ID: 1091033730

View in Genome Browser
Species Human (GRCh38)
Location 11:132214478-132214500
Sequence AGTTATAGGCATAAAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 389}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091033730_1091033735 15 Left 1091033730 11:132214478-132214500 CCTGCCATTTTATGCCTATAACT 0: 1
1: 0
2: 3
3: 34
4: 389
Right 1091033735 11:132214516-132214538 TTTGTTGTTGTTCTATGCTTTGG 0: 1
1: 0
2: 10
3: 71
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091033730 Original CRISPR AGTTATAGGCATAAAATGGC AGG (reversed) Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
903729114 1:25477301-25477323 AGTAAAAGGCAGAAAATGTCTGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904758587 1:32784379-32784401 ATATATAGGAATAAAATGGGGGG - Intronic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906723450 1:48025976-48025998 AGTCCTAGGCAGAAATTGGCAGG + Intergenic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910150303 1:84134354-84134376 AATTCTAGGCAGAAAAGGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911303140 1:96200188-96200210 AGTTATAGTCTTAAAAAGGCTGG + Intergenic
911706631 1:101021277-101021299 AATTATCAGCAGAAAATGGCAGG + Intronic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
913097623 1:115534546-115534568 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
915812560 1:158930228-158930250 AGTTAAAGACAGAAAATGGAGGG + Intergenic
915841544 1:159217176-159217198 AGTGATAGGGATAGATTGGCAGG - Intergenic
915881459 1:159676684-159676706 CGTTACAGGCATAAATTGGTTGG + Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918263295 1:182816760-182816782 TGTGATAGTAATAAAATGGCAGG - Exonic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920461889 1:206146874-206146896 ATATATATGCATAAAAAGGCAGG + Intergenic
920543049 1:206793660-206793682 GGTTCCAGGCATAAAATGGAGGG - Intergenic
921679970 1:218020109-218020131 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
922437382 1:225619789-225619811 AATTATAGACATCAAATGTCTGG + Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063727945 10:8659953-8659975 AGATATATGCATAAAGAGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1064803944 10:19109524-19109546 AGGTATAGGCTTCAAATAGCTGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065428771 10:25632416-25632438 AGCTATCTGCATAAAATGGGGGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070073899 10:73116445-73116467 ATTTAGAGGCATATAAAGGCTGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073614902 10:104983820-104983842 AGATATAGGCAGAGAATGGAGGG - Intronic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1075057460 10:119230183-119230205 GGTTTTAGGCAAAAAATAGCCGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077738267 11:4815439-4815461 TTTTATAGGAATAAAATGGGAGG + Intronic
1077778494 11:5298148-5298170 AATTTTAGGCAGAAAAGGGCGGG - Intronic
1080654809 11:34250495-34250517 ATTTATTGACATCAAATGGCAGG + Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081239111 11:40681601-40681623 AAGACTAGGCATAAAATGGCTGG + Intronic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1085024870 11:73230492-73230514 AGTCATTTGCATAAAATGTCTGG - Intronic
1085870832 11:80347344-80347366 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088269982 11:108024190-108024212 AATTATAGGCAGTAAGTGGCAGG - Intronic
1088715383 11:112544272-112544294 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090220238 11:125014812-125014834 ATTTCTAGGCATAAATTGGTTGG - Intronic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091033730 11:132214478-132214500 AGTTATAGGCATAAAATGGCAGG - Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093392086 12:18635562-18635584 GGTTATCTGCATAAGATGGCAGG + Intronic
1093415021 12:18909713-18909735 AGTTATAGTCATTTAATGGATGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094631677 12:32181568-32181590 ATTTATATGCATAAAATGAGAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096316350 12:50570412-50570434 AGATACAGGCAGTAAATGGCTGG + Intronic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097076998 12:56402414-56402436 AGTTATCGCCAGAAGATGGCAGG - Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098124128 12:67272394-67272416 TGTTATAGGCATAAAATTTCAGG + Intronic
1098146993 12:67507736-67507758 AGATATAGACATGGAATGGCTGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098936837 12:76490226-76490248 AATTCTAGGCAGAAAACGGCAGG + Intronic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099540828 12:83905155-83905177 AATTGTAGGCAGAAAAGGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100293007 12:93235436-93235458 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1100757988 12:97773361-97773383 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1101920518 12:108928862-108928884 AAATAAAGTCATAAAATGGCCGG - Intronic
