ID: 1091028104

View in Genome Browser
Species Human (GRCh38)
Location 11:132159920-132159942
Sequence TAGGTGAGCAGGCCTGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091028099_1091028104 18 Left 1091028099 11:132159879-132159901 CCTAAATGAGGTTCATGCTGATT 0: 1
1: 0
2: 0
3: 16
4: 158
Right 1091028104 11:132159920-132159942 TAGGTGAGCAGGCCTGTTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091028104 Original CRISPR TAGGTGAGCAGGCCTGTTCT GGG Intronic
900165297 1:1242098-1242120 TTGGAGAGCAGCACTGTTCTGGG - Intergenic
900186274 1:1334685-1334707 TACCTGGGCAGGCCTGGTCTGGG - Exonic
900371589 1:2334530-2334552 TGGGGGAGCAGGCCTGGTTTTGG + Intronic
901098719 1:6702645-6702667 AAAATGAGGAGGCCTGTTCTGGG - Intergenic
902192556 1:14773809-14773831 GAGGAGAGCAGGCCTGGCCTGGG - Intronic
903265079 1:22153389-22153411 TAGGGGAGCAGGTCTGTCCTGGG - Intergenic
905773473 1:40653428-40653450 GAGCTGGGCAGGCCTCTTCTCGG - Intronic
906679412 1:47715276-47715298 TAGGTGAGCAGGACTGAGCTGGG - Intergenic
906889369 1:49691400-49691422 CAGGTGTGCAGACATGTTCTTGG + Intronic
909224507 1:73000505-73000527 TATGTGAGGAGACATGTTCTAGG + Intergenic
909609775 1:77539835-77539857 TGGGTGAGCAGCCCTGTCTTGGG - Intronic
911083442 1:93956621-93956643 TGGCTGAGCATGCCTGTCCTTGG + Intergenic
916628574 1:166587279-166587301 TAGGTGAGCTGGGATGTTTTCGG - Intergenic
919837135 1:201582718-201582740 TACGTGAGGAAGCCTGTCCTCGG + Intergenic
920871690 1:209800240-209800262 TAGGTGGACAGGCTTGTTGTGGG - Intronic
922574160 1:226651254-226651276 TAGGTGAGCAGGCGAGGCCTCGG + Intronic
1063208656 10:3858340-3858362 GAGTTGAGCAGGGCTATTCTTGG - Intergenic
1064404234 10:15046922-15046944 TACGTGAGCAGTCCTGTTAATGG + Intronic
1067756598 10:49010460-49010482 TGGGGAAGCAGGCCTCTTCTGGG - Intergenic
1068018830 10:51554730-51554752 TAGGTGCCCAGGGCTGTCCTTGG + Intronic
1070812881 10:79307090-79307112 TAGCTCAGCAGGTCTGCTCTAGG + Intronic
1073067283 10:100770192-100770214 GAGGTGAGCATGCCTGTGGTGGG + Intronic
1073537536 10:104291341-104291363 AAGGTGAGCTGGCCTCTTCAAGG + Intronic
1076227267 10:128789226-128789248 AAGGTGACCAGAGCTGTTCTTGG - Intergenic
1076662529 10:132065029-132065051 TGGGCGTGCAGGCCTGCTCTGGG + Intergenic
1079984467 11:27186011-27186033 TTGTTGTGCAGGGCTGTTCTTGG - Intergenic
1081706103 11:45182681-45182703 GACGTAGGCAGGCCTGTTCTTGG + Intronic
1086515244 11:87604240-87604262 AAGGTGGGCTGGCCTGTTCCTGG - Intergenic
1087268988 11:96092279-96092301 TAGGAGAGAAGGCTTGTTCTGGG + Exonic
1089090323 11:115869419-115869441 AAGCTGAGCATGCCTGTCCTTGG + Intergenic
