ID: 1091041724

View in Genome Browser
Species Human (GRCh38)
Location 11:132287150-132287172
Sequence AACCAGTCCTTAGGCCCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091041722_1091041724 -6 Left 1091041722 11:132287133-132287155 CCTTGTCAGATCTGTCTAACCAG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1091041724 11:132287150-132287172 AACCAGTCCTTAGGCCCTTTAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1091041721_1091041724 -5 Left 1091041721 11:132287132-132287154 CCCTTGTCAGATCTGTCTAACCA 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1091041724 11:132287150-132287172 AACCAGTCCTTAGGCCCTTTAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1091041719_1091041724 5 Left 1091041719 11:132287122-132287144 CCATCATCCTCCCTTGTCAGATC 0: 1
1: 0
2: 0
3: 21
4: 217
Right 1091041724 11:132287150-132287172 AACCAGTCCTTAGGCCCTTTAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1091041720_1091041724 -2 Left 1091041720 11:132287129-132287151 CCTCCCTTGTCAGATCTGTCTAA 0: 1
1: 0
2: 2
3: 11
4: 129
Right 1091041724 11:132287150-132287172 AACCAGTCCTTAGGCCCTTTAGG 0: 1
1: 0
2: 1
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091041724 Original CRISPR AACCAGTCCTTAGGCCCTTT AGG Intronic
907713669 1:56907898-56907920 AACCAGTCCTTGGGCTTTTTGGG + Intronic
908890358 1:68839840-68839862 AACCAGCCCAAAGGCCCATTAGG - Intergenic
914358673 1:146911051-146911073 ATCTAGTCCTTAGGCCCTCCAGG - Intergenic
919031330 1:192246849-192246871 AAACAGTCCTCAAACCCTTTTGG - Intergenic
919478308 1:198055944-198055966 AGCCAGTCCTTGGGCCCTAGTGG + Intergenic
1063276336 10:4572491-4572513 ACCCTGTCCTTTGGCCTTTTAGG + Intergenic
1068854787 10:61786318-61786340 AACCTGTCCTTAGCTCCTTCAGG - Intergenic
1073645228 10:105294353-105294375 AGCCAGTCCTCAGGCCCCATTGG - Intergenic
1074796212 10:116947399-116947421 AACCAGTCCTTAAGTCAGTTAGG - Intronic
1077679516 11:4225619-4225641 AACCAGTCCCTTGGGGCTTTGGG - Intergenic
1077681971 11:4250288-4250310 AACCAGTCCCTTGGGGCTTTGGG + Intergenic
1077688930 11:4322199-4322221 AACCAGTCCCTTGGGGCTTTGGG - Intergenic
1077963537 11:7101539-7101561 AACCAGTCCTCAGCTCCTTAAGG + Intergenic
1081911480 11:46702704-46702726 AACCTGTCATTAGGCCCATGGGG + Exonic
1083393825 11:62374689-62374711 AGCCAGTCCCAAGGCCCTGTGGG + Intronic
1089747532 11:120627658-120627680 ATCCTGCCCTTAGGCCCTTCAGG - Intronic
1091041724 11:132287150-132287172 AACCAGTCCTTAGGCCCTTTAGG + Intronic
1095499834 12:42825413-42825435 GTCCAGTCCTTAGGCCCTGTAGG + Intergenic
1098363750 12:69680658-69680680 TAACAGTCCTTTGGCCCTTTGGG - Intronic
1100046214 12:90383659-90383681 AGCTAGTCCTTAGGCCCTTTGGG - Intergenic
1102823710 12:115928473-115928495 AGCCAGTCCCTAGCCCTTTTCGG - Intergenic
1125479299 15:40069511-40069533 ACTCAGTCCCTAGGCCCTTTTGG + Intergenic
1126252659 15:46587685-46587707 TACCAGTCCTCAGGCCCTTGTGG + Intergenic
1128769569 15:70271749-70271771 CACCTGTCCTGAGGCCCTTATGG - Intergenic
1129579453 15:76791828-76791850 AATTAGTCCTTATGCCTTTTGGG - Intronic
1130542576 15:84832195-84832217 TGCCAATTCTTAGGCCCTTTGGG + Intronic
1131138321 15:89956251-89956273 AACAAGTCATTAGGTCATTTGGG + Intergenic
1133711567 16:8406556-8406578 AACTAGTCCTTAGGGTCTTGTGG - Intergenic
1136640798 16:31563592-31563614 AAGCAGTCCTTTTGCACTTTCGG + Intergenic
1136664167 16:31793722-31793744 AAGCAGTCCTTTTGCACTTTTGG - Intronic
1141386680 16:83627853-83627875 AAATAGTCCTTTGGCCCTTGGGG - Intronic
