ID: 1091035042

View in Genome Browser
Species Human (GRCh38)
Location 11:132225225-132225247
Sequence GGGCTGCAGTATGGGAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091035038_1091035042 -10 Left 1091035038 11:132225212-132225234 CCTTTGCCTCATCGGGCTGCAGT 0: 1
1: 0
2: 1
3: 12
4: 142
Right 1091035042 11:132225225-132225247 GGGCTGCAGTATGGGAGTGTAGG 0: 1
1: 0
2: 2
3: 27
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091035042 Original CRISPR GGGCTGCAGTATGGGAGTGT AGG Intronic
900531232 1:3154468-3154490 GGGCTGCAGCATGGAGCTGTGGG + Intronic
901843223 1:11966448-11966470 GGGCGGCAGGATGGGAGTTGGGG + Intronic
901843244 1:11966491-11966513 GGGCGGCGGGATGGGAGTGGGGG + Intronic
902616499 1:17626288-17626310 GGGTTGCAGGAAGGGAGTGAAGG + Intronic
904611111 1:31726884-31726906 GGGAAGCAGATTGGGAGTGTGGG - Intergenic
904779760 1:32936922-32936944 AGGCTGCAGTATGGGAGCGGGGG + Exonic
905249493 1:36638782-36638804 GGGGTGCAGCATGGGAGGGTTGG + Intergenic
905480946 1:38261575-38261597 GGGCTGCAGGTTGGGGGTGATGG + Intergenic
912984828 1:114417548-114417570 GGGAGGCAGTGTGGGATTGTAGG - Intronic
913365144 1:118029186-118029208 AGGCTGGAGTATGGTAGTGTGGG - Intronic
914763766 1:150620327-150620349 GCCCTACAGTATGGGAGTGAAGG + Intronic
915921755 1:159981061-159981083 GGGCTGCAGCATAGGAGTTTTGG - Intergenic
916518633 1:165543790-165543812 GGCCTGCAGCATGTGTGTGTTGG - Intergenic
917426215 1:174917195-174917217 GGGCTTCAGTATCTCAGTGTGGG + Intronic
920842995 1:209570544-209570566 GGGCTGCAGTAAGGAATTATGGG - Intergenic
922740424 1:228011217-228011239 TGGCTGCAGCATGGGTGTTTCGG + Intronic
923096428 1:230778703-230778725 GGGCTGAAGGATGGGAGCGTAGG - Intronic
923672391 1:236051692-236051714 GAGCTGCCGTGTGGGAGCGTGGG + Intronic
1062961773 10:1577746-1577768 GGGCTTCAGCATGGGACTTTGGG - Intronic
1067467295 10:46510662-46510684 GCCCTGCAGTGTGGGAGTGCAGG - Intergenic
1067619891 10:47873943-47873965 GCCCTGCAGTGTGGGAGTGCAGG + Intergenic
1067800303 10:49353945-49353967 GGGCTGCTGGATAGGAGTCTTGG - Intergenic
1069358537 10:67615070-67615092 GGGCTTCAATATGTGAATGTTGG + Intronic
1069726283 10:70582268-70582290 GGGGTGTAGAAGGGGAGTGTTGG - Intergenic
1070640233 10:78163125-78163147 GGGATGCAGTATGGAAGAGCTGG + Intergenic
1072522085 10:96237785-96237807 GAGCTGCAAAATGGGAGTCTGGG + Intronic
1075058156 10:119235503-119235525 GTGCTGCAGAGTGGGAGTCTGGG + Intronic
1075575965 10:123577741-123577763 GGGCTGTAGTTTGGTAGTTTGGG - Intergenic
1076125393 10:127970152-127970174 CAGCTGGAGTCTGGGAGTGTGGG - Intronic
1076354614 10:129842711-129842733 GGAGTGCAGTAGGGCAGTGTCGG - Intronic
1076398397 10:130158618-130158640 GAGCTGGAGGATGGTAGTGTAGG + Intronic
1076823051 10:132951233-132951255 GGGCTGCAGTACGGCAGCCTTGG + Intergenic