1089271866 11:117307064-117307086 TAGGAGAGCTGGGCTGTGCTGGG - Intronic
1091028104 11:132159920-132159942 TAGGTGAGCAGGCCTGTTCTGGG + Intronic
1091291609 11:134443420-134443442 TAGGAGCGCAGGCCTGGGCTAGG + Intergenic
1092348880 12:7739581-7739603 GAGGTGAGTAGGCCTGGACTAGG + Intronic
1093132936 12:15414371-15414393 TAGATGAGGTGTCCTGTTCTGGG - Intronic
1098660997 12:73094002-73094024 TAGGTGTTCAGGCCTGTGATGGG - Intergenic
1098819669 12:75210675-75210697 TTGGTGATGAGGCCTGTTATAGG - Intergenic
1099672936 12:85717895-85717917 TAGGTTTGCAGGCCTGTGATGGG + Intergenic
1101270068 12:103133448-103133470 GAGATGAGCATGCCTGTTCTTGG - Intergenic
1101404622 12:104417044-104417066 TAGGTGAGAGGGCCTGATCGTGG + Intergenic
1102485175 12:113250618-113250640 TAGATGAACAGGCCAGTTGTTGG + Intronic
1106813946 13:33386837-33386859 GAGGAGGGCAGGTCTGTTCTTGG - Intergenic
1108732252 13:53247103-53247125 TAGGTGCCCAGCACTGTTCTAGG + Intergenic
1110909577 13:80939784-80939806 GAGCTGAACATGCCTGTTCTTGG + Intergenic
1111572277 13:90104292-90104314 GGGATGAGCATGCCTGTTCTTGG + Intergenic
1112583474 13:100696312-100696334 TAGTTGATCAGGCCTGCTCTAGG + Intergenic
1116967062 14:51025904-51025926 TAGGGCAGCAGGGCTGTACTTGG - Intronic
1118297755 14:64585845-64585867 TAGGAAACCAGGCCTGGTCTGGG - Intronic
1120469163 14:84900900-84900922 TAGGAAAGCAGGCATGTTCTTGG + Intergenic
1121033427 14:90679068-90679090 TAGGTGAGCAGGCTGGCACTAGG - Intronic
1121906475 14:97750740-97750762 TTGGTGAGCAGGCCAGTCCTAGG + Exonic
1122531972 14:102434662-102434684 CAGGAGAGCTGTCCTGTTCTTGG - Exonic
1122693282 14:103541464-103541486 GAGGTGAGCAGGCCAGAGCTCGG - Intergenic
1125723100 15:41854476-41854498 TGAGGGAGCAGGCCGGTTCTCGG + Intronic
1129628172 15:77228331-77228353 GTGGCTAGCAGGCCTGTTCTGGG + Intronic
1130137544 15:81194710-81194732 AAGGTGAGCAGGCTTCTGCTTGG + Intronic
1132376957 15:101334718-101334740 TTGGTGACCAGGCCTTTTGTGGG - Intronic
1133326887 16:4947338-4947360 TACGTGACAAGTCCTGTTCTAGG + Intronic
1133528240 16:6627288-6627310 TAGGTGTGCTTACCTGTTCTAGG + Intronic
1134039827 16:11060020-11060042 TTGGTGGGCAAGCCTGTCCTGGG + Intronic
1138156730 16:54712523-54712545 TAGGTGATAGGCCCTGTTCTAGG - Intergenic
1139680981 16:68562768-68562790 TAAGTGAGCAGGACTGTGTTAGG - Intronic
1146129428 17:30258615-30258637 GAGGTGAACAGGCTTCTTCTGGG - Intronic
1150441429 17:65194874-65194896 TGGGTAAGCAGGCCTGGCCTGGG + Intronic
1151598600 17:75093050-75093072 TGAGTGAGCAGGCCGGTGCTAGG - Intronic
1151896309 17:76983082-76983104 TAGGTGAGCAGCTTTGTTGTTGG - Intergenic
