ID: 1091041730

View in Genome Browser
Species Human (GRCh38)
Location 11:132287171-132287193
Sequence GGCAAGGCCAGTTTCAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091041720_1091041730 19 Left 1091041720 11:132287129-132287151 CCTCCCTTGTCAGATCTGTCTAA 0: 1
1: 0
2: 2
3: 11
4: 129
Right 1091041730 11:132287171-132287193 GGCAAGGCCAGTTTCAGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 203
1091041721_1091041730 16 Left 1091041721 11:132287132-132287154 CCCTTGTCAGATCTGTCTAACCA 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1091041730 11:132287171-132287193 GGCAAGGCCAGTTTCAGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 203
1091041719_1091041730 26 Left 1091041719 11:132287122-132287144 CCATCATCCTCCCTTGTCAGATC 0: 1
1: 0
2: 0
3: 21
4: 217
Right 1091041730 11:132287171-132287193 GGCAAGGCCAGTTTCAGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 203
1091041722_1091041730 15 Left 1091041722 11:132287133-132287155 CCTTGTCAGATCTGTCTAACCAG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1091041730 11:132287171-132287193 GGCAAGGCCAGTTTCAGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 203
1091041725_1091041730 -4 Left 1091041725 11:132287152-132287174 CCAGTCCTTAGGCCCTTTAGGCA 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1091041730 11:132287171-132287193 GGCAAGGCCAGTTTCAGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 203
1091041727_1091041730 -9 Left 1091041727 11:132287157-132287179 CCTTAGGCCCTTTAGGCAAGGCC 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1091041730 11:132287171-132287193 GGCAAGGCCAGTTTCAGTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091041730 Original CRISPR GGCAAGGCCAGTTTCAGTCC TGG Intronic
900347003 1:2214816-2214838 GCCCAGCCCAGTTTCATTCCTGG + Intergenic
900584245 1:3424825-3424847 GGCAAGGCCAGTTTCCCAGCCGG - Intronic
901598962 1:10407557-10407579 GGAGGGGCCAGTTTCAGTCAAGG + Intronic
902076699 1:13792766-13792788 GGAAAGGCCAGTGACACTCCAGG - Intronic
902605466 1:17566674-17566696 TGCAGGGCCAGTATCAGACCTGG + Intronic
905726941 1:40259994-40260016 GGTAAGGGTAATTTCAGTCCAGG - Intronic
905865116 1:41372323-41372345 GGCAAGGCCAGTGTCTGTGCGGG + Intronic
906944035 1:50280304-50280326 GGAAACTTCAGTTTCAGTCCTGG + Intergenic
907595118 1:55712625-55712647 GGGAAGCTCAGTTTCAGTCCTGG + Intergenic
912624289 1:111194824-111194846 GACAGGGCCAGATTCACTCCTGG - Intronic
913356500 1:117928981-117929003 AGCCAGGCCAGTGTCACTCCAGG + Intronic
913957358 1:143318316-143318338 AGCATGGCCAGTGTCAGACCTGG + Intergenic
914051672 1:144143680-144143702 AGCATGGCCAGTGTCAGACCTGG + Intergenic
914127525 1:144822861-144822883 AGCATGGCCAGTGTCAGACCTGG - Intergenic
915142785 1:153777449-153777471 GGGAAGGACTGTGTCAGTCCAGG + Intronic
915227660 1:154422768-154422790 TGCAAGGCCTGTGTCAGGCCGGG + Intronic
916788491 1:168104171-168104193 GCCAAGGCAGGTTTCAGTTCCGG - Intronic
917210254 1:172623907-172623929 GACAAGGGCAGTTTCAGTAGTGG - Intergenic
918232394 1:182548200-182548222 CGCAAGGCCAGTTCTAGGCCAGG - Intronic
920192237 1:204201105-204201127 GGCCAGGCCTGTGTCAGCCCTGG - Intronic