1101924429 12:108959288-108959310 TGTTAAAGGCCTAAAATGCCAGG - Intronic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103042676 12:117708908-117708930 AGTTAGAAGCCTAAAATGGTAGG + Intronic
1103054017 12:117804337-117804359 AGGTATAGACAATAAATGGCCGG - Intronic
1105522523 13:21143683-21143705 ATTTTTAGGGTTAAAATGGCAGG + Intronic
1107279143 13:38713558-38713580 AGTTAAGGCCATAGAATGGCTGG - Intronic
1107308439 13:39048754-39048776 AAATGTAGGAATAAAATGGCTGG + Exonic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109353610 13:61213588-61213610 AATAATTGGCATAGAATGGCAGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111606474 13:90546061-90546083 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114703348 14:24701040-24701062 AGGAATAGCCATATAATGGCTGG + Intergenic
1115041003 14:28927586-28927608 AGTAAAAGGCATAAAATTGGAGG - Intergenic
1115775831 14:36714171-36714193 AGTTATAACAATAAAATGACAGG + Intronic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118408570 14:65452005-65452027 AATTCTAGGCAGAAAATGGTGGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1121361842 14:93268728-93268750 AGTTAGAGGCATAAAAGGCTGGG - Intronic
1124004203 15:25783551-25783573 AAGTAGAGGCTTAAAATGGCAGG - Intronic
1126030520 15:44492828-44492850 AGTAATAAGCATAAAATGATGGG - Intronic
1126294765 15:47127330-47127352 ATTGAAAGACATAAAATGGCTGG - Intergenic
1126568613 15:50126566-50126588 AGTTATAGTCATAAGATGTTTGG - Intronic
1126650949 15:50920692-50920714 TGTAGAAGGCATAAAATGGCCGG - Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1128886952 15:71296823-71296845 AGTTATAGCTAATAAATGGCAGG - Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1140243701 16:73228936-73228958 AGTTGTAGTCCTAAAATAGCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1149237233 17:54606877-54606899 AATTATAGGCAAAAAAGGGCAGG + Intergenic
1150892428 17:69168598-69168620 AGTTACAGGAATAAAATTGGAGG + Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154232379 18:12569042-12569064 AAATACAGGCATAACATGGCCGG + Intronic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155571213 18:27196012-27196034 ATTTGTAGGCTTAAAATTGCAGG + Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156025822 18:32654047-32654069 AGTTATTGGCATTAAAGGGGAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156650677 18:39223121-39223143 AGTTGTAGTCAGACAATGGCTGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164190010 19:22905680-22905702 ATTTATAAGAATAATATGGCCGG - Intergenic
1165352764 19:35285104-35285126 AGGTCTTGGAATAAAATGGCTGG + Exonic
1166823391 19:45594501-45594523 AGTAATATCCATAAATTGGCCGG - Intronic
1166944970 19:46390796-46390818 AATTACAGACATAAAATAGCTGG - Exonic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
926590693 2:14737275-14737297 AGTTAGAGGCATTAAATGGCAGG + Intergenic
927705577 2:25294511-25294533 AGTTATATGCATAAAAGGTAGGG + Intronic
927823141 2:26286905-26286927 ATTTAAAAGCATAAACTGGCCGG + Intronic
930527221 2:52545328-52545350 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
931567200 2:63627408-63627430 AATTCTAGGCAGAAAAGGGCGGG + Intronic
932958415 2:76383423-76383445 ATTTAAAGACATAAATTGGCTGG - Intergenic
933010789 2:77060227-77060249 AGTTATAGGCATATATTTACAGG - Intronic
935388787 2:102528849-102528871 AGTCAAAGCCATAAAATGCCAGG + Intronic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
937840342 2:126518741-126518763 AATTCTAGGCAGAAAAAGGCAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940481745 2:154241197-154241219 GGTTATAGGCACAGGATGGCAGG + Intronic
941624281 2:167813502-167813524 ATAAATAGGCATAAAATGGGGGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942158817 2:173160365-173160387 AGTTTTAGACATAGAAAGGCTGG + Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943362532 2:186938560-186938582 AGTTAAAGACATAAAATGGATGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943780693 2:191820490-191820512 AGTCATTGGGATGAAATGGCTGG - Intergenic
944067455 2:195633951-195633973 AATTCTAGGCAGAAAAGGGCAGG - Intronic
944199443 2:197090585-197090607 AATTCTAGGCAGAAAAGGGCAGG + Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946094165 2:217258091-217258113 CTTTATAGGCAGAAAAGGGCTGG - Intergenic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946680870 2:222214495-222214517 GGTTAATGGCATAAAATGCCAGG - Intronic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947563327 2:231177129-231177151 AGATCTAGGCAGAAAATGGCGGG - Intergenic
1169082094 20:2803782-2803804 AGATATAAGCATTAAAAGGCAGG - Intergenic