1077063220 11:626699-626721 GGCCTGCAGGATGGGCATGTTGG + Exonic
1077640944 11:3880978-3881000 CGGCTGCAGGATGGGAGAGCAGG + Intronic
1078140606 11:8689935-8689957 GGCCCGCAGTATGGCAGTGTTGG + Intronic
1079291399 11:19191362-19191384 GGGCTGAAGCATGGGGGTGCTGG + Intronic
1081446774 11:43138539-43138561 GGGCTGAAGTATAAGAATGTAGG - Intergenic
1083267674 11:61554307-61554329 GTGCTGCAGTGTGTGTGTGTGGG - Intronic
1083695948 11:64442528-64442550 GGGCAGCAGTAAGGGAGCGAGGG - Intergenic
1083974702 11:66108419-66108441 GGGCTCCAGTATAGGAATTTAGG + Intronic
1085740165 11:79071446-79071468 GTGCTGCAAAGTGGGAGTGTGGG + Intronic
1088140662 11:106612104-106612126 GGGCTTCAATATGTGAGTTTTGG - Intergenic
1088544771 11:110948177-110948199 AGGCCGCAGAATGGAAGTGTAGG + Intergenic
1088826257 11:113496804-113496826 GCCCTGCAGTGTGGGAGTGAGGG + Intergenic
1089196023 11:116694512-116694534 GGATTGGGGTATGGGAGTGTGGG - Intergenic
1090671264 11:128947304-128947326 GGGCTGCAGGAAGTGAGTGGTGG - Intergenic
1091035042 11:132225225-132225247 GGGCTGCAGTATGGGAGTGTAGG + Intronic
1091173717 11:133541486-133541508 GGGCAGGAGTCTGGGAGTGCTGG - Intergenic
1091368333 11:135039708-135039730 GGGCTGCAGTGTGGGGGTCTAGG + Intergenic
1091545274 12:1497546-1497568 GGGCTGCAGTCTGCGAGTCTGGG - Intergenic
1091910058 12:4223119-4223141 GGGGTGAAGTATTGGAGAGTTGG + Intergenic
1093990647 12:25586369-25586391 GGGCTGCATGAAGGTAGTGTTGG - Intronic
1096100098 12:48965636-48965658 AGGCTGCAGTAAAGGAGTTTGGG + Exonic
1097107082 12:56632305-56632327 GGGCGGCGGGATGGGGGTGTGGG + Intronic
1097667779 12:62500495-62500517 GGGCTGAAGAATGGGAGACTGGG + Intronic
1100287885 12:93184700-93184722 GTGCTGCATTATGGGAGGGGTGG - Intergenic
1101149255 12:101869507-101869529 GGGCTGCAGAATGGTTGTGTTGG - Intergenic
1101479109 12:105079774-105079796 GGGATGCAGATTGGGAGTGATGG - Intronic
1102548749 12:113675450-113675472 GGGCTGGAGGAGGGGAGGGTTGG - Intergenic
1102949219 12:117018204-117018226 GGGCTGGAGAGAGGGAGTGTTGG + Intronic
1103998374 12:124844469-124844491 GGGCTGCAACATGGGAATTTTGG - Intronic
1106084294 13:26526422-26526444 GGGCTTCAGCATATGAGTGTTGG - Intergenic
1106982319 13:35302042-35302064 GGGCTGCAGTAGGGAGGAGTTGG + Intronic
1107424967 13:40283621-40283643 GGGCAGCAGCATGGGCATGTGGG - Intergenic
1109741854 13:66563947-66563969 GGGCTGTGGTAAGGGAGAGTAGG - Intronic
1110552586 13:76825710-76825732 GGGCTTCAGCATGGGAATGTGGG - Intergenic
1111145256 13:84170534-84170556 GTGCTGCAGTATGGTGGTGGTGG + Intergenic
1112242130 13:97692786-97692808 GTGCTGCAGTAGAGGGGTGTTGG - Intergenic
1112505512 13:99972230-99972252 GGGCTGCTGTTTGGGAGAGAAGG + Intergenic
1113454553 13:110438809-110438831 GGGCTGCTGTGTGTGTGTGTGGG - Intronic
1113539510 13:111095246-111095268 GGGCTGGTGTAGGGGAGTGGGGG + Intergenic
