ID: 1091032785

View in Genome Browser
Species Human (GRCh38)
Location 11:132205924-132205946
Sequence AGTTCCCCCTAGAAGGTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091032779_1091032785 29 Left 1091032779 11:132205872-132205894 CCATCAGCAAGTCTAAGATAGAA 0: 1
1: 0
2: 1
3: 22
4: 457
Right 1091032785 11:132205924-132205946 AGTTCCCCCTAGAAGGTCTAGGG 0: 1
1: 0
2: 0
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091032785 Original CRISPR AGTTCCCCCTAGAAGGTCTA GGG Intronic
902757444 1:18558304-18558326 ACCTCTGCCTAGAAGGTCTAGGG + Intergenic
909563921 1:77034175-77034197 TGTTCCCCCTGCAAGCTCTAGGG + Intronic
909709382 1:78628724-78628746 AATTACACCTAGAAGTTCTAAGG - Intronic
910335881 1:86130938-86130960 AGTTTCCTCAAGAAGGTTTACGG + Intronic
911093496 1:94036669-94036691 AGTTCCATCTCGAAAGTCTAAGG - Intronic
920334474 1:205235331-205235353 AGTTCCCACTAGAACAACTAGGG - Intronic
921289702 1:213646152-213646174 AGTTCCCCCTGAAAGGGTTATGG + Intergenic
923149375 1:231219820-231219842 AGTTCCTCCCAGAAGATCAAAGG + Intronic
923464095 1:234232734-234232756 AGTTCCCCTTAGAAGATACAAGG + Intronic
1065918255 10:30369674-30369696 AGTGCCCCTTAAAAGGGCTAGGG + Intronic
1075275249 10:121086958-121086980 GGTTGCCCCTAGAGGGTCAAGGG + Intergenic
1075414854 10:122255206-122255228 AGTTCCCCCAAGAGGCTCTGTGG + Intergenic
1078084352 11:8224846-8224868 AGTTCCCTCTGGAAGGTTCAAGG - Intronic
1078441226 11:11370426-11370448 AGTTCCCCCTTTAAGGGTTACGG - Intronic
1079811692 11:25005123-25005145 AGTTCCCCCTTCAAGCTGTAGGG - Intronic
1088668915 11:112122198-112122220 AGATGTCCCAAGAAGGTCTAAGG - Intronic
1090378000 11:126305009-126305031 AGTTCCTGCTAGTAGTTCTAGGG - Intronic
1090612465 11:128483671-128483693 ACTTCCTCCTAGCAGGCCTAGGG - Intronic
1091032785 11:132205924-132205946 AGTTCCCCCTAGAAGGTCTAGGG + Intronic
1092292378 12:7169516-7169538 TGCTCCCCCTAGAAGGCCTATGG + Intergenic
1095176894 12:39103009-39103031 AGCTGCCCCAAGAAGGGCTAAGG - Intergenic
1095389353 12:41687353-41687375 TCTTCCCCCTAGAAGTTGTAGGG + Intergenic
1102413768 12:112742893-112742915 TGTTCCTCCTGGAAGCTCTAGGG + Intronic
1104824387 12:131698401-131698423 GGTTCCGTCTAGAAGCTCTAGGG + Intergenic
1108510484 13:51151426-51151448 AGTTCCTTCTAGAGGCTCTAGGG - Intergenic
1110146816 13:72202006-72202028 TGTTCCCTCTAGAGGCTCTAGGG - Intergenic
1115174238 14:30544256-30544278 TGTTCCTCCTAGAAGCTTTAAGG - Intergenic
1117828055 14:59724106-59724128 AGGTCATCCTAGAAGGTGTAGGG + Intronic
1120266506 14:82257802-82257824 TGTTCCCTCTGGAGGGTCTAGGG - Intergenic
1123630062 15:22255019-22255041 TGTTCCCCCTGGAGGCTCTAGGG + Intergenic
1124482243 15:30088663-30088685 AGTGCCCCTTAAAAGGGCTAGGG - Intronic
1124488702 15:30140765-30140787 AGTGCCCCTTAAAAGGGCTAGGG - Intronic
1124543784 15:30609729-30609751 AGTGCCCCTTAAAAGGACTAGGG - Intronic
1124959539 15:34384102-34384124 AGTGCCCCTTAAAAGGGCTAGGG + Intronic
1124976165 15:34530323-34530345 AGTGCCCCTTAAAAGGGCTAGGG + Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1129037744 15:72661197-72661219 AGTGCCCCTTAAAAGGGCTAGGG - Intronic
