ID: 1091037661

View in Genome Browser
Species Human (GRCh38)
Location 11:132248008-132248030
Sequence TGTGGGCTGTGACCATTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091037661_1091037666 1 Left 1091037661 11:132248008-132248030 CCATTAAATGGTCACAGCCCACA 0: 1
1: 0
2: 0
3: 20
4: 123
Right 1091037666 11:132248032-132248054 CATCCAAACATGGGAGAAAATGG 0: 1
1: 0
2: 1
3: 39
4: 328
1091037661_1091037668 11 Left 1091037661 11:132248008-132248030 CCATTAAATGGTCACAGCCCACA 0: 1
1: 0
2: 0
3: 20
4: 123
Right 1091037668 11:132248042-132248064 TGGGAGAAAATGGAGAAATTAGG 0: 1
1: 0
2: 3
3: 78
4: 660
1091037661_1091037663 -8 Left 1091037661 11:132248008-132248030 CCATTAAATGGTCACAGCCCACA 0: 1
1: 0
2: 0
3: 20
4: 123
Right 1091037663 11:132248023-132248045 AGCCCACAGCATCCAAACATGGG 0: 1
1: 0
2: 1
3: 10
4: 138
1091037661_1091037662 -9 Left 1091037661 11:132248008-132248030 CCATTAAATGGTCACAGCCCACA 0: 1
1: 0
2: 0
3: 20
4: 123
Right 1091037662 11:132248022-132248044 CAGCCCACAGCATCCAAACATGG 0: 1
1: 0
2: 1
3: 14
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091037661 Original CRISPR TGTGGGCTGTGACCATTTAA TGG (reversed) Intronic
904523771 1:31116311-31116333 TGGGGACTGTCACCATTTAGAGG - Intergenic
904978526 1:34477181-34477203 TGTGGGCTGGCCTCATTTAAAGG + Intergenic
905249520 1:36638941-36638963 GGTGGTCTGAGACCATTTAAAGG - Intergenic
905284511 1:36870557-36870579 GGTGGGCTGTGACTCTTCAAAGG - Intronic
911986082 1:104624610-104624632 TGTGTACTGTGATCATGTAAGGG + Intergenic
915437531 1:155919921-155919943 TGTGGGCTGTGAGCACTGAAGGG - Intronic
1067559680 10:47296114-47296136 TGTGGGGAGTGACAATTTGAAGG - Intergenic
1071025190 10:81104532-81104554 TGTGGGCAGTGAGTATTTATAGG + Intergenic
1071070557 10:81687592-81687614 TGTGGGCTGTGAGCCTTTCGAGG + Intergenic
1074929999 10:118115056-118115078 TGTGGTCTGTGGCCATGAAATGG + Intergenic
1075246563 10:120827560-120827582 AGTGGGCTGTGAGAATTAAATGG + Intergenic
1075356106 10:121778232-121778254 TGTAGGCTGTGATCTTTTAGTGG + Intronic
1075642155 10:124072563-124072585 TGAGAGCTGCCACCATTTAATGG - Intronic
1076424996 10:130361461-130361483 TGGGGTCTGTGTCCATGTAAGGG + Intergenic
1077220902 11:1415746-1415768 TGTGGGCAGTGAGCAGGTAATGG - Intronic
1077837685 11:5938629-5938651 TTTGGGCTGTGTGTATTTAAAGG + Intergenic
1077878061 11:6324330-6324352 TGTGGGCAGTGAGCTTTTATAGG + Intergenic
1083545469 11:63545925-63545947 TCTGGGCTGTGACCACTTCTTGG - Intronic
1085745348 11:79110276-79110298 TGTGTGCTGTGAGCTGTTAAGGG - Intronic
1091037661 11:132248008-132248030 TGTGGGCTGTGACCATTTAATGG - Intronic
1091993748 12:4976941-4976963 TCTGAACTGTGACCATTGAAAGG + Intergenic
1093075313 12:14752149-14752171 TGTGGTGTGTGGCCATTCAATGG - Intergenic
1094044786 12:26155460-26155482 TGTGTGCCATTACCATTTAAGGG - Intronic