1117049623 14:51847176-51847198 AGGCTGCAGACTGGGAGGGTGGG + Intronic
1118817698 14:69324527-69324549 GGGATGCAGCATGGGGGTGGAGG + Intronic
1119233287 14:72998132-72998154 GTCCTGCACTGTGGGAGTGTGGG - Exonic
1121021997 14:90585888-90585910 GACCTGATGTATGGGAGTGTTGG - Intronic
1122025307 14:98871597-98871619 GGGGTGCAGTGTGGCAGGGTGGG - Intergenic
1122858476 14:104571573-104571595 GGGCTGCAGGAGAGGAGTGTGGG - Intronic
1126568109 15:50121326-50121348 GGGCTGCAGGAAGAGAGTATGGG + Intronic
1126695723 15:51323773-51323795 GGGATGCAGTATGGGAAGGCTGG - Intronic
1128798073 15:70479339-70479361 GGGCTGGAGAATGGGAGGGAGGG - Intergenic
1128866343 15:71117491-71117513 GGGGGACAGAATGGGAGTGTTGG - Intronic
1129517413 15:76165158-76165180 AGGCTGCAGGAGGGGAGAGTGGG - Intronic
1129879847 15:78999313-78999335 GGCCTGCAGGATGGAAGTTTGGG + Intronic
1132546955 16:537632-537654 TGGCTACAGAAGGGGAGTGTCGG + Intronic
1132595258 16:746221-746243 GGGCTGCAGGAGGGGAGAGGTGG + Intronic
1132595303 16:746396-746418 GGGCTGCAGGAGGGGAGAGGTGG + Intronic
1133102586 16:3488236-3488258 GGGGGGCAGAAAGGGAGTGTGGG + Intergenic
1135864697 16:26090602-26090624 GGGCTGCTGTGTGGCAGTGGAGG - Intronic
1136055611 16:27687091-27687113 AGGCTACAGTCTGGGAGTGAGGG - Intronic
1136560211 16:31034424-31034446 GGGCTGCTGTTTGGGAGTCTTGG + Intronic
1137621247 16:49877812-49877834 GGGCTGGAGCATGTGAGTCTGGG - Intergenic
1138293413 16:55867313-55867335 GGGCAGCAGCATGGGGGTGTGGG - Intronic
1139535130 16:67567392-67567414 GGACTCCAGTATGGAAGTGTTGG + Intronic
1139635034 16:68253319-68253341 GGGCTGCTGTATGGGTGGGTAGG - Intronic
1141417268 16:83885580-83885602 GGGCTGTGGTATGTGAGCGTGGG - Intergenic
1141555629 16:84834962-84834984 GGGCTCCAGTGTGTGAGTTTGGG + Intronic
1142312361 16:89321386-89321408 GGGCTGCAGGGCGGGACTGTGGG + Intronic
1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG + Exonic
1143569067 17:7743169-7743191 GAGCTGCAGAAGGGGAGTATAGG - Intronic
1144716063 17:17436673-17436695 TGGCTGGAGTCTGGGAGAGTGGG + Intergenic
1147190672 17:38736214-38736236 GGGCTCCAGGCTGGGAATGTGGG + Intronic
1149451244 17:56751706-56751728 GGGGTGCAGGGTGGGGGTGTTGG - Intergenic
1150072823 17:62167122-62167144 GGACTGCAGTATGGGTGTGTGGG - Intergenic
1151013731 17:70531035-70531057 GGGGTGGAGGATGGGAGGGTGGG + Intergenic
1152253818 17:79225932-79225954 GGGAAGCAGGATGGGGGTGTGGG + Intronic
1152699903 17:81813594-81813616 GAGCTGCAGTTTGGGAGGGGTGG + Exonic
1153985204 18:10344842-10344864 GGGCTCCAGCATGGGACTGCCGG + Intergenic
1156791472 18:40979880-40979902 GGGCTTCAGTATATGAGTTTTGG + Intergenic
1157625455 18:49047221-49047243 GGACTGCAGTGTGGGGGTGCAGG - Intronic
1161062054 19:2220115-2220137 GGGCTGCAGCACGGGACTGGGGG - Exonic
