ID: 1091027008

View in Genome Browser
Species Human (GRCh38)
Location 11:132150333-132150355
Sequence AACTTTCCACATAAGATCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 175}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091026994_1091027008 27 Left 1091026994 11:132150283-132150305 CCCCATGGCCAGACATCTCCCAT 0: 1
1: 0
2: 1
3: 19
4: 236
Right 1091027008 11:132150333-132150355 AACTTTCCACATAAGATCTACGG 0: 1
1: 0
2: 0
3: 12
4: 175
1091027007_1091027008 -9 Left 1091027007 11:132150319-132150341 CCAATTTTGGAATCAACTTTCCA 0: 1
1: 0
2: 1
3: 19
4: 275
Right 1091027008 11:132150333-132150355 AACTTTCCACATAAGATCTACGG 0: 1
1: 0
2: 0
3: 12
4: 175
1091026996_1091027008 25 Left 1091026996 11:132150285-132150307 CCATGGCCAGACATCTCCCATTA 0: 1
1: 0
2: 2
3: 35
4: 208
Right 1091027008 11:132150333-132150355 AACTTTCCACATAAGATCTACGG 0: 1
1: 0
2: 0
3: 12
4: 175
1091027003_1091027008 -1 Left 1091027003 11:132150311-132150333 CCCCACCTCCAATTTTGGAATCA 0: 1
1: 0
2: 7
3: 59
4: 359
Right 1091027008 11:132150333-132150355 AACTTTCCACATAAGATCTACGG 0: 1
1: 0
2: 0
3: 12
4: 175
1091026995_1091027008 26 Left 1091026995 11:132150284-132150306 CCCATGGCCAGACATCTCCCATT 0: 1
1: 0
2: 1
3: 29
4: 220
Right 1091027008 11:132150333-132150355 AACTTTCCACATAAGATCTACGG 0: 1
1: 0
2: 0
3: 12
4: 175
1091027005_1091027008 -3 Left 1091027005 11:132150313-132150335 CCACCTCCAATTTTGGAATCAAC 0: 1
1: 0
2: 2
3: 15
4: 215
Right 1091027008 11:132150333-132150355 AACTTTCCACATAAGATCTACGG 0: 1
1: 0
2: 0
3: 12
4: 175
1091026999_1091027008 9 Left 1091026999 11:132150301-132150323 CCCATTAGGCCCCCACCTCCAAT 0: 1
1: 3
2: 14
3: 47
4: 213
Right 1091027008 11:132150333-132150355 AACTTTCCACATAAGATCTACGG 0: 1
1: 0
2: 0
3: 12
4: 175
1091027002_1091027008 0 Left 1091027002 11:132150310-132150332 CCCCCACCTCCAATTTTGGAATC 0: 1
1: 0
2: 5
3: 30
4: 290
Right 1091027008 11:132150333-132150355 AACTTTCCACATAAGATCTACGG 0: 1
1: 0
2: 0
3: 12
4: 175
1091027004_1091027008 -2 Left 1091027004 11:132150312-132150334 CCCACCTCCAATTTTGGAATCAA 0: 1
1: 1
2: 7
3: 41
4: 264
Right 1091027008 11:132150333-132150355 AACTTTCCACATAAGATCTACGG 0: 1
1: 0
2: 0
3: 12
4: 175
1091027000_1091027008 8 Left 1091027000 11:132150302-132150324 CCATTAGGCCCCCACCTCCAATT 0: 1
1: 0
2: 2
3: 30
4: 277
Right 1091027008 11:132150333-132150355 AACTTTCCACATAAGATCTACGG 0: 1
1: 0
2: 0
3: 12
4: 175
1091026998_1091027008 19 Left 1091026998 11:132150291-132150313 CCAGACATCTCCCATTAGGCCCC 0: 1
1: 34
2: 244
3: 929
4: 2886
Right 1091027008 11:132150333-132150355 AACTTTCCACATAAGATCTACGG 0: 1
1: 0
2: 0
3: 12
4: 175
1091027006_1091027008 -6 Left 1091027006 11:132150316-132150338 CCTCCAATTTTGGAATCAACTTT 0: 1
1: 0
2: 1
3: 57
4: 407
Right 1091027008 11:132150333-132150355 AACTTTCCACATAAGATCTACGG 0: 1
1: 0
2: 0
3: 12
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091027008 Original CRISPR AACTTTCCACATAAGATCTA CGG Intronic
902714993 1:18266599-18266621 AAGTTTCCACATAAGTTCTTGGG - Intronic
904300746 1:29551810-29551832 AACTGTCCACCTCAGATCTCTGG + Intergenic
907075057 1:51570776-51570798 AACTGTCAACATAAAATGTAAGG + Intergenic
907197642 1:52699587-52699609 AACTTTCCATCTAAGCTTTATGG - Intergenic
908213238 1:61922969-61922991 AAAATTCCACATAAGATCCCAGG + Intronic
909198794 1:72661997-72662019 ATCTGTCCACATATGATGTAAGG + Intergenic
910882828 1:91937902-91937924 AACTTTCCATATAATATTTTTGG - Intergenic
911102679 1:94106651-94106673 AAGTTACTACATAAAATCTATGG + Intronic
912187204 1:107292573-107292595 CACTTTCCCAATAAGATCTCGGG + Intronic
913097778 1:115535682-115535704 AATTTTGCACATAAAATATATGG - Intergenic
917571771 1:176273305-176273327 AGGTTTCCAAATATGATCTACGG - Intergenic
918550842 1:185740513-185740535 AAATTTCCACATAAAATTTTTGG - Intronic
919251607 1:195063673-195063695 AAATTTCCACATACGATTTGCGG + Intergenic
919815283 1:201433658-201433680 GACTTTTCAGATAAGATCAATGG + Intergenic
1066208747 10:33215740-33215762 TACTTTCCACATGAGTTCTATGG + Intronic
1067382547 10:45788311-45788333 AATATTCCACATAAGAAATATGG - Intronic
1067890251 10:50128861-50128883 AATATTCCACATAAGAAATATGG - Intronic
1068263482 10:54616309-54616331 AATTTTCCATAGAAAATCTAAGG - Intronic
1070949784 10:80421658-80421680 TTTTTTCCACATAACATCTACGG + Intronic
1073760133 10:106620398-106620420 CACCTTCCACATGCGATCTAGGG - Intronic
1075489260 10:122852598-122852620 AACTTTCCACTTAACTTCTGGGG - Intronic
1076086019 10:127632850-127632872 AACTTTCCACTTAAAAGATATGG - Intergenic
1078113144 11:8416793-8416815 AAATTTCCACATAGGAAATAGGG - Intronic
1079565158 11:21873558-21873580 AATTTTCCAAATAAAATTTAAGG - Intergenic
1082031300 11:47606095-47606117 ACCTTTGCAGATAAGATCCAGGG - Intergenic
1082191242 11:49247816-49247838 AATTTTCCCCATGAGAACTAAGG + Intergenic
1082829863 11:57608211-57608233 TACTTTCCACCTAACATCTATGG - Intronic
1082975655 11:59068868-59068890 AACATTCCACTTAAGATTCATGG + Intergenic
1083555659 11:63624466-63624488 AACTTTGCAAAACAGATCTAGGG - Exonic
1085461214 11:76694869-76694891 AACTTTCCACACAATATTTGTGG - Intergenic
1085683013 11:78595769-78595791 CAGCTTCCACATAAGATCTCAGG + Intergenic
1086125061 11:83341886-83341908 AACTCTCCACATAAGGACTCAGG + Intergenic
1086674876 11:89593222-89593244 AATTTTCCCCATGAGAACTATGG - Intergenic
1086892942 11:92279298-92279320 AACTTCCCACATAAGAGGCAGGG - Intergenic
1088112748 11:106280700-106280722 AACTTCCCACAGAAGAGCTATGG + Intergenic