1096740087 12:53686801-53686823 TGTGGGCTGTGGCCTTGGAAGGG + Intergenic
1098008517 12:66024538-66024560 TGTGGGCTGAGACCACTTGAGGG + Intergenic
1098071148 12:66676150-66676172 TCTGGGCTGGGACAATTTATAGG - Intronic
1098781215 12:74688604-74688626 TGTGGATTGTGAAGATTTAATGG - Intergenic
1102863392 12:116355572-116355594 TGTGGGCTGTGAGCAGTGATGGG - Intergenic
1104146522 12:126039280-126039302 GTTGGCCTGTGACAATTTAATGG + Intergenic
1105264878 13:18807226-18807248 TGTGGGCTGTTTCCAGTTCAAGG - Intergenic
1105522075 13:21140316-21140338 TGTCGCCTGTGAATATTTAAGGG + Intergenic
1105914127 13:24896333-24896355 TCTGGGCTGTGCCCATTCAAGGG - Intronic
1106147683 13:27064812-27064834 TATGGGGAGTGACCATTTAATGG + Intergenic
1106724022 13:32466037-32466059 TGTAGGATGTGACCAATTAGAGG - Intronic
1109673671 13:65643213-65643235 TGTTGGCTGTGAGCACTTACAGG + Intergenic
1112979421 13:105363581-105363603 CGTTGTCTGTGAACATTTAAAGG + Intergenic
1115780841 14:36766356-36766378 TGTGGGCTGTGATCACAGAAAGG + Intronic
1116241273 14:42346302-42346324 TATGGCCTCTGACCAGTTAATGG + Intergenic
1117027515 14:51636687-51636709 TGTGGGATGTGACCCCTTAAAGG + Intronic
1119608443 14:76041336-76041358 TTTTGGCTGTTATCATTTAAGGG - Intronic
1122884268 14:104703610-104703632 TGAGGCCTGTGTCCATTGAAGGG - Intronic
1128032446 15:64493120-64493142 TGTGGGTAGTTACCAATTAAAGG + Intronic
1129781853 15:78277593-78277615 TCTGGGCTGTGACCACGTAAGGG - Intronic
1130419787 15:83733508-83733530 TGTGGGCTGTGTGCATTACATGG + Intronic
1134843216 16:17418023-17418045 AGTGGGCTGTGATCATCTGAAGG - Intronic
1135163964 16:20122248-20122270 AGTGGGCTGGGAATATTTAATGG - Intergenic
1138047274 16:53738456-53738478 CGTGGGATGTGTCCATATAATGG - Intronic
1139327528 16:66163930-66163952 GGTGGGCTGTGACCACAGAAGGG - Intergenic
1140029495 16:71323783-71323805 TCTTGGCTGTGACCATTTCTCGG - Intergenic
1142355600 16:89600177-89600199 TGTGGACAGTGACCACTTAGCGG + Intergenic
1146447640 17:32945124-32945146 TGTGGGTTGTAACCAATTAGTGG - Intergenic
1146721117 17:35124176-35124198 TGTGGATTGTGACCTATTAATGG + Intronic
1151800560 17:76376974-76376996 TGTGGACTGTTCCCATTGAACGG + Intronic
1154075482 18:11196275-11196297 TGTGGCATGTCACCTTTTAAAGG + Intergenic
1156953681 18:42935891-42935913 TTTGGCCTGTGGCCATTTAGAGG + Intronic
1157438019 18:47687533-47687555 CGTGGTCTGTGACCATGAAATGG - Intergenic
1159148160 18:64481815-64481837 TGTAGGCTGAGACCATTGCAGGG - Intergenic
1160915254 19:1493284-1493306 TGTGGGATTTGTCAATTTAAAGG - Intronic
1164917053 19:32060375-32060397 TGCTGGCTGTGAGCATTTTATGG + Intergenic
1167225094 19:48233090-48233112 TGTGGGCTGTGACCTGGTATTGG - Intronic
1167657928 19:50778444-50778466 TGTGAGCTGTCATTATTTAAGGG - Intergenic
925761834 2:7192275-7192297 TGTGGGCTGTGTGTATTTCATGG + Intergenic
927144266 2:20151359-20151381 TGTGGGCTTTGTCCATTTTCAGG - Intergenic
