ID: 1091033526

View in Genome Browser
Species Human (GRCh38)
Location 11:132213168-132213190
Sequence CGGTGTGCACAGATGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091033526 Original CRISPR CGGTGTGCACAGATGGATGA AGG Intronic
900337092 1:2169685-2169707 GGGTGCGCACAGAGGGATGACGG + Intronic
900354476 1:2253676-2253698 CGGTGCGAGCAGATGGAGGATGG + Intronic
902182749 1:14701895-14701917 GGGTGTGCACAGATACATGTAGG - Intronic
905026426 1:34853191-34853213 TGGTGTCCACAGGTGGGTGAGGG - Exonic
906073632 1:43035925-43035947 CGGTGAGGACACATGGATGGAGG + Intergenic
907919763 1:58901673-58901695 ATGAGTGGACAGATGGATGATGG - Intergenic
910011581 1:82470290-82470312 ATATGTGCACAGATGAATGATGG + Intergenic
915615539 1:157034979-157035001 AGGTGTGCAAAGAGGGATGTGGG + Intronic
920681692 1:208077864-208077886 CTCTCTGCACAGATGAATGAGGG + Intronic
921072782 1:211675889-211675911 CGGTGTGCAAAGAAGCCTGAGGG - Intergenic
921181517 1:212635520-212635542 CAGTCTTCAGAGATGGATGAGGG + Intergenic
1063087852 10:2835779-2835801 CAGTGTGCAGAGATGTGTGAAGG - Intergenic
1064873981 10:19971989-19972011 CGTTGTGCATAGAGGGAGGAAGG + Intronic
1066977022 10:42378512-42378534 CGGTTTGCACAGAGAGATAAAGG + Intergenic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1067797867 10:49333835-49333857 TGGTGGGTGCAGATGGATGATGG - Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1070306511 10:75242673-75242695 TGGTGTGCACATCTGGAAGATGG - Intergenic
1071481875 10:86070683-86070705 ATGTGTGCAGGGATGGATGAGGG - Intronic
1071515284 10:86292916-86292938 CTGTGTGAAGAGATGGATGGGGG + Intronic
1072697078 10:97611727-97611749 CGGAGAGCACAGGGGGATGAGGG + Exonic
1074704308 10:116117708-116117730 AGGTATGAATAGATGGATGATGG + Intronic
1074861320 10:117512400-117512422 AGATGTGCTCTGATGGATGACGG + Intergenic
1077475932 11:2790487-2790509 CTGTGTGCACAGCTGGATGCTGG - Intronic
1077786244 11:5386916-5386938 AGGTGTGAAAAGATGGATGCTGG + Intronic
1078781906 11:14447092-14447114 AGGTGTGTACAGATGAGTGATGG - Intronic
1080158169 11:29137856-29137878 GGATGTGCAGAGATGGCTGAAGG - Intergenic
1087272279 11:96123725-96123747 CAGTGTGCACAGATGGGGAAGGG + Intronic
1089117721 11:116109576-116109598 GGGTGTGCACAAATGGCAGAAGG + Intergenic
1089861312 11:121592230-121592252 CTGTTTGCACTGATGGATGGTGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091033526 11:132213168-132213190 CGGTGTGCACAGATGGATGAAGG + Intronic
1091047894 11:132341264-132341286 CAGAGTGCACATGTGGATGAGGG + Intergenic
1098834388 12:75403745-75403767 TGGTGTGAACAGAAGGATGAAGG - Intronic
1099221310 12:79918339-79918361 TGTTGTGCACACATGGAGGAGGG - Intronic
1102531733 12:113551666-113551688 GGGTGGGCACAGAAGGAAGAAGG - Intergenic
1103932098 12:124456320-124456342 CAGTGGGCACAGATGGCTGTGGG + Intronic
1104108733 12:125686987-125687009 AGGTGTACACTGAGGGATGATGG - Intergenic
1112218194 13:97458195-97458217 CTGTGTGAAAAGATGAATGAGGG + Intronic
1118006419 14:61568098-61568120 CGGTGGGCACAGAGAGATGAGGG - Intronic
1119565846 14:75628737-75628759 TGGGCAGCACAGATGGATGAAGG - Intronic
1119774070 14:77237736-77237758 TGGTGTGCAGAGATGACTGACGG + Intronic
1119895970 14:78220336-78220358 AGGTGTGCAGAGAGGGAGGAGGG + Intergenic
1122048734 14:99041161-99041183 CGGCCTCCACAGATGCATGAAGG - Intergenic
1128858710 15:71045888-71045910 CACTGTGCACACATGGAAGATGG - Intronic
