ID: 1091041726

View in Genome Browser
Species Human (GRCh38)
Location 11:132287155-132287177
Sequence GTCCTTAGGCCCTTTAGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091041720_1091041726 3 Left 1091041720 11:132287129-132287151 CCTCCCTTGTCAGATCTGTCTAA 0: 1
1: 0
2: 2
3: 11
4: 129
Right 1091041726 11:132287155-132287177 GTCCTTAGGCCCTTTAGGCAAGG 0: 1
1: 0
2: 0
3: 6
4: 66
1091041722_1091041726 -1 Left 1091041722 11:132287133-132287155 CCTTGTCAGATCTGTCTAACCAG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1091041726 11:132287155-132287177 GTCCTTAGGCCCTTTAGGCAAGG 0: 1
1: 0
2: 0
3: 6
4: 66
1091041721_1091041726 0 Left 1091041721 11:132287132-132287154 CCCTTGTCAGATCTGTCTAACCA 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1091041726 11:132287155-132287177 GTCCTTAGGCCCTTTAGGCAAGG 0: 1
1: 0
2: 0
3: 6
4: 66
1091041719_1091041726 10 Left 1091041719 11:132287122-132287144 CCATCATCCTCCCTTGTCAGATC 0: 1
1: 0
2: 0
3: 21
4: 217
Right 1091041726 11:132287155-132287177 GTCCTTAGGCCCTTTAGGCAAGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091041726 Original CRISPR GTCCTTAGGCCCTTTAGGCA AGG Intronic
909258850 1:73460717-73460739 GTGCATAGGACCTTTAGTCAGGG - Intergenic
913569626 1:120107271-120107293 TTCCATAGGCCCCATAGGCAGGG - Intergenic
914290435 1:146268233-146268255 TTCCATAGGCCCCATAGGCAGGG - Intergenic
914551479 1:148719016-148719038 TTCCATAGGCCCCATAGGCAGGG - Intergenic
914797444 1:150932422-150932444 GTGCTGAGGCCATTTAGGCTTGG + Intronic
918448008 1:184633660-184633682 GTCCTCAGCCCCTTTAAGCCAGG - Intergenic
922369635 1:224896414-224896436 GTCCTTAGGTCCTGCAGGCTTGG - Intronic
1071833288 10:89393394-89393416 CACATTAGGCCCTTTAGGTAAGG - Intronic
1075465260 10:122646282-122646304 CTCCTTAGGGCCCTTAGGAAGGG + Intergenic
1087440400 11:98176600-98176622 GTCTATAGTCCCATTAGGCAAGG + Intergenic
1089747528 11:120627653-120627675 GCCCTTAGGCCCTTCAGGGAGGG - Intronic
1090946425 11:131433445-131433467 GTCATGAGGCCCTGGAGGCAGGG - Intronic
1091041726 11:132287155-132287177 GTCCTTAGGCCCTTTAGGCAAGG + Intronic
1096578932 12:52572026-52572048 GGCCTTAGCCCCCTTAGCCAAGG + Intronic
1098741588 12:74179325-74179347 GTACTTAGTCCTTTTAGCCATGG + Intergenic
1102421891 12:112809795-112809817 GTCCCTAGGCTCTCTAGGAAAGG + Intronic
1103285004 12:119793542-119793564 GTCATCAGGGCCTTTAGGTATGG - Intronic
1106036162 13:26047254-26047276 GTCCTAAGACCCTACAGGCATGG + Intronic
1106181586 13:27374027-27374049 GTCCTTGGGCCCTTCATGCCAGG + Intergenic
1108635061 13:52325218-52325240 TTCCTCAGGTTCTTTAGGCAAGG + Intergenic
1108652742 13:52497974-52497996 TTCCTCAGGCTCTTTAGGCAAGG - Intergenic
1114647585 14:24264157-24264179 GTCCTCAGGCCCGTCAGCCAGGG + Intronic
1115928897 14:38468081-38468103 GTCCCTAGGCCCTGGTGGCATGG + Intergenic
1116621087 14:47203922-47203944 GTCTTTGGGGTCTTTAGGCAAGG + Intronic
1118137043 14:63041392-63041414 GTCTGTAAGCCCTTGAGGCAGGG + Intronic
1119164246 14:72479283-72479305 GTCCTTAGCCCCTGAAGGTAGGG - Intronic
1119492873 14:75051585-75051607 ATCCTTATTCCCTTTTGGCATGG + Intergenic
1123189107 14:106551023-106551045 GACCTTGGCCCCTTTAGCCATGG - Intergenic
