ID: 1091037561

View in Genome Browser
Species Human (GRCh38)
Location 11:132247188-132247210
Sequence GAGCTGGACATACACGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091037561_1091037562 -9 Left 1091037561 11:132247188-132247210 CCATCTGCGTGTATGTCCAGCTC 0: 1
1: 0
2: 0
3: 6
4: 125
Right 1091037562 11:132247202-132247224 GTCCAGCTCACAGAAGAGACAGG 0: 1
1: 0
2: 2
3: 16
4: 229
1091037561_1091037565 -5 Left 1091037561 11:132247188-132247210 CCATCTGCGTGTATGTCCAGCTC 0: 1
1: 0
2: 0
3: 6
4: 125
Right 1091037565 11:132247206-132247228 AGCTCACAGAAGAGACAGGGAGG 0: 1
1: 0
2: 2
3: 42
4: 369
1091037561_1091037566 26 Left 1091037561 11:132247188-132247210 CCATCTGCGTGTATGTCCAGCTC 0: 1
1: 0
2: 0
3: 6
4: 125
Right 1091037566 11:132247237-132247259 GACCCTAGAACATCCATCCTTGG 0: 1
1: 0
2: 0
3: 5
4: 75
1091037561_1091037563 -8 Left 1091037561 11:132247188-132247210 CCATCTGCGTGTATGTCCAGCTC 0: 1
1: 0
2: 0
3: 6
4: 125
Right 1091037563 11:132247203-132247225 TCCAGCTCACAGAAGAGACAGGG 0: 1
1: 0
2: 2
3: 32
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091037561 Original CRISPR GAGCTGGACATACACGCAGA TGG (reversed) Intronic
905388253 1:37619265-37619287 GAGCTGCAGATACAGGCAGAAGG + Intronic
905676338 1:39828073-39828095 GAGTTGGTCATACAAGAAGATGG - Intergenic
906449900 1:45936613-45936635 GAGAAGGGCATACACACAGAAGG - Intronic
908674294 1:66585097-66585119 GAGCAGGAGATAGACCCAGAGGG - Intronic
908964837 1:69747402-69747424 GAGCTGGACATACAAGCCTCTGG - Intronic
909937897 1:81574936-81574958 CAGCTGGAAGTACACACAGAGGG - Intronic
912333651 1:108842921-108842943 GTGCTGGACATTGACTCAGATGG - Intronic
918742016 1:188143694-188143716 GAGCTAGACATACTGGTAGAGGG - Intergenic
919518019 1:198550994-198551016 GGGCTGCACATCCAAGCAGATGG + Intergenic
920164597 1:204026597-204026619 GAGCTGGAGACAAAGGCAGAGGG + Intergenic
920266121 1:204724487-204724509 GAGATGGACATAGACGGAAAAGG - Intergenic
920748676 1:208653207-208653229 GAGAAGGAAATACATGCAGAGGG - Intergenic
921730641 1:218574226-218574248 GAGCTGAACATTCACTCACATGG - Intergenic
1064111940 10:12547142-12547164 GAAATGGACATAAAGGCAGAAGG + Intronic
1065044197 10:21731096-21731118 CAGATGGACAAACAGGCAGATGG + Intronic
1066444485 10:35469565-35469587 GAGATGGACAGACAGGGAGATGG + Intronic
1075792128 10:125092584-125092606 GATCTGGACAGACACACACACGG + Intronic
1076659573 10:132046535-132046557 GAGCTGGACACACACAGAAATGG - Intergenic
1080104243 11:28495248-28495270 GAGGTGAAAATACAGGCAGAGGG + Intergenic
1083899665 11:65637498-65637520 GGGATGGACAAGCACGCAGAGGG + Intronic
1085761010 11:79241503-79241525 GAGCTGCACATGCCAGCAGAAGG + Intronic
1085858708 11:80206716-80206738 GACCGGGACATACAGGCACAAGG + Intergenic
1086263284 11:84967116-84967138 GAGCTGGAATTACAAGCAGTTGG - Intronic
1088050074 11:105502281-105502303 GAGGTGGACATACTTTCAGATGG - Intergenic
1090050557 11:123374671-123374693 GAGCTAGAAATAAAAGCAGAGGG - Intergenic
1091037561 11:132247188-132247210 GAGCTGGACATACACGCAGATGG - Intronic
1091102873 11:132891988-132892010 GAGCTGGAAATCCATGCAGTGGG - Intronic
1091190929 11:133694805-133694827 GAGCTGGACACAGAGCCAGAAGG + Intergenic
1099138408 12:78938271-78938293 GATCTGGACTTACTCGCTGATGG - Intronic
1102657565 12:114495256-114495278 GAGCTTGACATATACTCACAGGG - Intergenic
1113279516 13:108773539-108773561 AAAATGGACACACACGCAGAGGG - Intronic
1117000029 14:51363114-51363136 GAGCCTCACATACAGGCAGAAGG + Intergenic
1118720748 14:68591963-68591985 GAGCTGGGCACACACTCAGGAGG + Intronic