1129779439 15:78260418-78260440 CAGAGAGCACAGATGGATGAAGG - Intergenic
1131557292 15:93410983-93411005 AGGTGACCACAGCTGGATGAGGG - Intergenic
1131559695 15:93428695-93428717 CGGAGTGCCCATATTGATGATGG - Intergenic
1131747836 15:95469007-95469029 CCGTGCGCACAGAGTGATGAGGG + Intergenic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1132602659 16:780766-780788 CGGTGTGCACGGGTAGGTGACGG + Intronic
1132699084 16:1214650-1214672 CGGGGTGCACAGACGGCTGCAGG + Intronic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1137529969 16:49273109-49273131 CTGCGTGAACAGATGGATGGAGG - Intergenic
1137908657 16:52352919-52352941 GGGGATGCACAGATGGGTGAAGG - Intergenic
1151950891 17:77353159-77353181 GGGTGTGCGCAGGTGGGTGAGGG + Intronic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1154282723 18:13020468-13020490 AAGTGTCCACAGAAGGATGAGGG - Intronic
1158059923 18:53327800-53327822 TGGTGTGCACAGAGGAGTGAAGG + Intronic
1159758286 18:72392727-72392749 CGGTTTGGTTAGATGGATGAGGG + Intergenic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1162085816 19:8248562-8248584 ATGGGTGGACAGATGGATGATGG + Intronic
1164817948 19:31220808-31220830 CTGTGTGCTCAGAAAGATGAAGG + Intergenic
1168358090 19:55714793-55714815 CGGCGTCCACAGATGGTGGAAGG + Intronic
1168506144 19:56936840-56936862 TGGTGTGCACAGCAGGAAGAGGG - Intergenic
925270018 2:2598798-2598820 TGGTGTGGACTGATGGGTGAAGG - Intergenic
928216843 2:29368805-29368827 CCCTGAGAACAGATGGATGATGG - Intronic
929591536 2:43150671-43150693 AGGGGTGCACAGAGGGAGGAAGG - Intergenic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
933257738 2:80099814-80099836 CGGGGTGGAGAGATGGAAGATGG + Intronic
933786453 2:85846605-85846627 TGGTGTACAGAGATGGTTGATGG - Intronic
934967881 2:98738619-98738641 CGGTGTGAACAGAGGCATCATGG + Intergenic
938770927 2:134500120-134500142 GGGTGTGCGCACTTGGATGAAGG - Intronic
940485795 2:154294086-154294108 CTGTGAGCACAGATGGCTGATGG + Intronic
940902511 2:159138573-159138595 AGGTGTGTACAGATACATGATGG + Intronic
945039281 2:205730611-205730633 CGGTGTGCAGGGAAGGAAGAGGG + Intronic
946059061 2:216926210-216926232 CAGTGTGCAGAGTTGGAGGAAGG + Intergenic
946579821 2:221116151-221116173 CAGTTAGCAAAGATGGATGAGGG + Intergenic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
1172342695 20:34170974-34170996 TGGTGTGAACAGATGGACTAAGG - Intergenic
1174667649 20:52274914-52274936 CTGTGTTCACAGACGGGTGACGG + Intergenic
1175690341 20:61060976-61060998 AGGTGAGCACCGATGGCTGAAGG - Intergenic
1175857926 20:62132766-62132788 CTGGGTGCACAGTTGGATGTGGG + Intronic
1177761971 21:25412281-25412303 CTGTGTGGACAGATGGCTCAAGG + Intergenic
1179509852 21:41865256-41865278 CGCTGTGGACAGGTGGATCAGGG - Intronic
1179623354 21:42633084-42633106 TGGTGGGCAGAGATGGAGGACGG - Intergenic
1180060110 21:45380659-45380681 GTGTGTGCACAGATGGATGCTGG - Intergenic
1180060130 21:45380793-45380815 GTGTGTGCACAGATGGATGCTGG - Intergenic
1180626216 22:17195204-17195226 CTATGTGCACAGATAGATGCAGG - Intronic
1180946454 22:19696337-19696359 CGGCGTGACCAGCTGGATGATGG - Intergenic
1183005710 22:34900002-34900024 CACTGGCCACAGATGGATGAGGG - Intergenic
1183698484 22:39436710-39436732 CAGTGGACACAGATGCATGAGGG - Intronic
955009448 3:54999986-55000008 CTGTGTGCCCACATGGATGGTGG - Intronic