1161343285 19:3754136-3754158 GGGCTGCAGGCTGGGTCTGTGGG - Intronic
1161966824 19:7553747-7553769 GGGCTGCAGTCTGGGAGCACAGG + Intronic
1161972520 19:7590584-7590606 GGGCTGCAGTTTGGGAAGGATGG - Intergenic
1162389342 19:10379992-10380014 GGGCGCCAGTATGGAAGTGGAGG + Intronic
1162528751 19:11223130-11223152 GGGCTGAGGTTTGGGTGTGTGGG - Intronic
1162787399 19:13044258-13044280 GGGCTGTGGCATGGCAGTGTGGG + Intronic
1163743718 19:19032914-19032936 GGGCTGAAGGATGGGACTGGGGG - Intronic
1163745345 19:19043428-19043450 GGGCAGGAGGAGGGGAGTGTGGG - Intronic
1164598894 19:29548089-29548111 GGGCTGCAGCAGGGGAGAGAGGG + Intronic
1165461855 19:35948585-35948607 GGGCTGAAGTAGGGGAGGGAAGG + Intergenic
1166297462 19:41896081-41896103 GGGCTGCAGTCTGGTTGGGTGGG + Intronic
1166965791 19:46528756-46528778 GGGCTGCAGTGTGTGTGCGTGGG - Intronic
1167315320 19:48759499-48759521 GGGCTGGAGGGTGGGAGTTTGGG + Intergenic
1167348682 19:48962274-48962296 GAGCTGGAGAATGGGAGTGGGGG + Intergenic
1167603317 19:50466987-50467009 GGCCTGCAGTTAGGGAGTGAGGG + Intronic
925372798 2:3359963-3359985 GGGCTGAACGTTGGGAGTGTGGG - Intronic
925535956 2:4916915-4916937 GGGTTGCAGGATGAGAATGTTGG - Intergenic
925611377 2:5705783-5705805 GGGGTGGAGTTTGGGAGTCTGGG + Intergenic
925916604 2:8611382-8611404 GGGCAGCAGTGTGGTAGGGTTGG - Intergenic
926172188 2:10559341-10559363 GGGCAGCAGGATGGGGGTGTGGG - Intergenic
927442345 2:23128126-23128148 GGGTTGCAGCTGGGGAGTGTGGG - Intergenic
927972806 2:27316388-27316410 GGGCAGCAGTAGGGGTGAGTAGG + Intronic
930620260 2:53636052-53636074 AGGCTCCAGTAAGGGAGCGTGGG - Intronic
931817019 2:65914397-65914419 GGGCTGCAGCCTGGGAGGGGTGG + Intergenic
932236593 2:70125384-70125406 GGGCTGCCGCTTGGGTGTGTGGG - Intergenic
932327795 2:70874725-70874747 GGGCTGGAGGTTGGGAGGGTTGG + Intergenic
938341348 2:130538625-130538647 GGGCTGCAGAGTGGGACTGCTGG - Intergenic
938348483 2:130582084-130582106 GGGCTGCAGAGTGGGACTGCTGG + Intronic
941943611 2:171070721-171070743 GTGCTGCAAAATGGGAGTGCAGG + Intronic
942457043 2:176145374-176145396 GGGCAGCAGTGTGGGTGTGGGGG + Intergenic
945199216 2:207264619-207264641 AGGCTGCAGTCTGGGAGCCTGGG + Intergenic
945977215 2:216280292-216280314 GTGCTGCAGGATGGGAGTTCAGG - Intronic
946482047 2:220066570-220066592 GGGCTGGAGGATGGGAGGATGGG - Intergenic
948070360 2:235116415-235116437 GGCCTGCAGGATGGGAGCATCGG - Intergenic
948646366 2:239407634-239407656 GGGTGGCTGTCTGGGAGTGTGGG - Intergenic
1168978238 20:1983828-1983850 GAGCTGAAGTGTGGGATTGTAGG - Intronic
1169522545 20:6389044-6389066 GGGATCCATTATGGGAATGTTGG + Intergenic
1169952803 20:11064690-11064712 GGGATGGAGCATGGGAGTGCGGG + Intergenic
1170788205 20:19486014-19486036 CAGCTGCAGTGTGGGGGTGTGGG + Intronic