1119496863 14:75087154-75087176 GAGCTGCACGCACACGCAGGAGG + Exonic
1121688104 14:95854747-95854769 GTGCTGGACATCCACGACGACGG - Intergenic
1124009456 15:25825405-25825427 GAGCTATGCATACACTCAGAAGG + Intronic
1128265886 15:66266320-66266342 GAGCTGTGCACACATGCAGAAGG + Intergenic
1131435676 15:92419586-92419608 GTCCTGGACATACCTGCAGAAGG - Intronic
1134136017 16:11676836-11676858 TTCCTTGACATACACGCAGATGG - Exonic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1137627886 16:49921084-49921106 GAGCTGGACATGCAACCACAAGG - Intergenic
1138353593 16:56360396-56360418 GAGCTGGACACACATGGAAAAGG - Intergenic
1140754144 16:78052392-78052414 CAGGTGGACACATACGCAGAAGG + Intronic
1143109184 17:4543996-4544018 GAGCTGGTCAGACACGCAGCTGG - Intronic
1145046958 17:19626448-19626470 GAGGTTGAAATACACGCACACGG + Intergenic
1146561529 17:33874247-33874269 GAGCTGACCATACGAGCAGAAGG + Intronic
1151989731 17:77566632-77566654 GAGCGGGTCATTCACACAGAAGG - Intergenic
1152025499 17:77806286-77806308 GAGATGGACAGTCAGGCAGAGGG + Intergenic
1152279433 17:79376611-79376633 GAGCTGAGCAAACACGCAGTGGG - Intronic
1153927651 18:9848296-9848318 AAGATGGATATACACACAGATGG - Intronic
1157471051 18:47989285-47989307 CAGCTGGACAGATAAGCAGAAGG + Intergenic
1160503625 18:79415050-79415072 GACCTGGACATGGACGCACATGG - Intronic
1160554396 18:79716610-79716632 GAGCTGGGCAGACACGCGGCAGG - Intronic
1161997078 19:7719805-7719827 GAGCTGATCATAAATGCAGATGG + Intergenic
1162689835 19:12420163-12420185 AAGTTGGACATAGAGGCAGATGG + Intronic
1163188727 19:15659329-15659351 GAGCTGGTCCTGCGCGCAGAGGG + Exonic
1163216067 19:15878805-15878827 GAGCTGGTCCTGCGCGCAGAGGG - Exonic
1163601787 19:18253742-18253764 TAGCTGGACCAACACGTAGAAGG - Intronic
1164581601 19:29438620-29438642 GAGCGGGACAGACAGGGAGAGGG + Intergenic
1164881118 19:31733771-31733793 GAGCTGTAGATACGCTCAGATGG - Intergenic
1167291747 19:48628647-48628669 GAGATGGACGGACACACAGAAGG - Intronic
1167738994 19:51312587-51312609 GAGCTGGAGATACAGGAAGTTGG + Intronic
927392320 2:22609381-22609403 GAGCGGGAAAGACACCCAGAGGG - Intergenic
932158931 2:69443343-69443365 GACCTGCACATACATCCAGATGG - Intergenic
932734703 2:74246570-74246592 GGGATGGACATCCACACAGATGG - Intronic
936671282 2:114659822-114659844 TAGATGTACATACACACAGAGGG + Intronic
938072321 2:128315286-128315308 GAGCTGGGCATCCATGGAGATGG - Intronic
938382929 2:130846719-130846741 GAGCTGGACAGCCAGGCAGCTGG + Intronic
949064608 2:241982297-241982319 TAGCTTGACATAGACACAGATGG - Intergenic
1172809967 20:37640475-37640497 GAGCTGGCCAGCCACGCAAAGGG + Intergenic
1174182562 20:48684023-48684045 GAGCTGGAGATACAAGGAGAAGG + Intronic
1174412328 20:50344155-50344177 GAGATGGAGACACAAGCAGAGGG - Intergenic
1175666380 20:60863746-60863768 CAGATGGACAGACAGGCAGATGG + Intergenic
1175893328 20:62324948-62324970 CAGCTGGACAGACACACAGTGGG + Intronic
1176196043 20:63836663-63836685 GAGCTGGACCTTCCCTCAGAGGG + Intergenic
1178150310 21:29786556-29786578 AAGCTGGACAGACACCAAGAAGG - Intronic
1178616674 21:34140365-34140387 AAGCTGGACAAACAGGTAGAAGG - Intronic
1178847851 21:36188348-36188370 AAGCTGGAGAAACAGGCAGAAGG - Intronic
1179970423 21:44834147-44834169 GAGGTGGACACACACACAAATGG + Intergenic
1181978988 22:26752753-26752775 GAGATGGACAGACAGACAGAAGG - Intergenic
1182278047 22:29202639-29202661 GACCTGGACCCACACCCAGATGG - Intergenic
1182588260 22:31359168-31359190 TAGGTGGAGATACAAGCAGAAGG + Intergenic
