ID: 1091041722

View in Genome Browser
Species Human (GRCh38)
Location 11:132287133-132287155
Sequence CTGGTTAGACAGATCTGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091041722_1091041724 -6 Left 1091041722 11:132287133-132287155 CCTTGTCAGATCTGTCTAACCAG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1091041724 11:132287150-132287172 AACCAGTCCTTAGGCCCTTTAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1091041722_1091041730 15 Left 1091041722 11:132287133-132287155 CCTTGTCAGATCTGTCTAACCAG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1091041730 11:132287171-132287193 GGCAAGGCCAGTTTCAGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 203
1091041722_1091041732 19 Left 1091041722 11:132287133-132287155 CCTTGTCAGATCTGTCTAACCAG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1091041732 11:132287175-132287197 AGGCCAGTTTCAGTCCTGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 142
1091041722_1091041726 -1 Left 1091041722 11:132287133-132287155 CCTTGTCAGATCTGTCTAACCAG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1091041726 11:132287155-132287177 GTCCTTAGGCCCTTTAGGCAAGG 0: 1
1: 0
2: 0
3: 6
4: 66
1091041722_1091041731 18 Left 1091041722 11:132287133-132287155 CCTTGTCAGATCTGTCTAACCAG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1091041731 11:132287174-132287196 AAGGCCAGTTTCAGTCCTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091041722 Original CRISPR CTGGTTAGACAGATCTGACA AGG (reversed) Intronic
902847100 1:19120144-19120166 TTGGTTTGACAGATCTGCAAGGG - Intronic
902981459 1:20126457-20126479 GTGGTCAGACAGACCTGACATGG + Intergenic
904583661 1:31566588-31566610 CTTGTTGGACGGATCTGACTGGG + Intergenic
906646828 1:47481178-47481200 CTGTTCAGACACATCTTACATGG + Intergenic
910073171 1:83243866-83243888 CAGGTTACACTGTTCTGACATGG - Intergenic
910163171 1:84295953-84295975 CTGGCTAGAAAAATCTTACATGG + Intergenic
910571329 1:88707789-88707811 CTGGTTAGAAAAATATGACCAGG - Intronic
915900023 1:159840196-159840218 CTGGTTAGACAGAGTTTAAATGG - Intronic
919292991 1:195657655-195657677 CTTTTTAGACAGGTGTGACATGG - Intergenic
920110978 1:203586807-203586829 ATAGTGAGACAGATCAGACAAGG - Intergenic
920112958 1:203599886-203599908 CTGGTTGGACTGATGGGACATGG - Intergenic
921971948 1:221159551-221159573 TGGGTTAAACAGATCAGACATGG + Intergenic
922063068 1:222110021-222110043 CTGGTTAGATACATCTGCCCTGG + Intergenic
1063217823 10:3939716-3939738 CTGGTTGGACAGATGGGAAAAGG - Intergenic
1064984838 10:21199596-21199618 CTGCTTGGACTGATCTGAGAAGG + Intergenic
1066497167 10:35953792-35953814 TTAGATAGACAGATCAGACAAGG + Intergenic
1068250785 10:54437047-54437069 CTAATTAGACAGGTGTGACAAGG - Intronic
1068813304 10:61281016-61281038 CTAGTTAGACATTTCTGATAAGG + Intergenic
1078878808 11:15426858-15426880 CTGGTTGGGAAGTTCTGACACGG + Intergenic
1080412431 11:32038410-32038432 CTGGTGAGACAGAAAAGACAAGG - Intronic
1081579060 11:44339531-44339553 CTGGAGAGACAGATCTGGCCTGG + Intergenic
1082576638 11:54813862-54813884 CTGTTTTGACAGATCTGCAAAGG - Intergenic
1083132098 11:60634116-60634138 CTGGATATTCAGATCAGACAGGG - Intergenic