1129398254 15:75265055-75265077 AGTGCCCCTTAAAAGGGCTAGGG - Intronic
1129401866 15:75289330-75289352 AGTGCCCCTTAAAAGGGCTAGGG - Intronic
1129475450 15:75782019-75782041 AGTGCCCCTTAAAAGGGCTAGGG - Intergenic
1129729271 15:77920351-77920373 AGTGCCCCTTAAAAGGGCTAGGG + Intergenic
1129839234 15:78733598-78733620 AGTGCCCCTTAAAAGGGCTAGGG - Intergenic
1132181896 15:99761391-99761413 TGTTTCCCCTGGAAGCTCTACGG + Intergenic
1134224979 16:12382714-12382736 TGTTCCCCCTGGAGGCTCTAGGG + Intronic
1138732962 16:59216446-59216468 CATTCCCTCTAGAAGTTCTAGGG + Intergenic
1138949294 16:61891491-61891513 AGGTCTCCCTAAATGGTCTATGG - Intronic
1143100367 17:4501279-4501301 AGTTCCCCTAAGAACGTCAAAGG - Intronic
1143831178 17:9652666-9652688 ACATTCCCCTAGAAAGTCTATGG - Intronic
1146943625 17:36860017-36860039 AGTTTCCCCCAGAAGGCCTCTGG + Intergenic
1148220125 17:45855270-45855292 TGTTCCCTCTGGAAGCTCTAGGG - Intergenic
1149016670 17:51916308-51916330 AGGTGCCACTAGAAGGACTATGG + Intronic
1152390339 17:80000485-80000507 CGCTCCCTCTGGAAGGTCTAGGG - Intronic
1154292433 18:13121469-13121491 AGTTCCCCCAAGAAGGTACAGGG + Intronic
1158270216 18:55704895-55704917 AGTTCCTTCTAGAAGTTTTATGG + Intergenic
1163587814 19:18173485-18173507 AGCCGCCCCTAGAAGGTCTAGGG + Intronic
1164156221 19:22599156-22599178 AGTGCCCCTTAAAAGGGCTAGGG - Intergenic
928393793 2:30929064-30929086 AGTCCCACCTAGAAGGACTAAGG + Intronic
930231892 2:48851691-48851713 AGTTCCTTCTGGAAGCTCTAGGG + Intergenic
931756352 2:65378019-65378041 AGATCCCACCAGAAGGGCTAAGG + Intronic
939465999 2:142557934-142557956 AGTTCCCCAAAATAGGTCTATGG - Intergenic
939813982 2:146871308-146871330 TGTTCCCTCTGGAAAGTCTAGGG - Intergenic
940611638 2:156000013-156000035 TGTTCCTTCTAGAAGCTCTATGG + Intergenic
941528339 2:166632940-166632962 AGTTCCCCCTTGAAGGCCATGGG + Intergenic
942296295 2:174520316-174520338 AGTTCCTCCTAGAAGCTCCGAGG + Intergenic
944464132 2:199983239-199983261 TGTTCCCCCTAAAGGATCTAAGG - Intronic
946041732 2:216788567-216788589 AGTTCCCCTAAAAAGCTCTAAGG + Intergenic
948768662 2:240236288-240236310 TGGCCCCCCAAGAAGGTCTATGG + Intergenic
1168780922 20:489377-489399 ACTTCCCCCTTGAAGATCAAAGG - Intronic
1170119383 20:12895176-12895198 AATTCCACCTAGAGGCTCTAGGG - Intergenic
1171878230 20:30598003-30598025 AGCTCCCTCTGGAAGCTCTAGGG + Intergenic
1174404452 20:50294459-50294481 AGCTTCCCCTAGAAGGTCAGTGG + Intergenic
1175508371 20:59503749-59503771 TGTCCCCCTTAGAAGGTCTCTGG + Intergenic
1182266655 22:29120726-29120748 AGTTCCTCCTAGAGGCTCAAGGG - Intronic
956785476 3:72638701-72638723 ATTTCCCCCTAGGAGATCTAAGG - Intergenic
961494573 3:127282306-127282328 ACTTCCCTCTTGAAGCTCTAAGG + Intergenic
970797765 4:19934598-19934620 ATTTCCACCGAGAAGGTCTAAGG - Intergenic
971816860 4:31502051-31502073 AGTTCCCCATATATGGTCAAAGG - Intergenic
976537546 4:86235974-86235996 AGTTCCTCTTGGAAGCTCTAAGG + Intronic
977945657 4:102911094-102911116 ATTTCCCCCTAAAATGTTTAAGG + Intronic
978358034 4:107898547-107898569 AGTTACACCTAGCAAGTCTAGGG + Intronic
983672827 4:170258123-170258145 TCTTCCTCCTTGAAGGTCTAAGG - Intergenic
986321923 5:6638382-6638404 AGCTCCACCTAGAAGGTGTGTGG + Intronic
988525668 5:31985093-31985115 AGTTCCCCCAAAAAGGATTAAGG + Intronic
990775598 5:59302200-59302222 AGTTCCCCCAAGAAGGATGAGGG + Intronic
992579729 5:78159457-78159479 CGTTCCCTCTGGAAGTTCTAGGG + Intronic
993621185 5:90169358-90169380 ATTTTCCCTTAGAAGTTCTATGG - Intergenic
1002573046 5:180154916-180154938 AATTCCCCCTCAAAGGTCCAGGG - Intronic
1005911432 6:30313289-30313311 GGTTCCTCCTGGAGGGTCTAAGG - Intergenic
1006887931 6:37397762-37397784 AGTTCCCCTTAGAAGGGATTGGG - Intergenic
1008051780 6:46907625-46907647 CCTCCACCCTAGAAGGTCTAGGG + Intronic
1009628428 6:66165432-66165454 AGCTTCCCTTAGAAGTTCTATGG + Intergenic
1010426259 6:75731962-75731984 ATTTCTCCCTAGGAGGTTTATGG - Intergenic
1014068932 6:117159122-117159144 AGTTCCTTCTGGAAGCTCTAGGG + Intergenic
1014756328 6:125305211-125305233 ATTTCCTCCTGGAAGCTCTAGGG - Intergenic
1015402474 6:132801679-132801701 TGTTCCCTCTAGAAGCTCTAGGG + Intergenic
1024094600 7:45973908-45973930 AGTTCCTCCTTGAGGGTGTAAGG - Intergenic
1029035734 7:97519287-97519309 ATTCATCCCTAGAAGGTCTAGGG - Intergenic
1031916963 7:127572663-127572685 TTTTCCCACTAGAAGGTCTTTGG - Intergenic
1035682307 8:1496907-1496929 AGCTCCCCCAAGATGGTTTACGG + Intergenic
1037576832 8:20213669-20213691 AGTTACCCCTAGAAGTTTTGGGG + Intronic
1050654201 9:7807806-7807828 AGTTCCCTCTGGAGGGTCTTGGG - Intronic
1052789696 9:32863811-32863833 AGTTCCTCCTAAAAGATGTAGGG - Intergenic
1055008663 9:71538201-71538223 AGTTCCCACTGAAAGGTCTAAGG + Intergenic
1056494071 9:87138731-87138753 ATTTTCCCCTAGAAGGTAGAGGG + Intergenic
1057266798 9:93622626-93622648 AGCTCCCTCTGGAAGCTCTAGGG - Intronic
1058041721 9:100309929-100309951 GGTTCCACCTAGAAGGTTTGGGG - Intronic
1061063333 9:128261812-128261834 AGTGCCCCTTAAAAGGGCTAGGG + Intronic
1185511125 X:665941-665963 AGTTCCCTCTGGAGGCTCTAGGG - Intergenic
1185536785 X:868885-868907 AGTTCCTCCTGGAGGCTCTAGGG + Intergenic
1185561169 X:1061623-1061645 AGTTCCCTCTGGAGGCTCTAGGG + Intergenic
1185577155 X:1183360-1183382 AGTTCCCTCTGGAGGCTCTAGGG + Intergenic
1185622704 X:1463352-1463374 AGTTCCCCCTGGAGGCTCTAGGG + Exonic
1185677375 X:1859809-1859831 AGTTCCCTCTGGAGGCTCTAGGG + Intergenic
1185683564 X:1908712-1908734 AGTTCCCTCTGGAGGCTCTAGGG + Intergenic
1185704943 X:2260017-2260039 AGTTCCCTCCAGAGGCTCTAGGG + Intronic
1185792695 X:2939317-2939339 TGTTCCCGCCAGAAGCTCTAGGG - Intronic
1185822779 X:3220674-3220696 AGTTCCCTCTGAAAGCTCTAGGG + Intergenic
1185831313 X:3305540-3305562 AGTTCCCTCTGGATGTTCTAGGG + Intergenic
1185838797 X:3369549-3369571 AGTTCCCTCTGGAGGCTCTAGGG + Intergenic
1185866811 X:3631485-3631507 AGTTCCCTCTGGAGGCTCTAGGG - Intronic
1186801136 X:13093275-13093297 CGTTCCCCCAGGAAGCTCTAGGG - Intergenic
1201236975 Y:11921246-11921268 AGTTCCCTCTGGAGGCTCTAGGG - Intergenic
1201237448 Y:11924615-11924637 AGTTCCCTCTGGAGGCTCTAGGG - Intergenic
1201280505 Y:12338378-12338400 TGTTCCCTCCAGAAGATCTAGGG + Intergenic
1201620644 Y:15953310-15953332 AGTTCCCTCCAGAGGCTCTAGGG - Intergenic
1201894965 Y:18983376-18983398 AGCTCCCCCTGGAAGCTCTAGGG + Intergenic