1169486430 20:6038014-6038036 AGTTAAAGGAATAAAAGAGCTGG + Exonic
1169915103 20:10675314-10675336 AGTTATGAGCATAAAAGGGTGGG + Intergenic
1174328559 20:49799208-49799230 AGTTAAAAGCATAAATAGGCTGG + Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177281373 21:18986998-18987020 AATTCTAGGCAAAAAACGGCAGG + Intergenic
1177571253 21:22890081-22890103 TCATATTGGCATAAAATGGCAGG - Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178153792 21:29827907-29827929 AGTTAGAGGCTTGAATTGGCTGG + Intronic
1178171513 21:30045958-30045980 AGATAAAGGCATAAAATGAAAGG - Intergenic
1178280454 21:31277880-31277902 GGATACAGGCATAAAATGACAGG + Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
950031219 3:9855102-9855124 AGTTCTGCTCATAAAATGGCAGG - Intronic
950319371 3:12035963-12035985 AGTTAGAGCCATAAAATGTTTGG - Intronic
951069749 3:18313285-18313307 ATATCTAGGCATAAAATGGCTGG + Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957188572 3:76975725-76975747 AGTTATAGTCATAAATTGACTGG - Intronic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960201725 3:114844573-114844595 ACATGTAGGCATGAAATGGCTGG + Intronic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
960906536 3:122607300-122607322 AGTTATAGGCATAGTGTGGTGGG + Intronic
961107157 3:124251776-124251798 AGGTATAGCCATAAAGTGACAGG - Intronic
961783364 3:129334721-129334743 AGTTCTGCTCATAAAATGGCAGG - Intergenic
963118545 3:141755383-141755405 AGTCATAGAAATAAAATTGCTGG - Intergenic
963410618 3:144922389-144922411 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
964467093 3:157006483-157006505 ATACATAGGCATGAAATGGCTGG - Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
964930163 3:162009800-162009822 ATTTATAGCCCTACAATGGCTGG - Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
967571118 3:191029349-191029371 AGTTATAGGCCTAAAAAGGAAGG + Intergenic
970131599 4:12877152-12877174 AATTCTAGGCAGAAAAAGGCAGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
972905420 4:43740614-43740636 AGTTATTCCCTTAAAATGGCAGG - Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973130193 4:46639725-46639747 AGTTATATTCAGAACATGGCAGG + Intergenic
974540517 4:63227244-63227266 AGCTAGAGGCATAAACTGGGTGG - Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977338757 4:95730420-95730442 AATTCTAGGCATAAAAGGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977595308 4:98873044-98873066 AGTGATTGGCACAAAATGACAGG + Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977781396 4:100985703-100985725 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
981822562 4:148902777-148902799 AGTTATAGACCTAAGAGGGCTGG + Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982978358 4:162097160-162097182 AGTTATAGGCATAATATATTAGG + Intronic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983256475 4:165405892-165405914 TTATATTGGCATAAAATGGCAGG + Intronic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
990561197 5:56984935-56984957 AGTTATAAGAATAAAATGTCAGG + Intergenic
990632923 5:57690739-57690761 AGTTATAGGTAAAGAAAGGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992936355 5:81710802-81710824 AGGAATAGGCAAAAATTGGCAGG + Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993783936 5:92105367-92105389 AGTTATACCCATAAAATCACTGG + Intergenic
994830479 5:104775222-104775244 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996344252 5:122472572-122472594 AGTTACAGGCAGTAAATAGCAGG + Intergenic
998297280 5:140983713-140983735 ACTTATATTCATAACATGGCTGG + Intronic
1000894620 5:166840686-166840708 AGTGATAGGAAGAAAATGGCTGG + Intergenic
1001169088 5:169400920-169400942 AGTTATTGGCATAATATGGATGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1004035975 6:11924416-11924438 TTTTTTAGGAATAAAATGGCTGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005657441 6:27955752-27955774 AGTTCTCAGTATAAAATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007999505 6:46344168-46344190 AGTTATACACATAAAATGTGCGG + Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008857031 6:56100974-56100996 AGTTGTAGGAATAAAATGTGGGG + Intronic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1014252267 6:119127177-119127199 AATTCTAGGCATAAAAGGGTGGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016292148 6:142537911-142537933 AGATAGAGGCGTAAAATGGTGGG - Intergenic
1016576261 6:145572615-145572637 AGTTATCTGCAGAAAACGGCAGG + Intronic
1016967273 6:149730631-149730653 ATTTAAAAGTATAAAATGGCTGG + Intronic
1017584804 6:155909063-155909085 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019115048 6:169753078-169753100 AGTTTTAGGCTTCAAAGGGCAGG + Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021052431 7:16004744-16004766 AGTTATAGGAATAAAGCAGCAGG - Intergenic