1083696341 11:64445304-64445326 CTGGCTAGGCAGGTCTGCCAGGG - Intergenic
1085774539 11:79353305-79353327 CTGATAAAACAGATCTTACAGGG + Intronic
1087899313 11:103622813-103622835 CTGCTTAGATAGATCTTTCAAGG - Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091308772 11:134558454-134558476 CTCGTTGGACTGATCTGAAATGG - Intergenic
1092938144 12:13383137-13383159 ATGGTGAGAGAAATCTGACATGG + Intronic
1099265555 12:80442349-80442371 TTGGTTAGACGGATCAGTCATGG + Intronic
1102965955 12:117125561-117125583 CTGGTTACACAGTACTGTCAGGG + Intergenic
1104178950 12:126359432-126359454 GTGATTAGACAGATGTGAGATGG - Intergenic
1106119841 13:26851119-26851141 CTTGTTGGACACATCTGACATGG + Intergenic
1106891725 13:34253423-34253445 CTGGTTAAACAGTTATTACAGGG + Intergenic
1107432209 13:40350303-40350325 CTGGTAAGAAAGATGAGACAGGG + Intergenic
1108672817 13:52709059-52709081 CAGGTGAGACATATCTGACCAGG + Intronic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1111431241 13:88150687-88150709 CAGGTTTGACAGAGCTGATATGG + Intergenic
1117445520 14:55800445-55800467 ATGGTGAGAGAAATCTGACATGG + Intergenic
1117941264 14:60968238-60968260 GTGGTGAGGCAGCTCTGACATGG - Exonic
1120630132 14:86880539-86880561 ATGGTTAGACAGAAGTGACATGG - Intergenic
1121108607 14:91296771-91296793 CTGGTGAGGCAGGTCTGGCAGGG - Intronic
1121787084 14:96670228-96670250 CTGGGGAGACAGACCTGACCCGG + Intergenic
1121908764 14:97770257-97770279 CAGGGCAGACAGAGCTGACAGGG - Intergenic
1126900779 15:53312308-53312330 CTGATTAGAAAGATAGGACAAGG - Intergenic
1127727628 15:61765718-61765740 CTGCTCAGGCAGATCTGAAAAGG + Intergenic
1127854271 15:62941726-62941748 TTGGTAAGACAGACCTGGCAGGG + Intergenic
1127935690 15:63635389-63635411 CTGTTGAGACAGATCAGACTTGG - Intronic
1129814939 15:78543497-78543519 CTGGCTTGACAGAGGTGACAGGG - Intronic
1131956879 15:97746388-97746410 ATTGGTAGACAGATCTTACAGGG - Intergenic
1141346393 16:83250491-83250513 CTGCTGAAACAGAGCTGACAAGG + Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1148715503 17:49712840-49712862 AGGGTGAGACAGATATGACAAGG - Intronic
1148927729 17:51102079-51102101 CTGATTAGAAAGGTCTAACATGG + Intronic
1160440890 18:78891549-78891571 CAGGACAGACAGATGTGACATGG - Intergenic
1161290320 19:3490595-3490617 CTGGCTGGGCAGATCTGACCAGG + Intergenic
1165526187 19:36356923-36356945 GTGGTAAAACATATCTGACAAGG - Intronic
1166288954 19:41849561-41849583 CTGCTTAGACAGATTTGATGGGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
934623226 2:95829106-95829128 CTGGCTCGACAGCTCTGGCAGGG + Intergenic
936232496 2:110715502-110715524 CTGGTTATACAGATGTGCCTAGG + Intergenic
940700643 2:157038118-157038140 CTGGTTAGACAGACTTCCCAAGG - Intergenic
941414324 2:165200625-165200647 TTGATTAGGCAGATCTGAGAGGG - Intronic
941524623 2:166591897-166591919 CATATTAGACATATCTGACAAGG - Intergenic
943171037 2:184400539-184400561 CTGGTTTGACAGAGTTGACTGGG + Intergenic
945097990 2:206237827-206237849 CTGGTCATAAAGATCTAACAGGG + Intergenic
1171216263 20:23354773-23354795 CTGGTCAAACACATCAGACAGGG - Exonic
1181451805 22:23027670-23027692 CAGGGTAAACAGATCTTACATGG - Intergenic
950258070 3:11522104-11522126 AGGGATAGACAGATCTGAAACGG - Intronic