1152247701 17:79193912-79193934 TAGGGGAGCAGGCCTGATGGTGG + Intronic
1158419395 18:57279524-57279546 CAGGTGAGAAGGAGTGTTCTGGG + Intergenic
1158794792 18:60831665-60831687 TAGGTGTGCAGGTCTGTTTCTGG + Intergenic
1159605089 18:70466684-70466706 TTGGTGAGCAGGCCTGAGCTGGG + Intergenic
1161492216 19:4568210-4568232 TGGGTGAGCGGGCCTGGTCCTGG - Intergenic
1164629392 19:29752245-29752267 TAGGTGCCCAGCCCTGTGCTAGG + Intergenic
1165404195 19:35619883-35619905 TGGGTCAGCAGCCCTGGTCTTGG + Intronic
1167156385 19:47741739-47741761 TATGTGCCCAGCCCTGTTCTAGG + Exonic
925659628 2:6188427-6188449 TAGGGGCCCAGGCCTGTACTTGG - Intergenic
926228383 2:10984340-10984362 CAGGTGAGAAGGAGTGTTCTGGG - Intergenic
930019658 2:46993885-46993907 TAGGAGGGCAGGCCTGTGTTGGG - Intronic
932189016 2:69723419-69723441 GAGGAGAGCAGGCATTTTCTAGG + Intronic
932316001 2:70783474-70783496 TAGCAGAGCAGGCCTGTGCTTGG - Intronic
932578006 2:72973299-72973321 CAGGTGAGCATGCCTGTTGTGGG - Intronic
940330392 2:152467772-152467794 CAGTTGACCAGGCCTGCTCTCGG - Intronic
940642256 2:156357973-156357995 TATATTAGCAGCCCTGTTCTGGG + Intergenic
941650664 2:168089095-168089117 TGGGTGAGCAGGCCAGCTCCAGG + Intronic
941749525 2:169120239-169120261 TGGGTGAGCAGGTCAGTCCTTGG - Intergenic
942376464 2:175343225-175343247 TGGCTGAGCATGCCTGTCCTTGG + Intergenic
943438614 2:187898491-187898513 TTGTTGAGCAGGCATCTTCTTGG + Intergenic
943500925 2:188688716-188688738 TAGGTGTGCAGGCTTATTTTTGG + Intergenic
943565020 2:189506934-189506956 TAGCTGAACAGACCTGTTGTAGG + Intergenic
945291960 2:208135599-208135621 TAGGTGAGCAGGAATCTTGTAGG + Intergenic
945931629 2:215861033-215861055 CATGTGAGGAGGCCTGGTCTGGG + Intergenic
945984251 2:216341348-216341370 TAGGCAAGCAGGCCTCTTCTAGG - Intronic
946134694 2:217636168-217636190 TATGGGAGAAGGCATGTTCTGGG + Intronic
947514857 2:230794094-230794116 TTGGTGGGCAGGCATGTTCCTGG + Intronic
948812870 2:240493864-240493886 TAGGTGGGCAGGCAAATTCTTGG + Intronic
1169009359 20:2237455-2237477 GAAGTGAGCAGTGCTGTTCTTGG - Intergenic
1171295240 20:24011711-24011733 CAGGTGAGGAGGCCTGCCCTGGG + Intergenic
1171310861 20:24143642-24143664 TCTCTGAGGAGGCCTGTTCTGGG - Intergenic
1172007332 20:31826510-31826532 AAGGCTAGCAGGCCTGTTCAAGG + Intronic
1172209652 20:33187787-33187809 AAGGTGAGCAGTGCTGTTCTGGG - Intergenic
1172324428 20:34023530-34023552 TTGGTGGGGAGGCCTGTCCTTGG + Intronic
1172444350 20:34985259-34985281 TAGGTGAGGTGGCCTGAGCTGGG - Intronic
1173810315 20:45951367-45951389 AAGGTGAGTGGGCCAGTTCTGGG - Intronic
1174123363 20:48283969-48283991 CAAGGGAGCAGGGCTGTTCTTGG - Intergenic