920199652 1:204251776-204251798 TGCAAGGACAGCTTCAGTGCTGG - Intronic
920640592 1:207748232-207748254 GGCAAGGCCAGTTTTTTCCCGGG + Intergenic
920726328 1:208438641-208438663 GGCAAGGAGAGGTACAGTCCAGG + Intergenic
1063128705 10:3158937-3158959 GCCAAGGCCAGATTCAATCAAGG + Exonic
1063521166 10:6742637-6742659 GCCAAGGCAAGTTTCAGAGCAGG + Intergenic
1065488255 10:26255335-26255357 GGCAAGGGCAGTTTCAGTGGAGG + Intronic
1073882890 10:108004476-108004498 GCCAAGGGTACTTTCAGTCCAGG - Intergenic
1076196196 10:128520070-128520092 GCCAAGGTCAGTGCCAGTCCAGG + Intergenic
1076737758 10:132466309-132466331 GCCAAGGCCTGGTTCAGGCCAGG + Intergenic
1076765467 10:132630749-132630771 GGCAGGGCAAGGTTAAGTCCAGG - Intronic
1076772206 10:132671918-132671940 GGAAAGGCCAGCTTCAGCCAGGG + Intronic
1077425357 11:2473499-2473521 GGCAAGGCCGTTTCCCGTCCTGG + Intronic
1078104690 11:8351231-8351253 GGTAAGGCCAGATTCAGGTCAGG - Intergenic
1083925129 11:65801484-65801506 GGCGAGTCCAGGTTCAGTGCAGG - Intergenic
1084964940 11:72739532-72739554 GGCAAGTCTGGTTCCAGTCCTGG + Intronic
1086847386 11:91768355-91768377 GGAAAAGCCAATTTCAGTTCAGG - Intergenic
1087804154 11:102537754-102537776 GGAGAGGCAAGTTTCAGCCCAGG + Intergenic
1089331201 11:117690264-117690286 CTCATGGCCAGTTCCAGTCCTGG + Intronic
1089809607 11:121120977-121120999 GCCAAGGCCAGCTACAGCCCAGG - Intronic
1090224406 11:125061455-125061477 GGCAAAGTCTGTTTCAGTACCGG + Intergenic
1091041730 11:132287171-132287193 GGCAAGGCCAGTTTCAGTCCTGG + Intronic
1091186035 11:133648880-133648902 GGCATGGCCTCCTTCAGTCCTGG - Intergenic
1091594471 12:1866925-1866947 GGTAAGGACATTTTCAGGCCGGG - Intronic
1092596523 12:10011550-10011572 GGGAAGCCCAGTCTCAGTGCTGG + Intronic
1093190222 12:16065672-16065694 GGCAAGGAAAGTTTCAGCCAAGG + Intergenic
1096855477 12:54478787-54478809 GTCACGGACAGTTTCAGTGCTGG - Intergenic
1098246504 12:68524558-68524580 AGAAAGGCCAGTCTCAGTCCAGG + Intergenic
1099184897 12:79505500-79505522 AGCAAGGGCAGTTTCACTACAGG - Intergenic
1100407546 12:94284675-94284697 GGCAGGGCCAGATTCGGACCTGG + Intronic
1101049414 12:100845486-100845508 GGACAGGCAAGTTTCAGTCATGG - Intronic
1102680571 12:114687791-114687813 GGCAAGGCCAGCTTCTTTGCTGG - Intergenic
1103618958 12:122174183-122174205 AGCAAGGCCAGCTTCAGTGGGGG + Exonic
1103743319 12:123105956-123105978 GGCCAGGCCAGCTTCCTTCCTGG + Intronic
1106554727 13:30799679-30799701 GGCAAGTCCAGCTTTTGTCCTGG + Intergenic
1106682218 13:32019599-32019621 AACAAGGACAGTTTTAGTCCTGG - Intergenic
1106997732 13:35507164-35507186 GGGAAGGTCAGTTTCAATTCAGG - Intronic
1107276227 13:38682757-38682779 GGAAAGGCCAGTTTCAAAACAGG + Intergenic
1107276246 13:38683067-38683089 GGAAAGGCCAGTTTCAAAACAGG + Intergenic
1107988477 13:45796605-45796627 GGCAAGGCCTGTGCCACTCCAGG - Intronic
1108487365 13:50940571-50940593 GGCAAGGCCAGTGTGAGCACTGG + Intronic
1109430038 13:62220092-62220114 GGAAAAGCCAGTTTAAGTCCTGG + Intergenic
1113595242 13:111527060-111527082 GGCAGAGCCGGTTTCTGTCCAGG - Intergenic
1114208861 14:20598861-20598883 GGCAGGGCCAGTGTCAAGCCAGG - Intronic
1118357908 14:65030645-65030667 GGCAAGATCAGTTTGAGCCCAGG + Intronic
1122992057 14:105241118-105241140 GGCCAGGCCAGAGTCAGCCCCGG + Intronic