927941519 2:27106093-27106115 TCTGGGCTGTGACCCTTTGACGG - Intronic
929141247 2:38668392-38668414 TGTGGGCTGTGACTCTTACAGGG + Intronic
933788235 2:85861180-85861202 TGTGGACCCTGACCATGTAAAGG - Exonic
934526579 2:95055850-95055872 TGTGTGCTGGGACCATTGAGGGG + Intergenic
935729784 2:106055866-106055888 TGTGTGCTGTGTCCATTTTAGGG - Intergenic
936647141 2:114384924-114384946 TCTGGACTGGGACCATTGAATGG + Intergenic
938319511 2:130353800-130353822 TGTGGCCTGTGAACATTAAGTGG - Intergenic
938976943 2:136487876-136487898 TTTGGGCTGTGCCGATTTCATGG + Intergenic
939538106 2:143458480-143458502 TGTGTTCAGAGACCATTTAAAGG + Intronic
943286300 2:186005370-186005392 TGCAGGCTGTAACCCTTTAAGGG + Intergenic
945863400 2:215149555-215149577 TGTAGGCTGTAACCCTTTACAGG - Intergenic
946374358 2:219299199-219299221 TGTGGGCTGGGAACATTTCAAGG + Intronic
1169772654 20:9218556-9218578 TCTGGGCTGTTGGCATTTAATGG + Intronic
1175236208 20:57514018-57514040 TGTGGGGTGTGACAGTTAAAAGG + Intronic
1175760928 20:61561903-61561925 TCTGGGCAGTGACCATATGATGG + Intronic
1176878680 21:14165244-14165266 TGTGGACTGTGACTGTTTTAAGG - Exonic
1177693624 21:24542197-24542219 TGGGAGACGTGACCATTTAAAGG - Intergenic
1180518890 22:16175446-16175468 TGTGGACTGTGAAGATTTCATGG - Intergenic
1183760045 22:39807716-39807738 TGTGGGTTGTGACCAATTAGTGG + Intronic
1185321704 22:50203596-50203618 AGTGTGCTGAGACCATTCAATGG + Intronic
1185376406 22:50484494-50484516 TGTGCCCTGTGACCACTGAAGGG + Exonic
951184666 3:19699257-19699279 TATGGACTGTGTCCTTTTAAGGG - Intergenic
956068223 3:65419451-65419473 TGTGGGCTGTGACCTATTACTGG - Intronic
956876624 3:73470339-73470361 TGTGGTCTGAGACTATATAAAGG + Intronic
960255921 3:115511651-115511673 TGTCAGCTGTGACCCTTTGATGG - Intergenic
960404867 3:117247330-117247352 TGTGAGCTGTGACTAATAAAAGG - Intergenic
963999601 3:151753948-151753970 AGTGCCCTGTGACCATTCAAAGG - Intronic
964789210 3:160436092-160436114 TGTGGGCAAAGAACATTTAAAGG - Exonic
968641357 4:1716629-1716651 TGGTGGCTGTGACCAGTTGAGGG - Exonic
968753230 4:2401231-2401253 TGTGAGCTGTGACCACTGCAAGG - Intronic
975024845 4:69535154-69535176 TGTGGATTGTGACGATTTCATGG + Intergenic
976260306 4:83139128-83139150 TGTGGGCTGTGGCTTTGTAAGGG - Intergenic
979678211 4:123432647-123432669 TGTGGACTGTGAAGATTTCATGG + Intergenic
980100530 4:128537233-128537255 TGTGGGCTGTGTGCATTTTGTGG + Intergenic
981853146 4:149255603-149255625 TGTGAGCTGGGACCAGTTTAGGG - Intergenic
982615097 4:157631607-157631629 TGTGGGCTGTGATCTGGTAAGGG - Intergenic
984662847 4:182392161-182392183 TGTGGGATGTGAACAGTGAAGGG + Intronic
986253101 5:6079122-6079144 TGCGGGCTGTAACCCTTTATAGG + Intergenic
991609357 5:68434736-68434758 TGTGGGTTGTGACCAGCCAAAGG + Intergenic
994099982 5:95881608-95881630 TCTGGGCTGTGTCCATTTACCGG + Intergenic
995041226 5:107590444-107590466 AGTGAGCTGTGACCATTCCACGG - Intronic