1091027008 11:132150333-132150355 AACTTTCCACATAAGATCTACGG + Intronic
1099339010 12:81403593-81403615 CAGTTTCCAGATAAGATCTCAGG + Intronic
1104384308 12:128336942-128336964 AACATTCCACATAAAAGCAATGG - Intronic
1109269853 13:60242906-60242928 AATTTTGCATATAAGATTTACGG - Intergenic
1109510098 13:63360719-63360741 AACTTTACAATTAAGATCTCAGG - Intergenic
1110267174 13:73551754-73551776 AAGTTTCCCCTTAAGAACTATGG - Intergenic
1110438738 13:75504431-75504453 CACTTTCCTCATCAAATCTATGG + Intergenic
1111150644 13:84249885-84249907 AACTTTATAAATTAGATCTATGG + Intergenic
1111317993 13:86586057-86586079 AACTTGCAACATATGATTTAGGG + Intergenic
1111865685 13:93765246-93765268 AACTTTCCAGATAAGCTGTCTGG + Intronic
1111865687 13:93765275-93765297 AACTTTCCAGATAAGCTGTCTGG + Intronic
1113214145 13:108018154-108018176 TACATTCCACATAGGAACTAGGG + Intergenic
1113597776 13:111546860-111546882 AACTTTCCACTTAATATTTTTGG + Intergenic
1116173266 14:41430195-41430217 CACTTTCCAGATAAGATCTCAGG + Intergenic
1116668116 14:47804872-47804894 AACATTCCTCATATGATTTATGG - Intergenic
1117166078 14:53035180-53035202 AACTTTCCACAAAGAAACTAAGG - Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118283906 14:64453778-64453800 ATCATTGCACAGAAGATCTATGG + Exonic
1119242801 14:73075702-73075724 AAATCTCCACTTAAAATCTAGGG - Intronic
1125092762 15:35813464-35813486 ACATTTCCATATAAGTTCTACGG - Intergenic
1125397636 15:39267524-39267546 AACTTTCTACAAAATTTCTAAGG - Intergenic
1126825954 15:52548146-52548168 AATTTTCCACATAATATTTTTGG - Exonic
1126921059 15:53525165-53525187 AACATTTCACAAAAAATCTATGG - Intronic
1130901489 15:88210002-88210024 CACTGTCCACATAGGATCTGGGG + Intronic
1132305962 15:100812591-100812613 AACTTTCCAAAAGAGACCTATGG - Intergenic
1138808247 16:60118766-60118788 AACTTTCCACTGCACATCTAGGG + Intergenic
1143873257 17:9972989-9973011 AACATTCAACTTAAGATCTGGGG + Intronic
1144291698 17:13832903-13832925 ATCTTTCCAGCTAAGATGTAGGG + Intergenic
1146543326 17:33717003-33717025 AACTTTCTAAAGAAGATCTGTGG + Intronic
1150960139 17:69903726-69903748 AAATTTACACATACAATCTATGG + Intergenic
1152893191 17:82894677-82894699 GATTTTCCACATAAAATATATGG - Intronic
1156050928 18:32933238-32933260 AAATTTCAACATAAGGTTTAAGG - Intergenic
1158825943 18:61219408-61219430 ATCTTTCCCTATAAGATGTATGG + Intergenic
1165181239 19:33972861-33972883 AAATTTCCACATGAGGTTTAGGG - Intergenic
925013946 2:507736-507758 ATCTTTCCAAAGAAGATCTTTGG + Intergenic
925685903 2:6473227-6473249 ATCTTTCCACAAAATATCTGGGG - Intergenic
926345552 2:11941735-11941757 AACTTTCCACATAACAAACAAGG - Intergenic
926686433 2:15701947-15701969 AACTTTCCTGATAAGATCTCAGG - Intronic