1202931012 14_KI270725v1_random:31729-31751 AGCATGGCCAGTGTCAGACCTGG - Intergenic
1123668410 15:22628720-22628742 GGCAAGGCTGGATTCAGTGCTGG - Intergenic
1124524389 15:30435181-30435203 GGCAAGGCTGGATTCAGTGCTGG - Intergenic
1124534276 15:30531042-30531064 GGCAAGGCTGGATTCAGTGCTGG + Intergenic
1124764372 15:32476569-32476591 GGCAAGGCTGGATTCAGTGCTGG - Intergenic
1124774262 15:32572529-32572551 GGCAAGGCTGGATTCAGTGCTGG + Intergenic
1126597009 15:50393016-50393038 ACCAAGGCAAGTTTCAGACCAGG - Intergenic
1128221225 15:65970054-65970076 TGCAAGGCTGGTTTCATTCCAGG + Intronic
1130540201 15:84816896-84816918 GGCAAGGCGAGGGTCAGTCACGG + Exonic
1132999661 16:2842479-2842501 GGTCAGGCCAACTTCAGTCCGGG - Intergenic
1133148510 16:3808551-3808573 GTCAAGGGCAGTTTCTGCCCGGG - Intronic
1135778914 16:25281688-25281710 GGGTATTCCAGTTTCAGTCCTGG + Intergenic
1136062054 16:27733263-27733285 AGCAAGGCCACTTTCATCCCTGG - Intronic
1136842156 16:33548130-33548152 GGCAGGGCCAGTGCCAGTTCAGG + Intergenic
1138492628 16:57385120-57385142 GGCAAGACCCCTTTCAGCCCCGG + Intergenic
1140840731 16:78836580-78836602 GGCAAGGCCTGGTGCAGTGCAGG - Intronic
1142283482 16:89161176-89161198 GGCAAGGCCAGTGGCAGCGCCGG - Intergenic
1142428152 16:90011615-90011637 GGCATGGCCCGTTTCAGGCCTGG + Intronic
1203152321 16_KI270728v1_random:1848427-1848449 GGCAGGGCCAGTGCCAGTTCAGG + Intergenic
1144996050 17:19269693-19269715 GGGAATGCCAGGTTCTGTCCTGG + Intronic
1145003554 17:19322072-19322094 GGCAAGGGCAGCTTCAGTCCTGG + Intronic
1146546354 17:33742104-33742126 GTGAAGGCCAGTTTCTGGCCAGG + Intronic
1146631563 17:34473862-34473884 TGCCAAGCCTGTTTCAGTCCAGG - Intergenic
1147686509 17:42289330-42289352 GGCAAGGCCAGGGGCAGGCCCGG + Intronic
1147731997 17:42609853-42609875 GGCAAGGACAGATGGAGTCCAGG - Intronic
1150794853 17:68229017-68229039 GGCGAGTCCTGTTTCTGTCCTGG + Intergenic
1153800339 18:8662967-8662989 AGCAAGGCCAGTTGCAGCCTGGG - Intergenic
1155957548 18:31966540-31966562 GGCAAAGGCAGGATCAGTCCCGG - Intergenic
1156957912 18:42991344-42991366 GGCAATGACAGTTTCACTGCTGG + Intronic
1157622934 18:49026610-49026632 TGCAGGGCCAGGTTCTGTCCAGG + Intergenic
1158160115 18:54471950-54471972 GGAAAGGTGAGTTTCATTCCAGG - Intergenic
1158214368 18:55084070-55084092 GCCATGGCCAGAGTCAGTCCTGG + Intergenic
1160185870 18:76675588-76675610 GGCCAAGCCAGTTACAGCCCCGG + Intergenic
1160869718 19:1271670-1271692 GGGATGGCCAGCTTCCGTCCCGG + Intronic
1162743863 19:12788609-12788631 GGCATGGCCAGCCTCAGCCCTGG + Intronic
1163263337 19:16204294-16204316 GGCCAAGCCAGTTTCTATCCAGG + Intronic
1202691068 1_KI270712v1_random:96104-96126 AGCATGGCCAGTGTCAGACCTGG + Intergenic
925686669 2:6480488-6480510 GGCTAGGACAGCTTCAGACCTGG + Intergenic
926313579 2:11693149-11693171 AGCAAGGCCAGGTACAGTCGTGG + Intronic
927875523 2:26652959-26652981 GGCAAGGCCAGTTTTGGGCCTGG + Intergenic
929461463 2:42104900-42104922 ACCAAGGCCAGAGTCAGTCCTGG + Intergenic
932428536 2:71659214-71659236 GGGAAGGCCAGTGTCAGTACAGG + Intronic
933808059 2:86014452-86014474 GGCCAGCCCAGATTCAGTGCTGG + Intergenic
933955325 2:87357847-87357869 AGCATGGCCAGTGTCAGACCTGG - Intergenic
