ID: 1091026867

View in Genome Browser
Species Human (GRCh38)
Location 11:132149296-132149318
Sequence AGCTTCTGCTAGGGGAATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091026867_1091026873 20 Left 1091026867 11:132149296-132149318 CCCTAATTCCCCTAGCAGAAGCT 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1091026873 11:132149339-132149361 GCTATTCAGCCCTGAGCTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091026867 Original CRISPR AGCTTCTGCTAGGGGAATTA GGG (reversed) Intronic
907257445 1:53190612-53190634 AGCTTCCGCCACGGGAATTCAGG + Intergenic
908572702 1:65425938-65425960 AGCTACTGTTATGGGAACTAGGG + Intronic
913728806 1:121686541-121686563 AGCATCTGCAAGGGGACTTTTGG - Intergenic
913789088 1:122495068-122495090 AGCATCTGCTAGGGGACATTTGG + Intergenic
914756541 1:150564985-150565007 TGCTTCTCCTAGGGAATTTAAGG + Intergenic
921530626 1:216278116-216278138 TGCTTCTGCTAGTGCTATTATGG + Intronic
922082612 1:222311566-222311588 GGCTTCAGCTTGGGGAATTAAGG + Intergenic
1065022089 10:21509529-21509551 TGCATCTGCAAGGGGAATGATGG - Intergenic
1066299128 10:34081424-34081446 TTCTTCTTCTAGGGGAATTTTGG - Intergenic
1067750668 10:48969216-48969238 AGCTGCTGCTTGGGGAGCTACGG + Exonic
1067930335 10:50554562-50554584 AGCTGCTGCTAGAGGGAGTATGG + Intronic
1069151870 10:64972376-64972398 AGCTTTTGTTAGGAGAATTATGG - Intergenic
1071222368 10:83483914-83483936 AGCTTGTGCTATTGTAATTATGG - Intergenic
1072683257 10:97521720-97521742 AGCTGCTGCTGGGGGAAATCTGG - Intronic
1073553451 10:104425486-104425508 AGCTGCGGCTATGGGAGTTACGG - Intronic
1089617229 11:119701771-119701793 AGCTGCTGCTAGGGAAATGGAGG + Intronic
1091026867 11:132149296-132149318 AGCTTCTGCTAGGGGAATTAGGG - Intronic
1092112265 12:5971992-5972014 AGCTGCTGCTAAGGGAACTCTGG - Intronic
1094244029 12:28266449-28266471 AGCTTTTACTAGGTGAATTATGG + Intronic
1108398774 13:50017533-50017555 AGCTTCTGATTTTGGAATTATGG - Intronic
1108496199 13:51027742-51027764 ACCTTCTAATAGTGGAATTAAGG - Intergenic
1110162125 13:72390974-72390996 AACTTCTGCTAGGTAGATTAAGG + Intergenic
1117938128 14:60930525-60930547 AGCTTTTGAAAGAGGAATTATGG - Intronic
1121924876 14:97918366-97918388 AGCTCCTGCTGGGGGACTCATGG - Intergenic
1123062808 14:105601890-105601912 AGCTTCTGGTGGGGGAATGGGGG - Intergenic
1125982025 15:44011086-44011108 TGCTTCTGCTTGGTGGATTAAGG + Intronic
1128737473 15:70061385-70061407 ACCTTCTGCTAGGGGAGCTTGGG - Intronic
1130108186 15:80944651-80944673 AGCATCTGATGGGGGAATGAGGG - Intronic
1132849125 16:2016606-2016628 AGCTTCTGCAGGGGGAACTGTGG - Intronic
1133388066 16:5386701-5386723 AACTCCTGCTGGGGGAATCAAGG - Intergenic
1150603813 17:66674567-66674589 AGCATCTGCTAGGGGAATGTGGG + Intronic
1155158954 18:23180383-23180405 AGATGCTGCTAGGGAAATGAAGG + Intronic
1156376515 18:36519624-36519646 AGCTCCTGCCAGGGGAAGCAAGG + Intronic
1157575895 18:48742796-48742818 TGCTTCTGCCAGGGGTATTGGGG + Intronic
1157955629 18:52094462-52094484 ATTTTCTTCTAGGGGATTTATGG + Intergenic
1158166966 18:54551063-54551085 AGGTTTTCCTATGGGAATTAGGG - Intergenic
1159914651 18:74177635-74177657 AGCCTCTGTAAGGGGCATTAAGG - Intergenic
1164604397 19:29586948-29586970 AGCTTCTAGTAGAGGAATGATGG + Intergenic
1166840456 19:45693725-45693747 AGCTTTTGGTGGGGGCATTAAGG - Intronic