928056023 2:28055536-28055558 AAGTTTCCAAATATGATTTATGG + Intronic
928235495 2:29535926-29535948 AACTTTCCCGCTAAGATGTAAGG + Intronic
928448282 2:31352771-31352793 AACTTCACACTTCAGATCTAGGG - Intronic
928448875 2:31360157-31360179 AATTTTCCACATAATATGTTTGG - Intronic
928874081 2:36016226-36016248 CAATTTTCACATAAGATATATGG + Intergenic
929729939 2:44478030-44478052 AATTTTACACATTAAATCTATGG - Intronic
932675727 2:73779472-73779494 AACTTTCCATGTGAGATCTCAGG + Intronic
935469282 2:103437421-103437443 AACTTTTCACATCAGATCGTTGG - Intergenic
936694678 2:114931581-114931603 AAATTTCAACATGAGATTTACGG + Intronic
940205202 2:151194817-151194839 AAATTTCCACAGAAGATAAAAGG + Intergenic
941942779 2:171060460-171060482 ATCTTTAGCCATAAGATCTATGG - Intronic
942821377 2:180119951-180119973 AAGATACCACATAAGTTCTAAGG - Intergenic
945824332 2:214701531-214701553 AACTTTCAACATGAGATTTGGGG + Intergenic
946468875 2:219937910-219937932 AACTGTACAACTAAGATCTATGG - Intergenic
947601857 2:231456341-231456363 CACTTTCCATAGAAGATCTGGGG - Intronic
947954586 2:234177453-234177475 AACTTTCGACAACAGAGCTAAGG - Intergenic
948151339 2:235747339-235747361 ATCTTTCCACATCCGATCAACGG - Intronic
1172182433 20:33011579-33011601 CACCTTCCACATAGGAACTAGGG + Intronic
1182428624 22:30287750-30287772 AACTTCCCACTTAAGATCAGAGG + Intronic
1182664446 22:31946793-31946815 AACCCTCCAGAGAAGATCTATGG - Intronic
951760768 3:26145172-26145194 CCCTTTCCACATAAAATTTAAGG + Intergenic
953038512 3:39234281-39234303 CACTTGCCACACTAGATCTAAGG + Intergenic
953293646 3:41691060-41691082 AAGCTTCCTCGTAAGATCTAAGG + Intronic
954734555 3:52695200-52695222 GACATTCCACATAGGATCGATGG + Exonic
956599677 3:71007237-71007259 AATTTTCCCCATCAGATCTGAGG - Intronic
956759616 3:72428487-72428509 AAGTTTCTACATAACATCTATGG + Intronic
958482758 3:94665170-94665192 AACATTCATCATAATATCTATGG + Intergenic
959305346 3:104657528-104657550 AACTTTCCACTTAAAAAATATGG - Intergenic
959365138 3:105448537-105448559 AATTTTCCACATGACATCTGTGG + Intronic
959410673 3:106017318-106017340 TACTTTATACATAAGATCTCTGG - Intergenic
959626728 3:108460724-108460746 ATCTTTCCATATAAGTTATATGG - Intronic
959898899 3:111637940-111637962 AACTTTACACATAATATTTAAGG + Intronic
960826479 3:121791535-121791557 AAGATTCCAGAGAAGATCTAGGG + Intronic
965934131 3:174085223-174085245 AATTTTCCAGATAAAATCTTGGG + Intronic
966239574 3:177741309-177741331 AACTTTCCACATACTAGCTCTGG - Intergenic
966447975 3:180024653-180024675 AGCTTTTCACATCAGATCCAAGG - Intronic
969552221 4:7878132-7878154 GTCTTTCCCCTTAAGATCTAAGG + Intronic
969931405 4:10634496-10634518 ACCTCTCCACATTTGATCTAAGG + Intronic
970778300 4:19704086-19704108 AACTTTCCAGATTATTTCTATGG - Intergenic