1129731499 15:77935136-77935158 GACCTGAGGACCTTTAGGTAGGG + Intergenic
1141205472 16:81929821-81929843 GTGCTGAGGTCCTTTGGGCAGGG + Intronic
1151017244 17:70569793-70569815 GTCCTTAAGCCCTGTTGACAAGG + Intergenic
1155103977 18:22642298-22642320 TTCCTTAGGCCCTTTGGTTAGGG + Intergenic
929891900 2:45925218-45925240 GTCCACAGGGCCTTTAGGAAAGG - Intronic
930545807 2:52766001-52766023 GGCCTGAGGCCCTTGAGGGAGGG + Intergenic
933978136 2:87528332-87528354 GTCCCTAGTCCCTGTAGGCGAGG + Intergenic
935043908 2:99462146-99462168 GTCCATAGGTCCTTTAGGGTGGG - Intronic
936315698 2:111422471-111422493 GTCCCTAGTCCCTGTAGGCGAGG - Intergenic
944368040 2:198947659-198947681 GTCCTTAGCCCCTTCAGTGAAGG + Intergenic
944641330 2:201728916-201728938 GTCCTTAGACATTTTAGGAAAGG + Intronic
1172412688 20:34737588-34737610 GAACTTAGGCCCTTAAGGAATGG + Intronic
1173642497 20:44613816-44613838 TTCCTGAGGGGCTTTAGGCAAGG - Intronic
1175875094 20:62225748-62225770 GTCCTTAGGCCCTTTGGACTTGG - Intergenic
1178277082 21:31248851-31248873 GCCCACAGGCCCTTTAGGGAAGG - Intronic
1179608276 21:42532483-42532505 ATGCTTAGGCCCTTTGGGCGTGG + Intronic
1182375269 22:29842489-29842511 CTCATTAAGCTCTTTAGGCAAGG - Intergenic
949916193 3:8966489-8966511 GTCCTTAGAGGCTTTAGGCAGGG + Intergenic
950481635 3:13247867-13247889 CTCCTTAGGCCGTGGAGGCAGGG - Intergenic
953686652 3:45083212-45083234 CTCCTTTGGCCCTTTATGCAGGG + Exonic
955441798 3:58963986-58964008 GACCTAAGGCCATCTAGGCAAGG + Intronic
956265572 3:67392617-67392639 GTCCTAATACACTTTAGGCAGGG + Intronic
961911673 3:130323691-130323713 GTCCTCAGGCCCTCTCCGCAGGG - Intergenic
969069360 4:4522069-4522091 AGCATTAGGCCCTTTAGACATGG + Intronic
975637624 4:76465873-76465895 AATCTTAGGCCCTTTATGCATGG - Intronic
989080724 5:37617572-37617594 GTCCTTAGCCAACTTAGGCAAGG - Intronic
995560791 5:113379091-113379113 GTCCTCAGGGACTTGAGGCAGGG - Intronic
997298410 5:132784289-132784311 GTCCTTAGACCCTCTGGGCCAGG - Intronic
998093563 5:139384385-139384407 GCCCCTTGGCCCTTCAGGCAGGG - Intronic
999826208 5:155275862-155275884 ATCCTTATGCCCTTTAGTAAGGG + Intergenic
1017420682 6:154269094-154269116 GTCCTCAGTCTCTGTAGGCAGGG + Intronic
1031538051 7:122959434-122959456 GTCCATAGTCCCTTTGGGGAAGG + Intergenic
1035051248 7:156000176-156000198 GTTCTCAGGCCCTTGAGGCCTGG + Intergenic
1040763038 8:50874050-50874072 GACCTTAGGCCCTGGAGGCATGG - Intergenic
1046294432 8:112200128-112200150 CTCCTTAGGCCCTGTGGGAAAGG - Intergenic
1049063114 8:140291783-140291805 CTCCACAGGCCCTCTAGGCAAGG - Intronic
1050062731 9:1727413-1727435 GTCCTTTGTCACTTTATGCAAGG - Intergenic
1051177869 9:14379243-14379265 CTCCTGAGGCCTTTTAGGGAAGG + Intronic
1051616883 9:19015101-19015123 GTCCTTAGGCTTTTTTGGAAGGG - Intronic
1055256265 9:74375286-74375308 GTCCTTAGGGTATTTGGGCAGGG + Intergenic
1061753604 9:132797772-132797794 GTCCTTTGTCACTTTAGGAACGG - Intronic
1191786926 X:64925960-64925982 GCCCTTCTGCCCTTTAGTCAGGG - Intronic
1194286725 X:92020089-92020111 GGCCTTAGGCCCTGGTGGCATGG - Intronic
1199920127 X:152392492-152392514 GTGCTTATGCCCTTTAGCTATGG - Intronic
1200604270 Y:5244649-5244671 GGCCTTAGGCCCTGGTGGCATGG - Intronic