1021513453 7:21458478-21458500 ATTTATAGACATAAACTGGCCGG - Intronic
1022563037 7:31369619-31369641 AGTTCTAGGCAGAAAAGGGCAGG - Intergenic
1023445611 7:40228569-40228591 ACTAAGAGGCATATAATGGCTGG + Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024808914 7:53184281-53184303 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1027479577 7:78678797-78678819 AGAAATAAGAATAAAATGGCAGG + Intronic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1027992153 7:85376454-85376476 TGTTATAGGAACAAAATGGCTGG - Intergenic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028462332 7:91108611-91108633 AGTTATAAACATATAGTGGCAGG - Intronic
1029559832 7:101295249-101295271 AGTTAAAGGCCTAAAGTGGCCGG - Intergenic
1030004184 7:105098986-105099008 AGTTAGAGCTATAAAATGGGAGG + Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030350886 7:108484935-108484957 TGGTATAGGCATAATTTGGCAGG + Intronic
1031116336 7:117673038-117673060 AATTCTAGGCAGAAAAGGGCGGG + Intronic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032797591 7:135290207-135290229 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1035495057 7:159317451-159317473 ATTTATGGGCAGAAAATGGAAGG - Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038449733 8:27632491-27632513 ACATATATGCAGAAAATGGCAGG - Intergenic
1038665043 8:29530585-29530607 AATTATTGGCATGAAACGGCAGG + Intergenic
1038954740 8:32455331-32455353 ATTTATAGGCATAAAAAGGATGG - Intronic
1039679129 8:39709528-39709550 AATTTTAGGCAGAAAAAGGCAGG - Intronic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043284421 8:78511948-78511970 AGTCAAAGACATTAAATGGCAGG - Intergenic
1043629917 8:82317678-82317700 AGTGTTAGGCATGAAATTGCAGG - Intergenic
1043669643 8:82866082-82866104 AGTGCTAGCCATAAAATGTCTGG - Intergenic
1043701397 8:83292234-83292256 AATTCTAGGCACAAAAGGGCAGG - Intergenic
1043857878 8:85282393-85282415 AGTTAATGTCATAAACTGGCAGG - Exonic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045160341 8:99534838-99534860 AGCTATAGGAATAAATTTGCAGG - Intronic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047883122 8:129218385-129218407 TTTTATAGGCACAAAATGGAGGG - Intergenic
1048089970 8:131229186-131229208 AGTTATTTCCATAAACTGGCTGG - Intergenic
1049448760 8:142647022-142647044 AGGTATAGGCAGAAAAAGCCTGG + Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051384146 9:16488874-16488896 AATTACAGGCAAAAAATGGTAGG + Intronic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052518746 9:29515155-29515177 CGTTCTAGGCAGAAAAGGGCAGG - Intergenic
1052593706 9:30531561-30531583 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054980715 9:71202568-71202590 ATTTCTAGGTATAAAGTGGCAGG + Intronic
1055067160 9:72130675-72130697 AGTTACAGGAATAACAAGGCAGG + Intronic
1055101270 9:72468069-72468091 AGTTCCAGGCATAAAATGATAGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058726319 9:107808181-107808203 AGTTAAAGTCAGGAAATGGCAGG + Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186216660 X:7307923-7307945 AGTTAGAGCCATAAAATGTTTGG - Intronic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187090034 X:16086445-16086467 AGCTTTAGGCATAAAAAAGCAGG + Intergenic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188986177 X:36770307-36770329 TTTCATAGGGATAAAATGGCAGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190527882 X:51346279-51346301 AGTTATATGCAGAGCATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193405675 X:81098245-81098267 TGTTGTAGGCATATAATGACTGG - Intergenic
1193585384 X:83315209-83315231 AGTTTTAGGGGTAAATTGGCAGG - Intergenic
1193809926 X:86039595-86039617 AATTCTAGGCAGAAAAGGGCAGG + Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194176257 X:90651714-90651736 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194690706 X:96980601-96980623 AGCTCTAGGCAGAAAAGGGCAGG - Intronic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG + Intergenic
1197587701 X:128369969-128369991 CTTTATAGCCATAAAATGGATGG + Intergenic
1198169813 X:134094639-134094661 TGTTATAAGCAGAAAATGTCTGG + Intergenic
1198589681 X:138163374-138163396 AGTGTTAGTCACAAAATGGCTGG - Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1198770364 X:140124437-140124459 AGTTATTGGCCTAAAATAGGAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199219947 X:145306252-145306274 AATTCTAGGCAGAAAATGGTGGG - Intergenic
1199706652 X:150432103-150432125 AGTAATAGCCATTAAATGTCTGG + Intronic
1200522882 Y:4232659-4232681 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1201646380 Y:16237037-16237059 TGTTTCAGGCATAAAATGGGTGG - Intergenic
1201656433 Y:16348280-16348302 TGTTTCAGGCATAAAATGGGTGG + Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic