ID: 1091035445

View in Genome Browser
Species Human (GRCh38)
Location 11:132228721-132228743
Sequence GCCCCTGTGCTGCTTCTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 254}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091035442_1091035445 -10 Left 1091035442 11:132228708-132228730 CCCACACTGACCAGCCCCTGTGC 0: 1
1: 2
2: 2
3: 24
4: 261
Right 1091035445 11:132228721-132228743 GCCCCTGTGCTGCTTCTGAGCGG 0: 1
1: 0
2: 0
3: 30
4: 254
1091035441_1091035445 -3 Left 1091035441 11:132228701-132228723 CCAGCTGCCCACACTGACCAGCC 0: 1
1: 0
2: 3
3: 45
4: 384
Right 1091035445 11:132228721-132228743 GCCCCTGTGCTGCTTCTGAGCGG 0: 1
1: 0
2: 0
3: 30
4: 254
1091035440_1091035445 28 Left 1091035440 11:132228670-132228692 CCACATCATTCTGCTGTCTTTAG 0: 1
1: 0
2: 1
3: 20
4: 239
Right 1091035445 11:132228721-132228743 GCCCCTGTGCTGCTTCTGAGCGG 0: 1
1: 0
2: 0
3: 30
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091035445 Original CRISPR GCCCCTGTGCTGCTTCTGAG CGG Intronic
901423400 1:9165716-9165738 GCCACTGTGCTGCAGCTCAGCGG - Intergenic
901965077 1:12859765-12859787 GGCCCTGTCCTGCTTCCCAGAGG + Exonic
902024235 1:13371133-13371155 GCCCCTGTCCTGCTCCCCAGAGG - Exonic
902566441 1:17314676-17314698 GACCTTGGGCTGCTTCTGACAGG - Intronic
903009264 1:20318741-20318763 GCCCCTGGGCTGCCTGTGGGAGG + Intronic
905106116 1:35564552-35564574 GCCTCTGTGTTCCTTTTGAGGGG + Intronic
905108344 1:35577140-35577162 TCCCCTTTGCTGCTGCTGCGCGG - Intronic
905241972 1:36587287-36587309 GCCTCTGACCTCCTTCTGAGGGG + Intergenic
905540547 1:38756926-38756948 GTAGCTTTGCTGCTTCTGAGTGG + Intergenic
906778761 1:48553458-48553480 GCCTCAGCTCTGCTTCTGAGTGG + Intronic
907384656 1:54118210-54118232 GCCCCTTAACTGCTCCTGAGAGG - Intergenic
909039294 1:70630290-70630312 GCCAAAGTGCTGCTTCTGACTGG + Intergenic
911067528 1:93803968-93803990 GCCTCTGTGCTTCATCTGATAGG + Intronic
911538581 1:99130444-99130466 GCCTCTGTGTTGCTTCTGGGTGG + Intergenic
912232094 1:107806150-107806172 GCCCTTGTGCTGCTTCCTATGGG + Intronic
912838827 1:113020816-113020838 ACCGCTGAGCTGTTTCTGAGCGG - Intergenic
913247043 1:116879125-116879147 GCGCCTGAGCTGCTGCTGACTGG - Intergenic
913414406 1:118589432-118589454 GCCCCTGTGCTGATAATGAATGG + Intergenic
915283211 1:154836778-154836800 GCCCCTGGGCTCCCTCTGAGTGG + Intronic
918281288 1:183008800-183008822 GGCCCTGTTCTGCTGCTAAGAGG + Intergenic
918466822 1:184829097-184829119 GCCCCTGTGAAACTTCTTAGTGG + Intronic
920245467 1:204584590-204584612 GCCCCTGGGGAGCATCTGAGAGG - Intergenic
921934251 1:220781783-220781805 GCCTGTGTGATCCTTCTGAGAGG + Exonic
922793504 1:228323974-228323996 GCCCTTGAGCTTCTCCTGAGAGG - Intronic
1063076191 10:2719164-2719186 GCCCAAGTGCTGCATCTGTGTGG - Intergenic
1063965754 10:11344633-11344655 GTCCTTGTGCTGCTTCTCAGTGG + Intergenic
1064404734 10:15051406-15051428 GTCTCTGTGCTTCATCTGAGAGG + Intronic
1065195295 10:23258358-23258380 ACCACTGTGCTGTTTCTGATTGG + Intergenic
1065963024 10:30749679-30749701 GCCCTTGAGCTGCCTCTGTGTGG + Intergenic
1066480291 10:35789100-35789122 GCCCCTTTGCTGCCTCTGCTGGG + Intergenic
1069149638 10:64942786-64942808 GTCCCTGCCATGCTTCTGAGTGG - Intergenic
1069793980 10:71040807-71040829 AAACCTGTGCAGCTTCTGAGAGG - Intergenic
1070658886 10:78290617-78290639 GCCCCTCAGAAGCTTCTGAGGGG + Intergenic
1070964956 10:80524296-80524318 GCCTCTGTTCTCCTTATGAGTGG - Exonic
1073134033 10:101209759-101209781 GCTCCTGGGAGGCTTCTGAGAGG + Intergenic
1073203911 10:101758519-101758541 CTCCCTGTGCTACTGCTGAGTGG - Intergenic
1074184564 10:111089328-111089350 GGCACCGTGCTGCTGCTGAGAGG + Intergenic
1075683643 10:124349447-124349469 TCCCCTGTCCTGCTTCTGCAGGG + Intergenic
1076244019 10:128932307-128932329 GCCCCTGAGCTGCATTTGAATGG - Intergenic
1076510731 10:131012153-131012175 ACCCCTGTGGTGCCTCTGCGTGG + Intergenic
1076679465 10:132164220-132164242 ACCCCTTTGCTGCCTCAGAGGGG + Intronic
1077178399 11:1200907-1200929 GCCCCGGGGCTGGTCCTGAGAGG - Intronic
1079733227 11:23962140-23962162 GCCCATGTCCTGCATCTGGGAGG - Intergenic
1081567987 11:44271336-44271358 GTCGCAGTGCTGCTACTGAGTGG + Intronic
1082722064 11:56690504-56690526 GCCACTGTGCTGTTTTTGATTGG + Intergenic
1083675396 11:64322334-64322356 CCCTCTGTGCTGCCTCTGTGGGG - Intergenic
1083711891 11:64554702-64554724 GCCCCTGGGCAGCTGCTGTGTGG - Intergenic
1084555027 11:69870802-69870824 TCTCATGTGCTGCTTCTTAGAGG + Intergenic
1085635546 11:78156789-78156811 GCCCTGGTGCTGCTTCTTAGAGG + Intergenic
1085767389 11:79295062-79295084 GTACCTCTGCTGCTTCTCAGAGG - Intronic
1089538183 11:119173471-119173493 GCCGCTGTATAGCTTCTGAGTGG - Exonic
1090765074 11:129869549-129869571 GCTCCTGTGCTGATGCTGATGGG + Exonic
1091035445 11:132228721-132228743 GCCCCTGTGCTGCTTCTGAGCGG + Intronic
1091703875 12:2680828-2680850 CCCCCAGTGCTGCTTCTGGGTGG - Intronic
1092880657 12:12885525-12885547 GCCCCAGCGCTGCCTCTCAGGGG - Intergenic
1092911485 12:13148872-13148894 GCCCCTGTGCAGCTGCTTAGAGG + Intergenic
1094425213 12:30310108-30310130 GCCTCTGTGCTGCTCCTGGGTGG - Intergenic
1095481076 12:42636497-42636519 GCTCCAGGGCTGCTTCTGAGGGG + Intergenic
1098255321 12:68610682-68610704 GCCCCTTAGCTGCCTCTGGGCGG - Intergenic
1098939220 12:76515710-76515732 GCCTCTGTGTCGCTTCTGGGTGG + Intronic
1100309085 12:93377929-93377951 GCCGCGGTGCTGCTGCTCAGTGG + Exonic
1102829475 12:115983457-115983479 GTCCCTGTGCTGCTGCTGGTGGG + Exonic
1104529224 12:129553297-129553319 GCACCTGTGCTGCTGCTGTCAGG + Intronic
1104569082 12:129909383-129909405 GCCCCTGTTCTGCTTCCCACTGG + Intergenic
1105255138 13:18739341-18739363 GCTCCTCTGCTCCTTATGAGTGG - Intergenic
1105265246 13:18809334-18809356 GCCTCTGGGCAGCTACTGAGGGG - Intergenic
1105426868 13:20301880-20301902 GGCCCTTTGCAGCGTCTGAGCGG - Intergenic
1107091978 13:36491554-36491576 GAACATGTGCTGCTGCTGAGTGG - Intergenic
1108479664 13:50856041-50856063 GGCTCTGTGCTGCTCCTGGGTGG - Intergenic
1112881343 13:104109659-104109681 GCCCCAGTGGTGATTCTGTGTGG - Intergenic
1113156795 13:107332524-107332546 GCCCCACAGCTGCTCCTGAGGGG - Intronic
1113258150 13:108529892-108529914 GCCCCTGTGCTGTAACAGAGTGG - Intergenic
1113768161 13:112893844-112893866 GTCCCTGTGGGGCTTCAGAGTGG + Intergenic
1113781268 13:112978984-112979006 GCCCCATGGCTGCTTCCGAGGGG - Intronic
1114065732 14:19058736-19058758 GCCACTGTCCTTCTCCTGAGTGG - Intergenic
1114096530 14:19341264-19341286 GCCACTGTCCTTCTCCTGAGTGG + Intergenic
1114567585 14:23644002-23644024 GGACCTGTGTTGCTTCTGTGAGG + Intronic
1115507232 14:34104145-34104167 GCTCATGTGCTGCTTCCCAGGGG + Intronic
1116908883 14:50436281-50436303 GTCTCTGTCCTGCTTCTGGGAGG + Intronic
1116999473 14:51357504-51357526 GCCTCTGTGCTTTTTCTCAGTGG + Intergenic
1117233761 14:53749958-53749980 CCCACTGTGCTGCTTTTGAAAGG - Intergenic
1117974248 14:61281526-61281548 GGCCCCGGGCTGCCTCTGAGTGG + Exonic
1118006393 14:61567924-61567946 GCCCCTGTGCTGGGACTGACAGG + Intronic
1118748422 14:68790229-68790251 GCCCCCGGGCTGCTTCTGGGTGG + Exonic
1120894091 14:89514264-89514286 GCCCCAGTCATGCTTCTGGGCGG + Intronic
1122815717 14:104311531-104311553 GCCCCTGTTCAGCTTCTGGTGGG - Intergenic
1127012014 15:54641837-54641859 GGCTCTGTGCTGCCTCTGGGTGG - Intergenic
1129193053 15:73948548-73948570 GCTGCTTTTCTGCTTCTGAGTGG - Intronic
1129223912 15:74154355-74154377 GCCACTGTGCTTCTTCTTAATGG + Intergenic
1130103664 15:80912929-80912951 GCTTCTGTGATGCTACTGAGTGG - Intronic
1132953250 16:2576873-2576895 GCCCGTGGGCCGCTTCTGAGTGG - Intronic
1132961102 16:2623295-2623317 GCCCGTGGGCCGCTTCTGAGTGG + Intergenic
1133007609 16:2893312-2893334 GCCCCTGGGCTGCTTCAATGGGG - Intronic
1133456995 16:5951053-5951075 TCACCTGTGCTGCTTATCAGAGG + Intergenic
1133689501 16:8199521-8199543 TCCCCAGCCCTGCTTCTGAGAGG - Intergenic
1134198031 16:12174080-12174102 CCCCCTGTGCTTCTTATTAGTGG + Intronic
1135099403 16:19593150-19593172 GCCCCTGTGCTGCTTGGCAGTGG + Intronic
1135208575 16:20503897-20503919 GCTCTTGGGCTGCTGCTGAGAGG - Intergenic
1136615024 16:31393370-31393392 GGCACTGTGCTTCTTCTGAGTGG + Exonic
1139026126 16:62820401-62820423 TCCACTGAGCTGCTTCTGTGTGG + Intergenic
1139259701 16:65579721-65579743 GCTCAGGTGCTGCTGCTGAGTGG + Intergenic
1142009520 16:87706766-87706788 GCCCCTGAGATGATCCTGAGAGG + Intronic
1142411238 16:89918242-89918264 GCCCCAGGGCTGCAGCTGAGGGG + Exonic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143253227 17:5537781-5537803 AAACCTGGGCTGCTTCTGAGGGG - Intronic
1144213095 17:13031740-13031762 GTCTCTGTGCTCCATCTGAGGGG + Intergenic
1146901872 17:36593927-36593949 CCCCCTGGGCTGCCTCTCAGTGG + Intronic
1148143271 17:45343103-45343125 TTCCCTGTCCTGCTTCTGACTGG - Intergenic
1148804812 17:50258827-50258849 GCCCCTGAGCAGCTCCTGGGTGG + Intergenic
1151074123 17:71251537-71251559 GCCCATGTGCTGCATAGGAGTGG - Intergenic
1151126104 17:71846423-71846445 GCTCATGAGCTGCTTCTCAGTGG - Intergenic
1151799396 17:76368833-76368855 ATCCCTGTGCTGATTCTGTGAGG - Intronic
1152069361 17:78127382-78127404 CCCCCTGTGCTGCTTCCGCCTGG - Intronic
1152229405 17:79106952-79106974 GCCCCTGTGCTGTATCTCATGGG - Intronic
1152409859 17:80117833-80117855 GCCCAGGTGGGGCTTCTGAGGGG + Intergenic
1152516427 17:80827470-80827492 GCTCCTGCGCTGGCTCTGAGTGG - Intronic
1152639916 17:81445072-81445094 GCCCGGGTGCTGCATGTGAGAGG - Exonic
1153794838 18:8611954-8611976 GCCCCTGGCCTGCTGCAGAGCGG + Intronic
1154064259 18:11091881-11091903 GCCCTTGTGCTGTGACTGAGTGG - Intronic
1154209257 18:12365358-12365380 GCTTCTGAGCAGCTTCTGAGTGG + Intronic
1154293455 18:13130522-13130544 GCTCCTGTGCATCTTCTGGGTGG - Intergenic
1154423150 18:14252209-14252231 GCCTCTGGGCAGCTACTGAGGGG + Intergenic
1154435884 18:14341261-14341283 GCCCCTCTGCTCCTTATAAGTGG + Intergenic
1155358072 18:24972985-24973007 GCCCCAGTTCTGCTCCTTAGGGG - Intergenic
1155426393 18:25711882-25711904 TCCACTGAGGTGCTTCTGAGGGG - Intergenic
1156491559 18:37499441-37499463 GACCCTGTTCTGCTCCTGTGTGG - Intronic
1158420132 18:57286071-57286093 GGCCCTGTGCTTCTCCAGAGAGG - Intergenic
1158819601 18:61144355-61144377 ACCCCTTTGCTGCAACTGAGGGG + Intergenic
1159177884 18:64862508-64862530 TCCTCTGAGCTTCTTCTGAGGGG + Intergenic
1160005016 18:75063266-75063288 GGCCTCCTGCTGCTTCTGAGGGG - Exonic
1160032509 18:75275063-75275085 GCACCTGTGCTGCTACTGATGGG - Intronic
1160475924 18:79187632-79187654 CCCCCTGTGCTGCTGCTGAATGG + Intronic
1160830404 19:1102072-1102094 GCCTCTGTGCTGCATCTGGCAGG + Intergenic
1161231462 19:3176960-3176982 GGCCCTGTCCTGAGTCTGAGGGG - Intronic
1161273789 19:3404503-3404525 GCCCCTCTGCAGCCTCTGAGGGG - Intronic
1161524055 19:4742724-4742746 GGCCCTGTGGTGACTCTGAGTGG + Intergenic
1161644466 19:5444560-5444582 GCCCTCTTGCTGCTTCAGAGAGG - Intergenic
1162117860 19:8442519-8442541 GCCACTGTGCTGGTCCTTAGAGG - Intronic
1163694934 19:18759384-18759406 GCCCCTGTCCTCCATCTGTGGGG + Intronic
1163713595 19:18861419-18861441 GCCCAAGTGCTGAGTCTGAGTGG + Intronic
1165743806 19:38218702-38218724 GCCACTGACCTGCTTTTGAGGGG + Intronic
928389030 2:30894938-30894960 GCTCCTGTGCTGCTGCTCTGGGG - Intergenic
929754973 2:44756774-44756796 GCCCCTGTGTTGTTTCTTTGTGG - Intronic
929755142 2:44758018-44758040 GGCCCTGTACTGGTTCTGGGAGG + Intronic
932303485 2:70685310-70685332 GCCCCTGTGATACTTCTCTGAGG + Intronic
932356166 2:71070046-71070068 GCTCCTGTGCTCGTTCTGAGAGG + Intronic
932690998 2:73913654-73913676 GCCCCTTTTCTGATTCTGACTGG + Intronic
933639263 2:84741685-84741707 GCCACTGTGCTGCTCCAGGGAGG - Intronic
934490110 2:94756574-94756596 GTCCCTCTGCTCCTTATGAGTGG - Intergenic
934517579 2:94998412-94998434 GCCGGTGTTCTGCTTCAGAGCGG - Intergenic
934538406 2:95155818-95155840 CCACATGTGCCGCTTCTGAGTGG + Intronic
934548576 2:95240333-95240355 GGCTCTGTGCTGCTCCTGTGTGG - Intronic
937081893 2:119146230-119146252 GCTCCTGTGCTCCTTCCCAGTGG - Intergenic
937339756 2:121083666-121083688 GCCCCTCTGCTTCATCTCAGTGG - Intergenic
941516425 2:166485972-166485994 TAGCCTGTGCTGCTTCTCAGCGG + Intronic
942662619 2:178282349-178282371 TCCCCTCTGCTGCTGCTTAGTGG + Intronic
946329528 2:219001614-219001636 GCCCCCGGGCTGGTGCTGAGAGG + Intergenic
946496545 2:220201441-220201463 ACCACTGTGCTGCTCCAGAGTGG + Intergenic
948754594 2:240151535-240151557 AGCCCTATGATGCTTCTGAGAGG + Intergenic
948786918 2:240357459-240357481 ACGCCTGTGCTGCCTCTGCGTGG + Intergenic
1169380886 20:5106243-5106265 GCCACTGTGCTGTTTTTGATTGG - Exonic
1171879969 20:30611314-30611336 GCCCCTCTGCTCTTTATGAGTGG - Intergenic
1172697347 20:36831754-36831776 GCCCTTGTTCTGATACTGAGGGG - Intronic
1174769203 20:53282541-53282563 GCCCCTGTTCTGCCCTTGAGGGG - Intronic
1175315501 20:58044064-58044086 GCCTCTGTGCTACTTCCCAGAGG - Intergenic
1175800785 20:61800045-61800067 CCGCCTGTGCTTCCTCTGAGGGG + Intronic
1176065209 20:63190808-63190830 GCCCCAGGGCAGCTTCCGAGGGG - Intergenic
1176191651 20:63813733-63813755 GGCCATGTGCTGCTTGTGGGTGG - Intronic
1176841152 21:13844373-13844395 GCCCCTCTGCTCCTTATGAGTGG - Intergenic
1176850324 21:13907799-13907821 GCCTCTGGGCAGCTACTGAGGGG - Intergenic
1178061358 21:28856673-28856695 GGCTCTGTGCTGCTCCTGGGTGG - Intergenic
1178551429 21:33542900-33542922 TCTCCTCTGCTGTTTCTGAGCGG - Exonic
1180383469 22:12162734-12162756 GCCCCTGTGCAGCTGCTGCAGGG + Intergenic
1180484213 22:15781328-15781350 GCCACTGTCCTTCTCCTGAGTGG - Intergenic
1180854531 22:19037799-19037821 GCCCCTGCGCTGCTGAGGAGGGG + Exonic
1181460852 22:23085137-23085159 GCCCGTCTGCTGCATCTGCGGGG + Intronic
1182264118 22:29099243-29099265 TCCCCTAGGCTGCTTCTGAGCGG - Intronic
1183622511 22:38982641-38982663 ACCCCACTGCTGCTTCTGAATGG + Intronic
1183623365 22:38987355-38987377 GCCCCACTGCTGCTTCTGAATGG + Intronic
1183628967 22:39021707-39021729 GCCCCACTGCTGCTTCTGAATGG + Intronic
1183630175 22:39027812-39027834 GCCCCACTGCTGCTTCTGAATGG + Intronic
1183633605 22:39047681-39047703 GCCCCTTTACAGCTTCTGAATGG + Intronic
1183638214 22:39077552-39077574 GCCCCACTGCTGCTTCTGAATGG + Intronic
1183641848 22:39097516-39097538 ACCCCACTGCTGCTTCTGAACGG + Intronic
1184423737 22:44396800-44396822 GCCCCTGTGCTCCTACAAAGAGG + Intergenic
1185342063 22:50295714-50295736 GCGTCTGTGCTGATTCTGATGGG + Intronic
949251545 3:1990611-1990633 GACTCTGTTCTGTTTCTGAGTGG + Intergenic
950563222 3:13748169-13748191 GGCCATGTGCTGCTGCAGAGTGG - Intergenic
952828479 3:37543801-37543823 GCCCCTCAGATGCTTCTCAGTGG + Intronic
953636867 3:44671440-44671462 GGACCTGTTCTGCTTCTGACTGG + Intergenic
953787436 3:45921634-45921656 GCCCCTGGGCTGCCCCTCAGAGG - Exonic
954123731 3:48516680-48516702 GTCGCTGGGCTGCTTCTGGGTGG - Intergenic
954640943 3:52097366-52097388 ACCCCTGGGCTGCTTCAGATAGG + Intronic
954980453 3:54740922-54740944 GCTGCTGTGCTGCTTCTGCAGGG + Intronic
956717644 3:72092474-72092496 GTCTCTGTGCTTCTTCTGACAGG - Intergenic
957042209 3:75344434-75344456 GGCCTGGTGCTGCTTCTGATCGG + Intergenic
960868665 3:122227734-122227756 ACCCCAGTGCTCCTACTGAGAGG - Intronic
965537166 3:169835464-169835486 GCCCCTGTGATGCTCCACAGAGG - Intronic
968597318 4:1492147-1492169 GCCCCTGTGCTGCTGGTAACAGG - Intergenic
968929926 4:3573423-3573445 GCCTCTGTGCTGCCACTCAGGGG + Intergenic
969618171 4:8265652-8265674 GCCTCTGTCCACCTTCTGAGGGG - Intergenic
971631503 4:28998777-28998799 GCCCCAGTGGTGCCTCTGTGTGG - Intergenic
972304439 4:37818525-37818547 GCACCTGCTCAGCTTCTGAGGGG - Intergenic
973343617 4:49031061-49031083 GCCCCAGTGATGCTTCTTGGGGG + Intronic
975582004 4:75915509-75915531 GCCCCTGTGCTCTCTCTCAGTGG + Intronic
977181456 4:93880097-93880119 GGCCCTGGGGAGCTTCTGAGTGG + Intergenic
977295293 4:95202781-95202803 GCCCCTGTGCTGCTCCTCGCTGG - Exonic
977668686 4:99670866-99670888 GGCTCTGTGCTGCTCCTGCGTGG - Intergenic
978621561 4:110638287-110638309 GGCTCTGTCCTGCCTCTGAGTGG + Intronic
983222994 4:165060519-165060541 GTCCCTGTACAGATTCTGAGAGG - Intergenic
983316199 4:166135110-166135132 GGCCCAGAGCTGCTTCTGATTGG + Intergenic
984520144 4:180792263-180792285 TCCCCAGTGCTGCTTCCCAGAGG - Intergenic
984569612 4:181376234-181376256 TCCTCTGTGCAGCTTCTGTGGGG + Intergenic
984778625 4:183504995-183505017 GCCCCTGGGCTGGTGCTGCGGGG + Exonic
985868873 5:2538259-2538281 GCCCTTTTGCTCCTTCAGAGGGG - Intergenic
986287474 5:6370570-6370592 CCCTCTGTGCTGGTTCTGGGTGG - Intergenic
989818649 5:45766423-45766445 GCTCCTGTGGTGGTTCTCAGGGG + Intergenic
990001381 5:50897472-50897494 ACCCCTGGGCTCCTTTTGAGTGG - Intergenic
990940824 5:61201062-61201084 TCCCCTGTGCAGCTCCTGAGTGG + Intergenic
993441280 5:87959930-87959952 GCCCCTGTGCTTCCTCTTAGGGG + Intergenic
993466260 5:88250510-88250532 GCCCCTGTTCTCCATCTAAGTGG + Intronic
997466394 5:134090688-134090710 GCCCCAGTGCTGCCTTTCAGTGG - Intergenic
997932793 5:138086032-138086054 GGACCTTTGCTGCTTCTGACTGG - Intronic
997986507 5:138505501-138505523 GCCCCTGACCTGCTTTTGGGTGG + Intergenic
1001933956 5:175691581-175691603 GCCGCTGTGCTCCTTCTTAAGGG - Intergenic
1002593481 5:180306840-180306862 CCTCATGAGCTGCTTCTGAGAGG - Intronic
1003328366 6:5109711-5109733 CCTCCTGTGCTGTTTCAGAGGGG - Intronic
1003838139 6:10093222-10093244 GCCCCTGTGGTGGTTCTGCATGG + Intronic
1004104635 6:12654546-12654568 GCCTTTGGGCAGCTTCTGAGAGG + Intergenic
1004291033 6:14367616-14367638 GACCCTGTGCTGCTTTCAAGGGG + Intergenic
1007304158 6:40891398-40891420 ACACCTGTGGGGCTTCTGAGGGG - Intergenic
1009962094 6:70535410-70535432 GCCCCAGTGCTCCTGCTGTGAGG - Intronic
1012002524 6:93670873-93670895 GCCACTCTGCTGCCTCTGACAGG - Intergenic
1012572155 6:100742660-100742682 GCAGCTGTGCTGCTTTGGAGGGG + Intronic
1017408879 6:154148559-154148581 GCCTGTGTGCTTCTTCTGAAAGG + Intronic
1018915155 6:168128518-168128540 GCCCCTGGGCTGCTGCTTAGAGG - Intergenic
1018989567 6:168663181-168663203 GCCCCTGGGGTGCTTCTCAGAGG + Intronic
1019294553 7:266964-266986 GCCCCAGGGCTGCTGCTGTGTGG + Intergenic
1019351523 7:556287-556309 GCCTCTGGGATGCCTCTGAGGGG - Intronic
1019917477 7:4143147-4143169 GCCCCTGTGCTGCTTCCGGTGGG + Intronic
1020094793 7:5362203-5362225 GACCCTGTGCTGGCTCTGCGGGG + Intronic
1020257545 7:6510496-6510518 GTCCCTGTGCTGCTTCAGGCTGG - Intronic
1023196509 7:37645701-37645723 GTCCCTGTGTGGCTCCTGAGAGG - Intergenic
1023570397 7:41565700-41565722 GACCCTGTGTTGCTGCAGAGAGG - Intergenic
1023778013 7:43628368-43628390 ACCCCTGAGCTGTTTCTGTGGGG + Intronic
1024565464 7:50676595-50676617 GCCCCTCTGAAGCTTCTGTGAGG - Intronic
1026365357 7:69643185-69643207 TCTCCCTTGCTGCTTCTGAGGGG - Intronic
1027452240 7:78345508-78345530 GCCCCCGTGCTGCCCCGGAGAGG - Intronic