957499350 3:81033839-81033861 CCTTTTGCCCAGATGGATGATGG - Intergenic
964098170 3:152957817-152957839 CTGTGTAGACAGATGTATGAGGG - Intergenic
967296186 3:187967376-187967398 CAGTGTGCAGGGATGGATGTGGG + Intergenic
969453975 4:7290658-7290680 ATGTGTGCATACATGGATGAGGG - Intronic
969462554 4:7336413-7336435 CAATGCGAACAGATGGATGAAGG + Intronic
970356511 4:15258994-15259016 CTGTATGCACAAATGCATGAAGG - Intergenic
972027682 4:34406007-34406029 CTGTGTGCACAGATATATGTGGG + Intergenic
972265803 4:37458496-37458518 TGGTGTCCACAGATGCATGGAGG - Intronic
984998937 4:185465890-185465912 TGGTGAGAGCAGATGGATGAGGG + Intronic
985661228 5:1157668-1157690 AGGTGTGGACAGATGTGTGAAGG - Intergenic
989725948 5:44586982-44587004 ATGTGTGCAGGGATGGATGAGGG - Intergenic
992950649 5:81853892-81853914 CAGTGTGGACAGGTGAATGAAGG + Intergenic
998919902 5:147056564-147056586 CAGGGTTCACAGATTGATGAAGG - Intronic
999148550 5:149411896-149411918 CTGTGTGCCCAGAGGGATAATGG - Intergenic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1006912404 6:37571934-37571956 CGGTGAGCACAGATGGTGCAAGG - Intergenic
1016127119 6:140417524-140417546 CCCTGTGCACAGTTGGTTGAAGG - Intergenic
1016627803 6:146192867-146192889 AGGTGGGCACAGCTGGAAGAAGG + Intronic
1018736759 6:166692399-166692421 GCGTGTGCAGAGATGGACGATGG + Intronic
1018951730 6:168382775-168382797 CTGTGTCCACAGCTGGATGGGGG - Intergenic
1019524303 7:1473886-1473908 GCATGTGCCCAGATGGATGAGGG + Intronic
1021842163 7:24729613-24729635 CTGTCTGCACAGAGGCATGAAGG - Intronic
1022177218 7:27883072-27883094 AAGTGTGCACTGATGGATGTTGG + Intronic
1022223823 7:28342278-28342300 CGGTGTGGAAGGATAGATGAGGG + Intronic
1027231105 7:76273001-76273023 CGGAGTGGACAGATGGGTGAAGG - Intronic
1028231291 7:88309308-88309330 GGGTGTGCACCCATGGAAGAAGG + Intergenic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1029389741 7:100267032-100267054 GGGTGGGTACAGATGGATCAGGG - Intronic
1031968831 7:128048915-128048937 CCGTGTGAACAGCTGGAAGAAGG - Intronic
1033242245 7:139689990-139690012 CGGTGTGCACAGGGGGCTGGGGG + Intronic
1035576426 8:709824-709846 CTGTATGCATGGATGGATGATGG - Intronic
1045803418 8:106128096-106128118 CAGTTTGCACAGATGGTTAAGGG - Intergenic
1047315539 8:123729954-123729976 TTGTGTGCACAGGTGGATGGTGG - Intronic
1047643294 8:126843804-126843826 CAGTTTGCACAGATGGAAGCAGG - Intergenic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1052605149 9:30689477-30689499 CGGGGAGGACACATGGATGACGG + Intergenic
1055023985 9:71699710-71699732 CAGTGTGCACAAATGCATGGGGG - Intronic
1056268764 9:84925681-84925703 CGGAGAGGAAAGATGGATGAGGG + Intronic
1059393653 9:114017160-114017182 CAGTCTGAACAGATGCATGAAGG + Intronic
1061819900 9:133221383-133221405 GGGTGTGCACAGATGCAGGGAGG + Intergenic
1062172270 9:135141566-135141588 ATGAGTGGACAGATGGATGATGG + Intergenic
1062240756 9:135536565-135536587 GGGTGTGCACAGATGCAGGGAGG - Intergenic
1186576240 X:10768974-10768996 GGGTGTGCACACATGTAGGAGGG + Intronic
1188655627 X:32691757-32691779 CAGTGTCCACTGATGGATGAGGG + Intronic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1197424374 X:126277131-126277153 CTGTGTTCATTGATGGATGAAGG + Intergenic
1199054887 X:143282168-143282190 GGCTGTGGACAGATGTATGATGG - Intergenic
1201266033 Y:12207615-12207637 CAGTGTCCACTGATGGATGATGG - Intergenic