1174321822 20:49748030-49748052 TAAGAGAGGAGGCCTGTTTTTGG - Intergenic
1181306513 22:21920215-21920237 CAGGTGAGCCGGCGTGTCCTGGG - Exonic
1184153861 22:42654205-42654227 TAGGAGAGCGACCCTGTTCTTGG - Intergenic
1185399818 22:50610017-50610039 TAGGTGCCCAGCCCTGTGCTTGG + Intronic
950578898 3:13850316-13850338 TAGCTGAGCAGGCCTTATCTGGG + Intronic
950797733 3:15523935-15523957 TAGGTGACAAGGACTGTCCTGGG - Intergenic
954109154 3:48424598-48424620 CAGGTGACCATGCCTGCTCTGGG - Exonic
954538378 3:51378042-51378064 TGGGTGAGTGGGCCTGTTCTTGG + Intronic
955340945 3:58124503-58124525 AAGGTGAGCCGCCCTGTCCTCGG + Exonic
959253610 3:103980784-103980806 TATGAGAGGAGGCCTATTCTAGG + Intergenic
960265441 3:115615852-115615874 GAGGTGAGCAAGTCTCTTCTGGG + Intergenic
960466034 3:117997411-117997433 GAGGAGAGCAAGGCTGTTCTGGG - Intergenic
962840730 3:139230228-139230250 TTGCTGAGCAGGGCTGATCTAGG - Intronic
969199576 4:5592198-5592220 TTGGTAAGGAGGCCTGCTCTTGG - Intronic
971016773 4:22497070-22497092 TAAGTGGGCAGGCTTGTTTTTGG - Intronic
971196478 4:24475246-24475268 TAGAAGAGCAGGCCTGTGATGGG - Intergenic
971678460 4:29666527-29666549 TAGTTGTGGAGGCCTGTACTTGG - Intergenic
974390315 4:61258558-61258580 TAGGTGCGTAGGTCTGTTTTAGG + Intronic
975615099 4:76238063-76238085 TAGGTGAGCAGGCCAGACCCGGG + Intronic
976187558 4:82457720-82457742 TAGTTGAGCCAGCCAGTTCTGGG + Intronic
979645320 4:123060666-123060688 TAGGTTTGCAGGCCTGTGATGGG + Intronic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
982232845 4:153224399-153224421 GAGGTAATCTGGCCTGTTCTGGG + Intronic
982572999 4:157074374-157074396 AAGGTGAGCAAGTCTGTTGTAGG + Intergenic
983696502 4:170539068-170539090 TAAATGAGCATGGCTGTTCTTGG - Intergenic
986146663 5:5084254-5084276 CAGGTTAGCAGGCCTGTTACTGG + Intergenic
996256365 5:121409156-121409178 TAGGTGTGCAGGACCGTTTTAGG + Intergenic
998181586 5:139949814-139949836 AAGGTGAGCAGGACTTGTCTAGG - Intronic
998692721 5:144604949-144604971 TAGGTGCTCAGGCTTGTGCTGGG - Intergenic
1000154729 5:158539293-158539315 TAGGTGGTCAGTCCTGTCCTTGG + Intergenic
1002660809 5:180790225-180790247 TGGCTGGGCAGGCCTGGTCTGGG - Intergenic
1002859371 6:1066521-1066543 TAGGTGAGCAGAGGTGTGCTGGG + Intergenic
1003433217 6:6059519-6059541 TAGGTAAGCAAGCCTTGTCTGGG + Intergenic
1004118023 6:12790275-12790297 TAAGTGAGCAGGGCAATTCTAGG - Intronic
1006022628 6:31126419-31126441 TAGCTGAGAAGCCCTGTCCTGGG + Intronic
1006181877 6:32158532-32158554 TATGGGCGCAGGCTTGTTCTGGG + Intronic
1006393611 6:33773042-33773064 CAGGTGTGCAGGGCTGTGCTAGG + Intronic