1028762364 7:94510015-94510037 GCCCCAGTGCTGCCCCTGTGCGG + Exonic
1032134143 7:129259278-129259300 GCTCCTGTGCTGCTTAAGAAGGG - Intronic
1032795172 7:135270702-135270724 GGCCGTGTGCTGCTCCTGATGGG - Intergenic
1033588854 7:142794139-142794161 GCCCCTGAGCTGCTTCTTTCAGG + Intergenic
1034364572 7:150534971-150534993 GCCTCTGTGTTGCTCCTGTGTGG + Intergenic
1034935179 7:155194676-155194698 GCCCCTGAGCAGGGTCTGAGGGG + Intergenic
1035287093 7:157813606-157813628 GCGCCTTTGCTGCCTCTGGGCGG + Intronic
1035319530 7:158019849-158019871 GCCGCTGTGCTGTGTCTGTGCGG - Intronic
1039102828 8:33958628-33958650 GGCTCTGTGTTGCTTCTGGGTGG + Intergenic
1040109919 8:43562697-43562719 GGCCCTGTGCTGGACCTGAGGGG - Intergenic
1040278569 8:46026201-46026223 GCCCCTGTGCTGGGTCAGGGGGG - Intergenic
1041153848 8:54963562-54963584 GCCCCTGTGGCTCTTCTGGGAGG + Intergenic
1048049353 8:130802838-130802860 GGTCAAGTGCTGCTTCTGAGGGG - Intronic
1049357261 8:142195067-142195089 ACCCCAGTCCTGCTTCTGAGGGG - Intergenic
1049548257 8:143244875-143244897 GCCCCTTTGCAGCTGCTAAGGGG + Intergenic
1052881594 9:33604031-33604053 GCCCCTCTGCTCCATATGAGTGG + Intergenic
1053494724 9:38541806-38541828 GCCCCTCTGCTCCTTATGAGTGG - Intronic
1053917474 9:42954242-42954264 GGCCCTCTGCTCCTTATGAGTGG + Intergenic
1054711597 9:68516451-68516473 GCCACTGTGCTGCTTGTAACTGG + Intronic
1055767649 9:79682044-79682066 GCCAATGTGCTGAATCTGAGTGG - Intronic
1056954897 9:91074004-91074026 ACACCTGTGCTTTTTCTGAGTGG - Intergenic
1056956998 9:91090572-91090594 GCCCCAGTGGGGCTTCTAAGTGG - Intergenic
1057115492 9:92517206-92517228 GTTCCTGTGCTGCCTTTGAGTGG + Intronic
1061274635 9:129562322-129562344 GCCTCTGTGCACATTCTGAGAGG - Intergenic
1062491053 9:136805089-136805111 GGCCCGGTGGTGCTTCTCAGAGG - Intronic
1062590554 9:137272684-137272706 GCCCTTGTGGTGCTTGTGTGTGG + Intronic
1186424068 X:9449542-9449564 CACCCAGTGCTGCTTCTGTGAGG - Intergenic
1188009813 X:25043667-25043689 GCCCCTTGGCTGCCCCTGAGAGG - Intergenic
1190373331 X:49764075-49764097 GCTTTGGTGCTGCTTCTGAGAGG - Intergenic
1190690330 X:52908284-52908306 GGCCTAGTGCTGCTTCTCAGAGG - Exonic
1190695653 X:52947508-52947530 GGCCTAGTGCTGCTTCTCAGAGG + Exonic
1193005720 X:76616777-76616799 GGCCCTGTGTTGCTTCTGGATGG - Intergenic
1195672917 X:107484280-107484302 GGCCCAGTGCTGGTTCTGACCGG - Intergenic
1198419204 X:136452146-136452168 GCCCCTGGGCCCCTTTTGAGAGG - Intergenic
1198889599 X:141378132-141378154 GCCGCTGTTCTGATTTTGAGTGG - Intergenic
1199945188 X:152659630-152659652 GCCCCTTTGCTATTTCTGACAGG + Intergenic
1200064789 X:153499194-153499216 TCCCCTGCTCTGCCTCTGAGAGG + Intronic