973139082 4:46743930-46743952 AACTTTTAACATAAGATTCAAGG + Intronic
975185018 4:71391800-71391822 ACCTTTCCACCTAAAATCCAGGG - Intronic
975201257 4:71592582-71592604 ACCATTCCACACAAGATATATGG - Intergenic
977036432 4:91959232-91959254 ATCTTTACACAAAGGATCTATGG + Intergenic
977827179 4:101547023-101547045 AACTTTCCTCCTAAGATCAGGGG - Intronic
979324985 4:119368554-119368576 AACTGTACAGTTAAGATCTATGG - Intergenic
979411953 4:120390495-120390517 GACTTTCCAGATAAGAGATAAGG + Intergenic
980683505 4:136194656-136194678 AGCTTTCCATATGAGAACTAAGG + Intergenic
980847335 4:138339731-138339753 ATCTTTCCACACCAGATCAATGG + Intergenic
981112598 4:140952944-140952966 AACTATACACATAGGCTCTATGG + Intronic
981145321 4:141317223-141317245 AACTATCCACATTTGATATAAGG - Intergenic
981747688 4:148067306-148067328 AACTATGCACAGAAGATGTAAGG - Intronic
981774900 4:148355215-148355237 CACTTTCCCCAGAAGATATATGG - Intronic
987071670 5:14342625-14342647 AACTTTGCACAAGAGATATAAGG - Intronic
989278373 5:39614529-39614551 AACTTTCCACTTAATAGGTAAGG - Intergenic
991475532 5:67014919-67014941 ACCTTCTCACATCAGATCTAGGG + Intronic
991589850 5:68239058-68239080 GCCTTTCCACATAACATATAAGG - Intronic
993806277 5:92414046-92414068 CATTTTACATATAAGATCTAAGG - Intergenic
994164658 5:96596146-96596168 AACTTTGCAGATGAGATCAAGGG + Intronic
994186808 5:96824128-96824150 AATTTTCCACATAATATTTTTGG + Intronic
999018214 5:148132744-148132766 AACTTTCTTCATATTATCTAAGG - Intronic
1000673144 5:164087555-164087577 AATTTTCTACATAACATCTATGG + Intergenic
1000866010 5:166515590-166515612 AAATATCCACATAAAATGTATGG + Intergenic
1000917101 5:167095665-167095687 AACTGAACACTTAAGATCTATGG - Intergenic
1002683271 5:180986376-180986398 AATTTTCCACATAATATGTTTGG + Intergenic
1003160763 6:3632279-3632301 AACTTTCCATATAATATTTTTGG + Intergenic
1003371349 6:5530008-5530030 AACTTTCCACCTAAGTCCAAAGG + Intronic
1009037789 6:58139000-58139022 AAGTTTCAACATGAGATCTGGGG - Intergenic
1009213576 6:60892637-60892659 AAGTTTCAACATGAGATCTGGGG - Intergenic
1009505803 6:64476456-64476478 AACTCTCCCCAGAAGATCTCTGG + Intronic
1009746280 6:67820815-67820837 CACTTTCCTGATAAGATCTCAGG - Intergenic
1013444047 6:110203376-110203398 ATCTTTCCACATGAAATGTAAGG + Intronic
1013454601 6:110318821-110318843 AACTTTCTAGTTAAGATTTATGG + Intronic
1014473915 6:121849447-121849469 AAAATTCCAGATAGGATCTATGG - Intergenic
1014494516 6:122104529-122104551 AATTTTCCACACAAGATCTGTGG - Intergenic
1014686729 6:124510843-124510865 AACTTCCCACAAAATATCAAGGG + Intronic
1017069026 6:150556459-150556481 AATTTCCAAAATAAGATCTAAGG - Intergenic
1017223587 6:151994402-151994424 AACTGTCCAAATACGATCTCTGG + Intronic