1146513273 17:33469104-33469126 ACCCACTGCTTAGGCCCTTCTGG - Intronic
1149702729 17:58668834-58668856 CCCCAGTCCTCAGGGCCTTTGGG - Intronic
1151135233 17:71940288-71940310 AATCTTTCCATAGGCCCTTTTGG + Intergenic
1153223627 18:2881961-2881983 ACCCAGCCCTTAGGGCCTTCTGG + Intronic
1154490194 18:14916173-14916195 AACCAGTGCTCACCCCCTTTAGG - Intergenic
1155535537 18:26812624-26812646 AAGCAGTCCTTTGTCCTTTTTGG + Intergenic
1162295514 19:9810903-9810925 CACCAGTCCATAGACTCTTTGGG + Exonic
1164447599 19:28331308-28331330 ATCCATTCCTTAGGCCATTGGGG - Intergenic
930033151 2:47070301-47070323 AGCAAGACCTTAGGCCCCTTAGG + Intronic
936508585 2:113127824-113127846 ACCCAGTTCTCAGGCCCTCTGGG - Intronic
936599913 2:113885919-113885941 ATCCAGTTCTTACGCCTTTTGGG - Intergenic
937299876 2:120832589-120832611 GAGCAGACCTCAGGCCCTTTGGG + Intronic
945425219 2:209692945-209692967 AACCAGTCCTTTTGTTCTTTTGG - Exonic
1169530139 20:6476397-6476419 ACCCAGTCCACAGGCTCTTTAGG - Intergenic
1170119316 20:12894590-12894612 ACCCAGTCCTGAGTGCCTTTGGG - Intergenic
1170446127 20:16429720-16429742 AACAAATCCTTGAGCCCTTTGGG - Intronic
1170451472 20:16488469-16488491 CCCCAGTCTTTATGCCCTTTTGG - Intronic
1172945394 20:38683713-38683735 ATCCAGCCCTTAGGACTTTTTGG + Intergenic
1173516849 20:43670555-43670577 AAACATTTCTTAAGCCCTTTTGG + Intronic
1179512306 21:41881088-41881110 AACCAGTCATCTGGCCATTTTGG - Intergenic
1181557717 22:23681431-23681453 AGCCTGTCCTTAGGCCCTGTGGG + Intergenic
950716831 3:14853667-14853689 TACGAGTTATTAGGCCCTTTTGG + Intronic
952228391 3:31403023-31403045 AACCAGTCATTTGTCCATTTAGG + Intergenic
953592243 3:44269591-44269613 AACCAATACTTTGGACCTTTTGG + Intronic
957337582 3:78851414-78851436 TACCAGTCCTTATGGCATTTGGG + Intronic
966388643 3:179428633-179428655 AAAAAGTCCCGAGGCCCTTTAGG - Intronic
970192796 4:13531250-13531272 AAGCAGCTCTCAGGCCCTTTCGG + Intergenic
980086076 4:128391419-128391441 AACAAGTCATTTGGCCATTTAGG + Intergenic
1010688212 6:78877002-78877024 AAACACTCCTAAGGTCCTTTGGG - Intronic
1012085273 6:94817552-94817574 TATCAGTCTTTAGGCCCTGTTGG - Intergenic
1014060180 6:117063169-117063191 AACCAGTCCTCAGGCCCCAGTGG + Intergenic
1015526794 6:134181708-134181730 AAACAGTCCTTAAGTCCTTAGGG - Intronic
1016557467 6:145354519-145354541 AACCATTGCTTAGACCCTTGTGG + Intergenic
1021727430 7:23562598-23562620 AAACAGTCCTCAAACCCTTTTGG - Intergenic
1028922503 7:96323014-96323036 AACCAGTTCTTAAGTCATTTCGG - Intergenic
1029130062 7:98322985-98323007 ACCTAGTCCTTAAGCCCTGTGGG + Intronic
1033349106 7:140547258-140547280 AACCAGTTCTTACCCCCTTGGGG - Intronic
1040898099 8:52389505-52389527 AACCAGTGCTTAAGCCTTTAGGG - Intronic
1042678242 8:71347579-71347601 AAACAATCTTTAGGCACTTTGGG - Intronic
1047849248 8:128838675-128838697 ATCCAGTCTTCAGGCCCTGTTGG - Intergenic
1047849496 8:128841427-128841449 AACCAGTCTTCAGGCCCTGTTGG - Intergenic
1049872797 8:144994176-144994198 ATCCACTCCTTAGGCTGTTTGGG - Intergenic
1051612037 9:18970665-18970687 ATCTAGTCCTTTGGGCCTTTTGG - Intronic
1058515566 9:105770030-105770052 ACACTGTTCTTAGGCCCTTTTGG + Intronic
1060607418 9:124928212-124928234 AGCCAGTCCTTCTGCCATTTTGG + Exonic
1188739685 X:33763502-33763524 AGCCAGTCTTTGGGCCATTTGGG + Intergenic
1192320235 X:70084952-70084974 AACAAACCCATAGGCCCTTTAGG + Intergenic
1193705453 X:84815709-84815731 AAACAATCCTTTAGCCCTTTAGG + Intergenic
1196811038 X:119629223-119629245 CACCAGTCCTCAGCCCCTTCAGG + Intronic
1199789053 X:151133056-151133078 AACCAGGAAGTAGGCCCTTTAGG - Intergenic