959572413 3:107899190-107899212 CTGGTAAGGCAGAGCTGGCAGGG - Intergenic
962825375 3:139096016-139096038 CTGGTCAGCCAGATGTGAAAAGG + Intronic
963206548 3:142642123-142642145 CAGGTTAGACAGAGGTGACAAGG - Intronic
966834529 3:184038788-184038810 CTGGGGAGGCAGAGCTGACAGGG + Exonic
967188703 3:186967004-186967026 TTGGACATACAGATCTGACAGGG + Intronic
972335108 4:38100912-38100934 CTTGTTTGACATTTCTGACATGG + Intronic
977180822 4:93871423-93871445 CTGGCAAAACAGATCTGACGGGG + Intergenic
977673369 4:99721090-99721112 GTTGTTAGAAAGATCTGAGATGG - Intergenic
978949727 4:114543500-114543522 CTGGTTGGGCAAATCTGAGAAGG + Intergenic
981263400 4:142750719-142750741 CTGATTAGACCCATCTGCCAAGG - Intronic
983739974 4:171118055-171118077 CTGGAAAGACAGATGTGACATGG + Intergenic
984751710 4:183283958-183283980 CTTGTTGGACAGATATCACACGG + Intronic
986091945 5:4517469-4517491 CTGGTGAGGCTGATCAGACATGG + Intergenic
987233699 5:15921440-15921462 ATGGACAGACAGATCTGAAAAGG - Intronic
992374594 5:76175866-76175888 GCTGTCAGACAGATCTGACAGGG - Intronic
992467233 5:77018522-77018544 CTGGGTGGGCAGATCTGATAAGG - Intergenic
1003096861 6:3149184-3149206 CTGGTTAGACAAAACTGTCCTGG + Intronic
1007188586 6:39994557-39994579 CTGGGTATACAGTACTGACATGG - Intergenic
1008973908 6:57402014-57402036 CTGGTTTGATATATCTGGCAGGG + Intronic
1009058537 6:58369019-58369041 CTTGTAAGTCAGATCTGATAGGG - Intergenic
1009232302 6:61078101-61078123 CTTGTAAGACGGATCTGATAGGG + Intergenic
1012262568 6:97104684-97104706 CTTGTAAGACAGATCTTTCAAGG - Intronic
1012636785 6:101552689-101552711 CAGGTTAGACACATCTGTCTGGG - Intronic
1013362962 6:109411519-109411541 CTGGTTACACAGATATAACCAGG + Intronic
1013558600 6:111282692-111282714 CTGGTTAAACAGTTCTAACTTGG + Intergenic
1027290847 7:76708742-76708764 CAGGTTACACTGTTCTGACATGG - Intergenic
1030571597 7:111232495-111232517 GAGGTTAGCTAGATCTGACATGG + Intronic
1032016344 7:128382650-128382672 CTGGCCAGACAGATCTGAGTGGG + Intergenic
1038703994 8:29877065-29877087 ATGGGTAGACAGCCCTGACAGGG + Intergenic
1043052402 8:75400350-75400372 CTGGTAAGTCAGAGCTGATATGG - Intergenic
1048539116 8:135326413-135326435 GTGGTTACACAGGTCTGAGAGGG + Intergenic
1049474406 8:142790119-142790141 CTGCTTAGACAGCTCCAACAAGG - Intergenic
1051027838 9:12635199-12635221 TTAGTTAGACAGAACTGATATGG + Intergenic
1053059151 9:35015731-35015753 ATAGTTAGACAGGACTGACAAGG + Intergenic
1058194510 9:101956283-101956305 CTGGTTAGATAGATCGAACCAGG + Intergenic
1059130865 9:111748186-111748208 CTTGTTAGTAAGATCTGAAAAGG + Exonic
1062314928 9:135962226-135962248 CTGGCTAAACCGACCTGACAGGG - Intergenic
1187670492 X:21661554-21661576 GTTGATAGACAGATCTAACAGGG + Intergenic
1187717215 X:22114622-22114644 CAATTTAGCCAGATCTGACAAGG + Intronic
1188869244 X:35353284-35353306 CTGGTTAGAAAGCACTGATAGGG - Intergenic
1190871635 X:54429743-54429765 CTGGTTATACAGATGGGAGAAGG - Intergenic
1193326311 X:80181898-80181920 CTAGTTACACAGATATAACAAGG + Intergenic
1195938378 X:110146329-110146351 TGGGTTAGACTGGTCTGACATGG + Intronic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1198272607 X:135068579-135068601 CTGGTTAGATAGATGTAACCAGG + Intergenic