1018939434 6:168299134-168299156 AATTTTCCACATATAATTTAGGG - Intronic
1021038511 7:15831394-15831416 AACTTTCCCTAGAAGAACTAAGG - Intergenic
1023186181 7:37535700-37535722 CAATTTTCACATCAGATCTAAGG + Intergenic
1025483119 7:61010875-61010897 AACTTTCTACACCAGATATATGG + Intergenic
1028669318 7:93383140-93383162 AACTTGCCACTTAATATTTATGG + Intergenic
1031186712 7:118490346-118490368 AATTTTCAACACAAGATCTTTGG + Intergenic
1031365756 7:120898893-120898915 AACTATCTTCATAAGATCAAAGG + Intergenic
1031407416 7:121403356-121403378 CATTTGCCACATCAGATCTATGG + Intergenic
1032143501 7:129356832-129356854 CACCTTCCACATAAAATCCATGG + Intronic
1033413908 7:141145696-141145718 AACTATCTACTTCAGATCTACGG - Intronic
1034294661 7:149961639-149961661 AAGTATACACATAGGATCTATGG + Intergenic
1034811396 7:154135232-154135254 AAGTATACACATAGGATCTATGG - Intronic
1036466077 8:8998782-8998804 AACTTGCCACATAACACCAAAGG - Intergenic
1040884578 8:52246827-52246849 AATTTTTCACATAAGTTATAAGG + Intronic
1041663926 8:60424360-60424382 ATCTCTCCACATCAGATCAAAGG + Intergenic
1043599480 8:81919894-81919916 CAGTTTCCCCATAAGATCTCAGG + Intergenic
1046316238 8:112506266-112506288 AACATTTCACATAAAAACTAAGG + Intronic
1046671542 8:117062099-117062121 GACTTTCCACACAGGATCCAGGG + Intronic
1046935057 8:119877769-119877791 ATCTTCCCACATAAGATTTGTGG + Intronic
1048491685 8:134900111-134900133 AACTTTAAACATAAGAGCTAAGG + Intergenic
1052215162 9:25958074-25958096 AACTTTCCACTTAAAAGATATGG + Intergenic
1057734277 9:97639293-97639315 TACTATCCACATAGGATCTGAGG - Intronic
1187643131 X:21316594-21316616 ACCTTTACACATAGGAACTAAGG + Intergenic
1188568313 X:31551970-31551992 AACTTTCGACACATAATCTAAGG + Intronic
1189560132 X:42183744-42183766 AACTTCCTACATAACATCTTTGG - Intergenic
1190925185 X:54897048-54897070 AACTTTCCACTTAAAATATAAGG + Intergenic
1190950424 X:55138216-55138238 AACCTTCAACTTAAAATCTAGGG - Intronic
1191166001 X:57392943-57392965 ATCATTGCACAGAAGATCTATGG - Intronic
1193186676 X:78521534-78521556 AACTTGCCCCATAATATTTACGG - Intergenic
1194395085 X:93373396-93373418 AAGTTTGAACATTAGATCTATGG + Intergenic
1194577623 X:95633110-95633132 AAATTTCTACATATGTTCTAAGG - Intergenic
1195556085 X:106226369-106226391 AACTTTCCACAAAGGATAAAAGG - Intergenic
1196302346 X:114061997-114062019 TACTTTCCTCATAAGTTCCAAGG - Intergenic
1196499914 X:116367941-116367963 AACTCAACACATAAAATCTAGGG + Intergenic
1197183165 X:123558795-123558817 TACTTTCCTGATAAGATCAATGG + Intergenic
1197776153 X:130119915-130119937 AACTTGACATATAAAATCTATGG - Intergenic
1199029300 X:142977847-142977869 TACTTTCCAAATGAGAACTAAGG - Intergenic
1199296338 X:146163102-146163124 AAATTTCAACATGAGATTTAGGG - Intergenic