925363912 2:3298136-3298158 AGCATCTGTTAAGGGAATGAAGG - Intronic
926244485 2:11113093-11113115 CGCTGCTGCTAGGGGAATGCTGG + Intergenic
929725386 2:44420801-44420823 AGCTTCTGCTAGTGGAATATAGG - Intronic
932660122 2:73644348-73644370 GGCTTCTGGTAGGGGCATTCAGG + Intergenic
932666689 2:73704029-73704051 GGCTTCTGGTAGGGGCATTCAGG + Intergenic
932936768 2:76112621-76112643 GGCCTCTGCTAGGAAAATTAGGG + Intergenic
936094973 2:109524400-109524422 AGCTCCTGCTAGGGATCTTAGGG + Intergenic
1168993505 20:2114810-2114832 AACTTCTGGTGGGGGAATAAAGG - Intronic
1169564688 20:6841219-6841241 AGCTCCTGCTAAGGAATTTAAGG - Intergenic
1170784102 20:19452710-19452732 AGCTTCAGCAAGGTGATTTATGG + Intronic
1170808701 20:19656406-19656428 TGCTTCTGTTAGGAGATTTAAGG + Intronic
1173056503 20:39618688-39618710 AACTTTTGCTAGGGGAGTGAGGG - Intergenic
1175920823 20:62449956-62449978 AGCTTCTGCTGAGAGAATTAGGG + Intergenic
1176332486 21:5560883-5560905 AGCTCCTGCTGGGGGATTTGGGG - Intergenic
1176395271 21:6260068-6260090 AGCTCCTGCTGGGGGATTTGGGG + Intergenic
1176441886 21:6729036-6729058 AGCTCCTGCTGGGGGATTTGGGG - Intergenic
1176466148 21:7056105-7056127 AGCTCCTGCTGGGGGATTTGGGG - Intronic
1176489709 21:7437883-7437905 AGCTCCTGCTGGGGGATTTGGGG - Intergenic
1177000370 21:15605129-15605151 ATCTTCTCCTAGGGGAATGTAGG - Intergenic
1178205080 21:30455711-30455733 AGCTTCTGGTGAGGGAATCAGGG + Intergenic
1179977464 21:44876816-44876838 AGTGTCTTCTAGGGCAATTAGGG - Intergenic
1182221843 22:28764887-28764909 ACTTGTTGCTAGGGGAATTATGG - Intergenic
1182325810 22:29511904-29511926 ACCTTCTGTTTTGGGAATTAAGG + Intronic
1182866388 22:33607942-33607964 AGCTTCTTATAGGGCATTTAGGG - Intronic
1183771480 22:39929900-39929922 AGTTCCTGCTGGGGGCATTAGGG - Intronic
953583985 3:44183171-44183193 AGATTCTGCTGTGGGAGTTAAGG + Intergenic
954552884 3:51496890-51496912 AGCATCTGCTAGGGTATTTAGGG + Intronic
954981643 3:54751233-54751255 AGCTCCTGCAAGGGGATTTCTGG - Intronic
955184042 3:56698192-56698214 AGCATCTTCTAAAGGAATTATGG - Intergenic
955191043 3:56761877-56761899 ATCTTATCCTAGGGCAATTAGGG - Intronic
957728042 3:84093943-84093965 TGCTTGTGCTAGGGGTAATATGG + Intergenic
958850755 3:99322456-99322478 ATCTTCTGCTAGGGAAAGGAAGG + Intergenic
959068656 3:101682419-101682441 GGCTGCTGCTAAGGTAATTATGG - Exonic
962373571 3:134841090-134841112 AGCTTCTCCTGGTGGAATAAGGG - Intronic
964667981 3:159194709-159194731 ATCTTCTGCCATGGCAATTATGG + Intronic
973277813 4:48327852-48327874 ACATTCTGCAAGGGGAATCAGGG + Intergenic
974092295 4:57323747-57323769 ACTTTCTTCTAGGGGATTTAAGG - Intergenic
977549052 4:98421240-98421262 AGCTTCTGCTATAGGAAAGAAGG - Exonic
980897919 4:138877349-138877371 ATCTTCTTCAAGGGGGATTATGG + Intergenic
987009680 5:13749474-13749496 AACCTCTGCTACAGGAATTAAGG + Intronic
987987986 5:25174859-25174881 AGCATATGGTAGAGGAATTAAGG - Intergenic
988916663 5:35901203-35901225 AGATTCTGGGAGGGGAATTTGGG + Intergenic
991604171 5:68383747-68383769 AGCCTCTGCATGGGAAATTATGG - Intergenic
993013899 5:82513935-82513957 AGCTGCTGCTATGGCAACTAGGG - Intergenic
993700916 5:91118246-91118268 AGCTTATGATAGGAGAATAAAGG + Intronic
995637134 5:114206390-114206412 AGCTTCTGCTGGAGGAATTTGGG - Intergenic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
