCTCTGCTTGG + Intronic
1034574464 7:151985330-151985352 GAGAAGCAGAGGTGTCTGGTTGG - Intronic
1034614353 7:152402124-152402146 AACAAACAAAAGTTACTGCTTGG + Intronic
1037141497 8:15525807-15525829 CAGGTGCAAAAGTGTGTGCTGGG + Intronic
1037381796 8:18293034-18293056 GAGATGAAAAAGTGTTTGCTTGG + Intergenic
1037612567 8:20488742-20488764 AAGAGGAAAAAGTGTAAGCTTGG - Intergenic
1037763439 8:21757062-21757084 AAGAAGCCAGAGTGTCCCCTAGG - Intronic
1038112314 8:24513272-24513294 AGGATCCCAAAGTGTCTGCTAGG - Intronic
1038478062 8:27882744-27882766 AAGAAGGAAAAATCTCTGCTGGG + Intronic
1039786934 8:40842137-40842159 AAGAAGCAAGTGTGGCTCCTGGG + Intronic
1040719259 8:50297408-50297430 AAGAAAAAAAATTGTGTGCTGGG - Intronic
1041744934 8:61198371-61198393 AAGAAGAAAAAGTATCTATTGGG - Intronic
1042688654 8:71470969-71470991 AATAAACATAAATGTCTGCTGGG - Intronic
1044813642 8:96088919-96088941 AAGAAAGAAAAGTGTTTCCTTGG - Intergenic
1046492722 8:114973738-114973760 ATAAAGCAAAGGTGTCTCCTTGG + Intergenic
1046815487 8:118578730-118578752 AGGAAACAACAGTGGCTGCTGGG - Intronic
1046830683 8:118742516-118742538 AAGAGGCAAAAGTGGATGCTGGG + Intergenic
1047695769 8:127402141-127402163 AAGATGCACTAGTGTCTTCTGGG - Intergenic
1047886093 8:129251551-129251573 AAGAAGGGAAAGTGTCTGTAAGG - Intergenic
1048010846 8:130454814-130454836 GAGAAGCAAAAGAGGTTGCTAGG + Intergenic
1048612807 8:136042071-136042093 CACAAGGAAAAGTGTGTGCTTGG + Intergenic
1048913461 8:139159057-139159079 AAATAGCAAGACTGTCTGCTTGG + Intergenic
1049617982 8:143584404-143584426 AAGAAAAAAAAATGTCAGCTGGG + Intronic
1050596142 9:7206291-7206313 AAAAAGCAAAAGTTCCTACTTGG - Intergenic
1052029325 9:23610536-23610558 AAGAAGCTTAAGTTTGTGCTGGG - Intergenic
1053346652 9:37383238-37383260 AAGAAGAAAGAGTGGCTGCTTGG - Intergenic
1055672354 9:78620092-78620114 AAAAAGAATAAATGTCTGCTCGG - Intergenic
1056342327 9:85648844-85648866 AAGTAGGAAAAATGACTGCTTGG + Intronic
1056474339 9:86939039-86939061 AAGAGGCCAAAATGACTGCTGGG - Intergenic
1056607726 9:88100307-88100329 AATATGGAAAAGTATCTGCTAGG - Intergenic
1056607744 9:88100542-88100564 AATATGGAAAAGTATCTGCTAGG - Intergenic
1056798127 9:89673335-89673357 AAAAAGCACAAGATTCTGCTGGG + Intergenic
1059101743 9:111478576-111478598 GAGAAGCAAAATTGACTGTTAGG - Intronic
1060147163 9:121262997-121263019 AAGGAGAAAATGTGTTTGCTTGG - Intronic
1061337372 9:129949237-129949259 AAGAAGAAAAAGAGACTGCATGG + Intronic
1061480276 9:130894606-130894628 AAGAAGCATACATATCTGCTAGG + Intergenic
1061688035 9:132299845-132299867 AAGAAGGACAAGTCTCGGCTGGG + Intronic
1062407669 9:136404541-136404563 AAGAGGCGAAAGACTCTGCTGGG - Intronic
1185951142 X:4435625-4435647 AAGAAGTAAAAGTTTCATCTTGG + Intergenic
1185987377 X:4850495-4850517 AACAAACAAAAGTGAATGCTTGG - Intergenic
1185989735 X:4880156-4880178 AATAAGCAAAACTGTATGCCAGG - Intergenic
1186298836 X:8177189-8177211 AATAAGTAAAAGTGGCTGCCAGG - Intergenic
1186609328 X:11123700-11123722 TAGATGAAAAAGTGGCTGCTTGG - Intergenic
1188055555 X:25536857-25536879 AAGAGGCAAAAATGCATGCTAGG - Intergenic
1188469886 X:30526429-30526451 TAGAGGAAAAAGTGTCTTCTAGG - Intergenic
1188631400 X:32366341-32366363 AAGGAGAAAAAGGGTCTGTTGGG - Intronic
1188854143 X:35171588-35171610 AAAAAACAAAAGTCTCTGCCTGG - Intergenic
1189382404 X:40511300-40511322 AAGAGGTAAATGTGTCTGCCTGG + Intergenic
1189529279 X:41862556-41862578 AAAAAAAAAAAGTGTGTGCTGGG + Intronic
1189612456 X:42751937-42751959 AGGAAGAAAAAGAATCTGCTAGG + Intergenic
1193504868 X:82329945-82329967 AAGGAAAAAAAGTCTCTGCTTGG - Intergenic
1193933408 X:87584047-87584069 AAGGAACAAAAGTCTCTGCCTGG + Intronic
1193980788 X:88180031-88180053 GAGAAGAAAAAGTCTCTGCCTGG - Intergenic
1194193839 X:90868608-90868630 TAGAAGGAAAATTTTCTGCTGGG - Intergenic
1194496152 X:94620142-94620164 AAGAAGCAAAAGTGGAGGCCGGG + Intergenic
1195356417 X:104043971-104043993 AAGATGGAAAAGATTCTGCTTGG + Intergenic
1195468424 X:105207235-105207257 AAAAAGCAAAAGTGAATGATAGG + Intronic
1196072416 X:111540608-111540630 AAGAAAAAAAAAAGTCTGCTGGG - Intergenic
1196096750 X:111808605-111808627 AAGGACCAAAAGAGACTGCTTGG + Intronic
1196261751 X:113591034-113591056 AATAAGCAAAATTTTCTCCTTGG - Intergenic
1197833548 X:130671182-130671204 CAGAAGCAAAAGTCTATGTTGGG - Intronic
1198155535 X:133956420-133956442 AAGAAGGGAAAGAGTCTCCTTGG + Intronic
1198196114 X:134364346-134364368 AAGAAGCAAAATTGCAAGCTGGG + Intergenic
1200397024 X:155997115-155997137 AAAAAGCAAAAGTGTCTGCATGG + Intergenic
1201439580 Y:13993462-13993484 AATAAGTAAAAGTGGCTGCCAGG - Intergenic
1201444993 Y:14049246-14049268 AATAAGTAAAAGTGGCTGCCAGG + Intergenic