995118683 5:108512099-108512121 TGTGGGCTATGGCCCTTTAGAGG - Intergenic
998472838 5:142396739-142396761 TGTGGGAGGTGACCAATTAGAGG + Intergenic
1000358738 5:160427630-160427652 TGTGGTCTGAGACCCTTTGAGGG - Intronic
1001580326 5:172793822-172793844 TGTGGCCTGTGACAATTTCCTGG + Intergenic
1001782335 5:174380731-174380753 TCTGGGCTGTGACCAATTTAGGG + Intergenic
1006495286 6:34418627-34418649 TTTGGGCTGTGAGTATTGAAGGG - Intronic
1007509434 6:42364064-42364086 TGTGGACTGTGGCCATTTCAAGG - Intronic
1007719132 6:43875119-43875141 TGAGGGCTGTGACCAGCTGAGGG + Intergenic
1007987318 6:46219703-46219725 TTTGGGCTGTATCCAGTTAATGG + Intergenic
1013597229 6:111671294-111671316 TGTGAGGTGTGACCAAATAAAGG - Intronic
1014484911 6:121986579-121986601 TATGAGTTGTGACCATTTAGTGG + Intergenic
1017792111 6:157810039-157810061 TTTGGGCTGTTTCCAGTTAAGGG - Intronic
1022099708 7:27161758-27161780 TGAGGGCTGTTACCGTTTATGGG - Intergenic
1025009711 7:55386361-55386383 TGTGGATTGTGAAGATTTAATGG - Intronic
1027413014 7:77942577-77942599 TGTGGGCTGTGATCAACTGATGG + Intronic
1027857773 7:83534561-83534583 TGTGAATTGTGACCATTTAATGG - Intronic
1030755070 7:113277542-113277564 GGTGGTCTGTGATCATTTAAAGG - Intergenic
1031655985 7:124356029-124356051 TGTAGTCTTTGAGCATTTAAAGG + Intergenic
1033277397 7:139982727-139982749 TGTGGGCTGTGATCCTTTAGGGG - Intronic
1037387247 8:18356607-18356629 CCTGGGCTGTGACCTTTGAAAGG + Intergenic
1038156816 8:24999249-24999271 TTTGGGCTGTAACCTGTTAATGG - Intergenic
1038853934 8:31310390-31310412 TGTGCACTGTGGCCATTTAGGGG + Intergenic
1040560752 8:48521425-48521447 TGTTTGCTGTGACCATGGAAAGG + Intergenic
1043477959 8:80623297-80623319 AGTGGGCTGTGAAATTTTAAAGG + Intergenic
1048289132 8:133166483-133166505 TTTGGGCTGTGCAGATTTAACGG + Intergenic
1048414533 8:134211630-134211652 TGTGGGCTGAGCCCAGTTAATGG - Intergenic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1049729768 8:144170396-144170418 TGTGGGCTGTGACCCTTCCCAGG + Intronic
1053703514 9:40726454-40726476 TGTGGACTGTGATGATTTCATGG + Intergenic
1054413570 9:64849917-64849939 TGTGGACTGTGATGATTTCATGG + Intergenic
1054454622 9:65423546-65423568 TGTGCGCTGTGACCATGGCAGGG - Intergenic
1060071861 9:120557126-120557148 TGTTTGCTGTGACCTTCTAAAGG - Intronic
1188603610 X:32000563-32000585 TCAGGTCTGTGACTATTTAAAGG + Intronic
1189535171 X:41927835-41927857 TGTCTGCTGAAACCATTTAAAGG - Intergenic
1190025540 X:46918918-46918940 TGTGGGTGGTGACCATTCAAAGG + Intronic
1190376060 X:49789432-49789454 TGTGGTCTCTGAGCTTTTAAAGG + Intergenic
1190448102 X:50551123-50551145 TCTAGGCTGTGACCATTACAGGG - Intergenic
1195458432 X:105096697-105096719 AATGGGCTGCGACTATTTAATGG + Intronic
1195625480 X:107002067-107002089 TGTAAGCTGTGAGCATTTCAGGG + Intergenic
1201713700 Y:17020129-17020151 TGTGGGAAGTGACTACTTAATGG - Intergenic