1171418369 20:24999257-24999279 GGGCTCCATAATGAGAGTGTGGG + Intergenic
1172033608 20:31997395-31997417 CGGTTGCAGTACCGGAGTGTGGG + Exonic
1172072931 20:32271990-32272012 GGGTGGCAGCAGGGGAGTGTGGG - Intergenic
1175321305 20:58090299-58090321 GGAGTGCAGTCTGGGAGTTTGGG - Intergenic
1175336245 20:58198226-58198248 GGGCTGCAGGATGGGCGGGGAGG + Intergenic
1176658746 21:9614106-9614128 GGGATGCAGCATGGGAGTGCCGG + Intergenic
1176658760 21:9614162-9614184 GGGGTGCAGCGTGGGAGTGCCGG + Intergenic
1176658769 21:9614190-9614212 GGGGTGCAGCGTGGGAGTGCCGG + Intergenic
1176658812 21:9614358-9614380 GGGGTGCAGCGTGGGAGTGCCGG + Intergenic
1176658828 21:9614414-9614436 GGGGTGCAGCGTGGGAGTGCCGG + Intergenic
1176658837 21:9614442-9614464 GGGGTGCAGCGTGGGAGTGCCGG + Intergenic
1178121652 21:29475598-29475620 GGGCTTCAGTATGTGAATTTTGG + Intronic
1178356400 21:31913391-31913413 GGGCTGCAGCAGGGGAGTACAGG + Intronic
1179090925 21:38264946-38264968 AGGGTTCAGCATGGGAGTGTGGG + Intronic
1180911877 22:19456372-19456394 GGGCTGCCTTATGGGGCTGTTGG + Intronic
1181020723 22:20100811-20100833 AGGCTGCAGTGTGGGAGGATCGG - Intronic
1182712357 22:32330870-32330892 GGTCTGCTGTGTAGGAGTGTTGG + Intergenic
1184479762 22:44739372-44739394 GGGCTGCAGTCCAGGAGGGTGGG + Intronic
952145851 3:30531307-30531329 CGGCTGCTGTCTGGGAATGTTGG + Intergenic
953358620 3:42275733-42275755 GGGATGCAGTGTGGGGGTCTAGG + Intergenic
954257509 3:49416884-49416906 GGGCTGCTGTAGGGCAGGGTGGG - Exonic
954371412 3:50171275-50171297 GAGCTGGAGTTTGGGAGTGCTGG + Intronic
959864382 3:111249592-111249614 GTGTTGCATTAAGGGAGTGTAGG + Intronic
962839618 3:139221909-139221931 GGGCTGCAGTATGGAAGCCTGGG + Intronic
964256434 3:154779718-154779740 GTGCTGGAATATGGGAGTGAGGG - Intergenic
966142455 3:176771265-176771287 GGGTTGCAGAAGGGTAGTGTTGG + Intergenic
966888515 3:184389745-184389767 GGGCAGCAGGAGTGGAGTGTCGG - Exonic
968450027 4:671209-671231 GGGCTGCAGGAAGGGGGTGCTGG + Intergenic
968582307 4:1400827-1400849 GGGCTGCAGGATGGGATGGAGGG - Intergenic
969583134 4:8076994-8077016 GGGCTGCAGGATGGGGGTTGGGG + Intronic
969583148 4:8077036-8077058 GGGCTGCAGGATGGGGGTTGGGG + Intronic
970019678 4:11553928-11553950 GGACAGCAGGAAGGGAGTGTGGG - Intergenic
971246942 4:24937952-24937974 GGGGTGCAGAATGGTTGTGTAGG + Intronic
972089165 4:35258191-35258213 GGCCTGCAATGAGGGAGTGTGGG + Intergenic
973542027 4:51944515-51944537 GGGCTGCAGTATAGTTGGGTTGG + Intergenic
975737113 4:77391941-77391963 GTGCTGTAGTATGAGAATGTGGG - Intronic
978666844 4:111194325-111194347 GTGTTGCAGTATGGGGGAGTGGG + Intergenic
979399804 4:120234819-120234841 GGTGTGCAGTAAGGAAGTGTAGG + Intergenic
981110142 4:140925688-140925710 GGGCTGCAGCATGGGAGGGCAGG - Intronic
981584343 4:146285069-146285091 AGACTGCAGTATGGGAGTGTAGG + Intronic