1007593981 6:43040200-43040222 TAGGAGGGCAGGCAGGTTCTGGG + Exonic
1010124744 6:72418932-72418954 TAGGTGAGGAGAGCTGTTCTGGG - Intergenic
1012803051 6:103858389-103858411 TAGATGAGCGGGACTCTTCTAGG - Intergenic
1013178908 6:107701423-107701445 TGGGTGACCAGGGCTGTTCTGGG - Intergenic
1016185338 6:141191864-141191886 TAGGTCTCCAGGCCTGTTATGGG + Intergenic
1017694808 6:157003829-157003851 TAGGTGCGCATGACTGTTCCTGG + Intronic
1019656181 7:2197361-2197383 TAGGTGTGCAGGCCTGGTGCTGG - Intronic
1019773091 7:2896043-2896065 CAGGGGAGCAGGTCTGTGCTGGG + Intergenic
1019921994 7:4169013-4169035 TGGGTGCGCAGGCATGTGCTGGG + Intronic
1020365659 7:7378208-7378230 AGGCTGAGCAGCCCTGTTCTAGG - Intronic
1022474472 7:30700980-30701002 TGGCTGAGCAGTGCTGTTCTTGG + Intronic
1022659997 7:32358008-32358030 AAGGTCAGCAGGCCTCTGCTGGG - Intergenic
1024056701 7:45664076-45664098 TAGGTGATCAGGCCTCCCCTGGG + Intronic
1027964318 7:84986390-84986412 CAGCTGAGCTGGCCTTTTCTTGG - Intergenic
1028020926 7:85770507-85770529 TAGGTCACCAAGTCTGTTCTAGG - Intergenic
1033677318 7:143556154-143556176 GGGCTGAGCATGCCTGTTCTTGG + Intergenic
1033694516 7:143773282-143773304 GGGCTGAGCATGCCTGTTCTTGG - Intergenic
1042809031 8:72803864-72803886 GAGGTGAGTAGGCCTGACCTTGG + Intronic
1045251612 8:100487450-100487472 TCCGTGAGCAGGGCTCTTCTTGG + Intergenic
1045409953 8:101906828-101906850 TAGGTGAGCAGCCCACTTTTAGG + Intronic
1047803787 8:128337727-128337749 TAAAGGAGCAGGACTGTTCTAGG - Intergenic
1047971947 8:130092055-130092077 TGGGGGAGGAGGCCTCTTCTTGG + Exonic
1049530314 8:143151260-143151282 TGTGTGCGCAGGCCTGTGCTTGG - Intergenic
1051351690 9:16203661-16203683 TATGGGAGGAGGTCTGTTCTTGG + Intergenic
1051893924 9:21969449-21969471 TGCGTGATCAGCCCTGTTCTAGG - Intronic
1052834962 9:33243490-33243512 TAGATTAGTTGGCCTGTTCTAGG + Intronic
1056176946 9:84044985-84045007 GGGCTGAGCAGGCCTGTCCTTGG + Intergenic
1059053444 9:110953239-110953261 AGGCTGAGCATGCCTGTTCTTGG - Intronic
1059107908 9:111527132-111527154 TAATTGAGCAGGGCTTTTCTAGG + Intronic
1187274289 X:17804893-17804915 TTTCTGAGCAGGACTGTTCTGGG - Intronic
1189253962 X:39623003-39623025 GAGATGAGAAGGCCTGGTCTGGG + Intergenic
1189754959 X:44261643-44261665 AATGTGAGCAGGCTTGTTCTAGG - Intronic
1190744163 X:53311462-53311484 GAGATGATCAGGCCTGTGCTTGG - Intronic
1193230504 X:79039574-79039596 TAGATGAGCAGCCTTTTTCTGGG + Intergenic
1197643423 X:128992440-128992462 TAGGTTAGCAGGCAAGTCCTTGG + Intergenic
1201562153 Y:15329023-15329045 TAGGGGAGCAGGCCTGCGATGGG - Intergenic
1202099186 Y:21287990-21288012 TAGGCCTGCAGGCCTGTGCTAGG - Intergenic