1182846740 22:33437627-33437649 GAGCTGGAGGTCCAGGCAGATGG - Intronic
1183541634 22:38432580-38432602 GAGCTTGACATAGAACCAGAGGG + Intronic
1184330641 22:43824972-43824994 GAGGTGGACAGACACGCAGGCGG + Exonic
949159008 3:858611-858633 CAGCTGGAGATACAGGGAGAAGG - Intergenic
954603656 3:51892238-51892260 GAGGAGGATATCCACGCAGAGGG + Intergenic
959031495 3:101304455-101304477 AAACTGGACATACATACAGAAGG - Intronic
962149735 3:132880143-132880165 AAGAAGGACATACACCCAGAAGG - Intergenic
963729090 3:148953901-148953923 GGGCTGTACATATACACAGATGG - Intergenic
973694449 4:53476444-53476466 GAGCTCCACAGACAGGCAGAGGG - Intronic
978979532 4:114925519-114925541 GAGATTGATATACACGGAGAAGG + Intronic
982207215 4:153005766-153005788 GAGCTGGGAACACACGCAGCAGG + Intergenic
985213133 4:187617118-187617140 GAGCTAGAGATACAGGCATAAGG - Intergenic
986283022 5:6339007-6339029 GACCTGGCCAGACACTCAGAAGG + Intergenic
990011188 5:51000361-51000383 GAGCTAAACATAGACACAGATGG - Intergenic
992694981 5:79277205-79277227 GAGCTGGACATACAAAAACATGG - Intronic
992867953 5:80976672-80976694 GAGCTGGGCAGACACCAAGAAGG - Intronic
1001596503 5:172902202-172902224 GAGGTGGCCAAACAGGCAGATGG + Intronic
1002976320 6:2081451-2081473 GATGTGGACAGACAAGCAGAAGG - Intronic
1003189482 6:3861735-3861757 GAGCTGGAGATGCAAGAAGATGG + Intergenic
1006588958 6:35140734-35140756 GAGCTGGACCTACAGGGAGGGGG + Exonic
1007296962 6:40830932-40830954 GAGCTGTACACACACACAAATGG + Intergenic
1008568714 6:52794196-52794218 CAGGTGGACATACGGGCAGAAGG + Exonic
1012475454 6:99611739-99611761 GAGCTGCTCATATATGCAGAGGG + Intronic
1019154190 6:170027964-170027986 GAGATGGACAGAGACACAGATGG + Intergenic
1020600264 7:10266437-10266459 AAGCTGGACATGCATGCTGAGGG - Intergenic
1020894667 7:13925061-13925083 GAGCAGGAAATAAAAGCAGAGGG - Intronic
1022483739 7:30761344-30761366 AAGCTGAACTTACAGGCAGAGGG - Intronic
1022843729 7:34189967-34189989 GAGCTGGACATGCATGCAACGGG - Intergenic
1023342261 7:39233839-39233861 GAGGAGGACAACCACGCAGATGG - Intronic
1023889923 7:44384740-44384762 GAGCTTGACAGACAGGCAAATGG + Exonic
1024282520 7:47731325-47731347 AAGCTGGACACAGACGCAGAGGG + Intronic
1024343185 7:48287404-48287426 GTGCTGGACAGACGCACAGATGG + Intronic
1029488795 7:100859110-100859132 AAGCAGGACATAGACGAAGAAGG - Exonic
1030317950 7:108135695-108135717 GAGATGGAAAGACAAGCAGAAGG - Intergenic
1035386834 7:158478591-158478613 GAGCTGGACCCACATGGAGAAGG + Intronic
1035476249 7:159145567-159145589 AAGCTGGAGAAAAACGCAGACGG + Intergenic
1036721264 8:11177627-11177649 AATTTGGACATACACGCAGAGGG + Intronic
1045089022 8:98719756-98719778 GTGCTGGATATACACGGACAGGG + Intronic
1045342287 8:101265829-101265851 CAGCTGGACACAGAGGCAGAAGG - Intergenic
1047998239 8:130357276-130357298 GAGCTGACCAGACACGGAGAAGG - Intronic
1048048522 8:130795618-130795640 GGGGTGGACAGACAGGCAGACGG + Intronic
1060295551 9:122340734-122340756 GCGCTGGACACAGAGGCAGAGGG + Intergenic
1185615091 X:1416312-1416334 CAGCTGGACACACACACACACGG + Intronic
1187478846 X:19636762-19636784 AAGCTGAACATATACACAGAAGG + Intronic
1190711401 X:53073277-53073299 GAGCTGGAAAACCATGCAGAGGG + Intronic
1190879506 X:54482761-54482783 GAGATGGACATAGAGGGAGATGG + Intronic
1194680150 X:96842350-96842372 GAGCTGGAAATAAACGTAGCTGG + Intronic
1198480007 X:137032600-137032622 GAGTTGGAGAGACACGGAGACGG - Intergenic
1200965455 Y:9031944-9031966 GATCTGGAGATACTGGCAGATGG + Intergenic
1201749655 Y:17419090-17419112 GGGCGGGAAATACATGCAGAAGG + Intergenic