982685794 4:158487193-158487215 GGGCTTCAGTGAAGGAGTGTGGG - Intronic
985416534 4:189741153-189741175 GGGATGCAGCGTGGGAGTGCCGG - Intergenic
985710662 5:1426776-1426798 GGGCTGCAGTGAGGGAGGATGGG + Intronic
985809796 5:2074603-2074625 GGGCTGCTTTCTGGGAGTCTTGG + Intergenic
992091941 5:73325121-73325143 GTGCTGCAGAATGGGGGTGGGGG - Intergenic
993728207 5:91392411-91392433 GGGGAGCAGTATGAGAGTGAAGG + Intergenic
995795229 5:115934170-115934192 GGGCTGCAGAGAGGGAGTGGTGG + Intergenic
996599818 5:125249878-125249900 GTGCTGCAGTTTGGGAGGGTAGG + Intergenic
998797346 5:145834528-145834550 GGGCTGCATCCTGGGAGTGAAGG - Intronic
1001493147 5:172169493-172169515 GGGCAGAAGAATGGGAGGGTGGG + Intronic
1003557507 6:7153971-7153993 AGGCTGCAGTCTGGAAGTGATGG + Intronic
1005716793 6:28557104-28557126 GGGGTGGAGTAAAGGAGTGTAGG + Intergenic
1005810789 6:29514321-29514343 GGGCTGCAGGAGGGGAGAATAGG + Intergenic
1005989039 6:30892000-30892022 AGACTGCAGTATGGGGGTCTGGG + Exonic
1007112382 6:39320374-39320396 GGGCTGCAGGCTGGCAGTGGGGG - Intronic
1007476272 6:42121953-42121975 GGGGTGCAGTATGGGGGTGCTGG + Intronic
1008813720 6:55537662-55537684 TGCCTGCAGTATCAGAGTGTTGG - Intronic
1009825441 6:68860387-68860409 GGGCTCCAGAATGGGAGAGTGGG - Intronic
1013049407 6:106517635-106517657 GGGCTGCAGTTGGGGAAAGTAGG - Intronic
1013471724 6:110472295-110472317 GGTCTGGAGAGTGGGAGTGTGGG - Intronic
1016880817 6:148910511-148910533 GGGCTGCAGTATGAGAGAGACGG - Intronic
1018326189 6:162671940-162671962 GGGCTGCAGACTGTGAGTGCTGG + Intronic
1019299093 7:294581-294603 GGGCTGCAGTCTGGGCCTCTTGG - Intergenic
1019834670 7:3370934-3370956 GGGCTGCATGTTGGGAGTTTGGG - Intronic
1022466694 7:30656815-30656837 GAGCTGCAGTGTGGGTCTGTGGG + Intronic
1024324889 7:48101815-48101837 TGGCTGCAGTTTGTGTGTGTTGG + Exonic
1026619019 7:71933996-71934018 GGGCTGCCATATGGGAATGTAGG + Intronic
1027163017 7:75815927-75815949 GGGGTTGGGTATGGGAGTGTTGG - Intronic
1033591469 7:142812294-142812316 GGGCTGGAGTATGGTAGCCTGGG + Intergenic
1034461332 7:151199580-151199602 GGGCTGCTGTGTGGGAGTGGAGG - Intronic
1034493363 7:151406185-151406207 GGGCTGCAGAACCGGCGTGTGGG - Intronic
1036500205 8:9307340-9307362 GGACTGCAAGATGGGAGTCTTGG - Intergenic
1036709081 8:11066887-11066909 GTGCTGGGGGATGGGAGTGTGGG - Intronic
1036934707 8:12990007-12990029 GGGCTGGTGTAGGGGAATGTTGG + Intronic
1037721861 8:21451017-21451039 GGGCTGCAGCATTGGAGAGAGGG - Intergenic
1039071062 8:33649795-33649817 GGCCTGCACTATAGGAGTGCAGG + Intergenic
1039400489 8:37265160-37265182 GGGCTGCCTCATGGGACTGTTGG + Intergenic
1039613415 8:38936890-38936912 GGCCTGCAGTGAGGGTGTGTGGG - Intronic
1041872750 8:62653430-62653452 GGGCTTCAGTGTAGGAGTTTTGG + Intronic
1042245242 8:66703547-66703569 AGGCTGCATTATAAGAGTGTCGG + Intronic