1001187246 5:169586265-169586287 TGCTGCTGCTAAGGCAATTAAGG - Intronic
1003017407 6:2479033-2479055 GGCTTCTGCTGAGGGAAGTAGGG + Intergenic
1003992559 6:11500196-11500218 AGCTTCTGCCAGGGAAACTCAGG + Intergenic
1004744693 6:18498317-18498339 AGCTTCTGGTAGGGGAAGGAAGG - Intergenic
1011421769 6:87180898-87180920 ACCTCCTGCAAGGGGAATCAGGG - Intronic
1011751631 6:90460432-90460454 ATCTTCCACTAGGGGATTTAGGG - Intergenic
1012379881 6:98608107-98608129 AGCTTTTGCTAGTGAGATTAGGG - Intergenic
1012467242 6:99529695-99529717 AGCATCTGGTAAGTGAATTATGG - Intergenic
1012707376 6:102548743-102548765 AGCTTCTGCTAAGGGCAACAGGG + Intergenic
1012763512 6:103333004-103333026 AGGTCCTGCGAGGGGAATAAAGG + Intergenic
1012854265 6:104482980-104483002 AGCTTCTGCAAAAGGAATTTTGG - Intergenic
1013844283 6:114430761-114430783 AGTTTCTGCTATGGGAATACTGG + Intergenic
1015428719 6:133104031-133104053 AGCTACAGCAAGTGGAATTATGG - Intergenic
1016873680 6:148843259-148843281 ATGTTCTGCTAGGGGACTTTTGG + Intronic
1020975109 7:14996306-14996328 AGCATCAGATAGGGCAATTAGGG - Intergenic
1021965486 7:25914403-25914425 AGCTTCTGTTAGGGCATTCAAGG - Intergenic
1024186755 7:46957104-46957126 TGCTTATGTTAGGGGAATGAGGG + Intergenic
1028320478 7:89453433-89453455 AACTTCAGGTAGCGGAATTAGGG - Intergenic
1028427792 7:90709746-90709768 AGCTTCTCTTAGGGGATTTCTGG + Intronic
1028716750 7:93979720-93979742 AGCTTCTCCCTGGGGAGTTAAGG + Intronic
1030513545 7:110515099-110515121 ACATTCTGCGAGGGGAATGAGGG - Intergenic
1031154228 7:118089968-118089990 ACTTTCTGCTACAGGAATTATGG + Intergenic
1032403307 7:131638491-131638513 AGCGTCTACTAGGTGGATTAGGG + Intergenic
1036587320 8:10136288-10136310 AGCTTCTGCTATCGGACTTCTGG + Intronic
1039037753 8:33378187-33378209 TTCCTCTGCTAGGGGAATTCAGG + Intronic
1039747363 8:40441112-40441134 AGCTTCTCCCAGGAGAATCATGG + Intergenic
1048650417 8:136469928-136469950 AACGTCTGCAAGGAGAATTAAGG - Intergenic
1049005349 8:139851931-139851953 AGGGTCTGCCAGGGGAATGAAGG + Intronic
1049732033 8:144183420-144183442 GGCTTCTGCTTGTGGCATTATGG + Intronic
1051879717 9:21827335-21827357 AGCTTCTGCTATGGGAGAGAGGG + Intronic
1057971257 9:99560327-99560349 ATCTTTTGCTAAAGGAATTATGG + Intergenic
1059627923 9:116087774-116087796 ATCTTCTGCAAGGGAAAATATGG + Intergenic
1059631878 9:116133714-116133736 GGCTGTTGCTAAGGGAATTATGG - Intergenic
1059808514 9:117830293-117830315 AGCCTCTGCTAGGGAAATTCTGG - Intergenic
1061979663 9:134094370-134094392 GTCTTCTTCTAGGGGATTTATGG - Intergenic
1203429606 Un_GL000195v1:79449-79471 AGCTCCTGCTGGGGGATTTGGGG + Intergenic
1185540894 X:902435-902457 AGCTTCTGGTAGGTGGACTATGG + Intergenic
1189352259 X:40284512-40284534 CTCCTCTGCTAGGGCAATTATGG + Intergenic
1190044327 X:47100252-47100274 AGCTTCTGAAGGGGGAATTGGGG - Intergenic
1190224485 X:48534651-48534673 GGCTTCTGCAAGGTGAGTTATGG - Intergenic
1192379916 X:70604887-70604909 AGAATCTGATAGGGGAATTCAGG + Intronic
1193807207 X:86009477-86009499 AGCTTATGCTAGGGGAAGCCAGG + Intronic
1195850078 X:109273368-109273390 AGCTTTTTCTAGAAGAATTAGGG - Intergenic
1195955140 X:110320482-110320504 TGCTTCTGCTAGGGGAATTTAGG + Intronic
1196210203 X:112987435-112987457 AGCTTTTGCATGGAGAATTAAGG + Intergenic