1042562964 8:70087206-70087228 AGGCTGCATTATAGGTGTGTAGG + Intergenic
1045555320 8:103209439-103209461 GGGCTGCTGAATGGGAGTCAAGG - Intronic
1046518390 8:115292756-115292778 GGGTTGGAGTAGGGGTGTGTAGG - Intergenic
1046850841 8:118971219-118971241 GGGTTGGAGTTTGGGAGTGAAGG - Intergenic
1048308659 8:133301248-133301270 GGGCTGCAGTACAGGAGTGGGGG - Intronic
1048308676 8:133301337-133301359 GGGCTGCAGTACAGGAATGGGGG - Intronic
1048979332 8:139694713-139694735 GGGCTGGAGTAGAGGAGGGTGGG - Intronic
1049265773 8:141667108-141667130 GGGAGGCAGGATGGGAGTGGGGG + Intergenic
1053237731 9:36470767-36470789 GGGCTGCTGCATGGAAGTGGGGG - Intronic
1053344801 9:37370527-37370549 GGGCTGTGGCATGGGAGTGAGGG + Intergenic
1055268862 9:74532994-74533016 GTGCTGCCTTATGGGAGTGGGGG - Intronic
1057817511 9:98306445-98306467 GGGCTGCAGGGAGGGAGGGTCGG + Intronic
1060600090 9:124871459-124871481 GAGCGGCAGCATGGGATTGTGGG + Intronic
1062474811 9:136721736-136721758 TGGCTGCAGGATGGGGCTGTCGG - Intronic
1062560619 9:137140019-137140041 GGGCTGGAGTGTGTCAGTGTGGG + Intronic
1203636472 Un_KI270750v1:117685-117707 GGGATGCAGCATGGGAGTGCCGG + Intergenic
1203636486 Un_KI270750v1:117741-117763 GGGGTGCAGCGTGGGAGTGCCGG + Intergenic
1203636495 Un_KI270750v1:117769-117791 GGGGTGCAGCGTGGGAGTGCCGG + Intergenic
1203636504 Un_KI270750v1:117797-117819 GGGGTGCAGCGTGGGAGTGCCGG + Intergenic
1203636513 Un_KI270750v1:117825-117847 GGGGTGCAGCGTGGGAGTGCCGG + Intergenic
1203636522 Un_KI270750v1:117853-117875 GGGGTGCAGCGTGGGAGTGCCGG + Intergenic
1203636531 Un_KI270750v1:117881-117903 GGGGTGCAGCGTGGGAGTGCCGG + Intergenic
1203636540 Un_KI270750v1:117909-117931 GGGGTGCAGCGTGGGAGTGCCGG + Intergenic
1203636549 Un_KI270750v1:117937-117959 GGGGTGCAGCGTGGGAGTGCCGG + Intergenic
1203636565 Un_KI270750v1:117993-118015 GGGGTGCAGCGTGGGAGTGCCGG + Intergenic
1203636574 Un_KI270750v1:118021-118043 GGGGTGCAGCGTGGGAGTGCCGG + Intergenic
1203636583 Un_KI270750v1:118049-118071 GGGGTGCAGCGTGGGAGTGCCGG + Intergenic
1189595778 X:42563923-42563945 GGGCTTCAGTTTGGGAGTAGGGG + Intergenic
1194475955 X:94360276-94360298 TGGCTGCAGACTGGAAGTGTGGG - Intergenic
1195243491 X:102976212-102976234 GGACTGCAGTCTAGGAGTCTTGG - Intergenic
1195828452 X:109029186-109029208 GGTCTGAAGTATGGGGCTGTGGG - Intergenic
1196164802 X:112527061-112527083 GGGCTGGGGTATAGGTGTGTTGG - Intergenic
1196742131 X:119034270-119034292 GGGCTGAGCTATGGGAATGTTGG - Intergenic
1196925169 X:120626897-120626919 GGGCTGCAGTAAAGGAGACTTGG - Exonic
1199641829 X:149869364-149869386 GGGCAGGTATATGGGAGTGTAGG - Intergenic
1200307759 X:155045735-155045757 GGGCTGGAGAATTGGAGTCTAGG + Intronic
1201018280 Y:9626003-9626025 GAGGTGGAGTATGGGAGGGTGGG + Intergenic