934239513 2:90254060-90254082 AGCATGGCCAGTGTCAGACCTGG - Intergenic
934273682 2:91562683-91562705 AGCATGGCCAGTGTCAGACCTGG + Intergenic
934461957 2:94217414-94217436 AGCATGGCCAGTGTCAGACCTGG - Intergenic
937882698 2:126880459-126880481 GGCAAGGCCAGATCCTGACCAGG + Intergenic
937985222 2:127635312-127635334 GGCAGGGCCAGCCTCAGCCCTGG + Intronic
939250834 2:139680175-139680197 AGCAAGGCAAGTTTCAGAGCAGG + Intergenic
944880851 2:204011543-204011565 GGCAATGCCAGTTTCTGTGTTGG - Intergenic
947002389 2:225471794-225471816 GGCAGAGCTAGTATCAGTCCTGG - Intronic
947789655 2:232857381-232857403 GGCAATGCAACTTTCAGACCGGG - Exonic
948076765 2:235171025-235171047 GGCAATGACAGCTGCAGTCCTGG - Intergenic
1170756762 20:19212360-19212382 GGCGAGGCCAGAGCCAGTCCGGG + Intergenic
1172790704 20:37503450-37503472 GGCAATGCCATTTTCAGAGCTGG - Intronic
1173249900 20:41358857-41358879 AGCCAGGGCAGGTTCAGTCCAGG - Exonic
1175888890 20:62307383-62307405 GGCCAGGCCAGGTCCAGTCAGGG - Exonic
1175986115 20:62764905-62764927 GGCCAGGCCAGTGTCCCTCCTGG + Intergenic
1176041036 20:63066008-63066030 GGCAAGCCCAGTCGGAGTCCTGG - Intergenic
1176593035 21:8660351-8660373 AGCATGGCCAGTGTCAGACCTGG - Intergenic
1179513676 21:41891902-41891924 CGCCAGGCCAGCTTCAGTGCAGG - Intronic
1180275882 22:10637478-10637500 AGCATGGCCAGTGTCAGACCTGG - Intergenic
1181354293 22:22289355-22289377 AGCATGGCCAGTGTCAGACCTGG + Intergenic
1181503684 22:23336019-23336041 TGCAAAGGCAGTTTCAGTCGTGG + Intergenic
1181636465 22:24176988-24177010 GGCTGGGCCAGTTGCAGGCCTGG - Intronic
1181696611 22:24595808-24595830 TGCAAGGCCAGTTCCAGCCCTGG - Intronic
1181708680 22:24666246-24666268 TGCAAAGGCAGTTTCAGTCGTGG + Intergenic
1182432689 22:30309618-30309640 GGCTAAGCCTGTTCCAGTCCAGG - Intronic
955426462 3:58796147-58796169 GCCAAGCCCACTTTCAGTCCTGG - Intronic
956613593 3:71148929-71148951 GGCAAGGGCACTTCCAGTTCAGG + Intronic
957372236 3:79310054-79310076 GACAAGGCCTGTTTGGGTCCTGG - Intronic
959651882 3:108758109-108758131 GGCAAGGCCACTTTCTGTAGGGG + Intergenic
961464283 3:127072009-127072031 GACAGGCCCAGTTTCAGCCCTGG + Intergenic
961584908 3:127914517-127914539 GGCAGGGACAGATTCACTCCAGG + Intergenic
961598985 3:128044010-128044032 GGTAAGGCTAGTCTCAGGCCTGG + Intergenic
963039287 3:141056835-141056857 AGCAAGGCCACGTGCAGTCCGGG - Intronic
963283630 3:143412000-143412022 GGGAAGTCCCATTTCAGTCCGGG + Intronic
965748998 3:171957292-171957314 GGCAAGGCCAGATTCTCTCTAGG + Intergenic
966912906 3:184569256-184569278 GGCAGCGCGAGTGTCAGTCCCGG - Intronic
968317345 3:197736268-197736290 GTCACGGCAAGTTTCAGTCCGGG + Intronic
968489604 4:882964-882986 TGCAAGGCCAGTGGCAGCCCTGG - Intronic
969959636 4:10930693-10930715 GGCCAGGCCAGGGTCAGCCCAGG - Intergenic
970494037 4:16607911-16607933 GGTAAGGCCACTTTCATTTCAGG + Intronic
971674412 4:29607113-29607135 GGAAAGGCCAGATTTAGTCCTGG + Intergenic
972032513 4:34478947-34478969 GGCAAGGCCATGTTCTCTCCAGG + Intergenic
973987607 4:56370153-56370175 GGCTAGGCCAGTCTCACTCCTGG - Intronic
977139295 4:93347066-93347088 TGCAAAGCCAGTTCCACTCCAGG - Intronic
977390792 4:96407747-96407769 TTCAAGTCCAGTTTCAGTCAAGG + Intergenic
977745236 4:100539220-100539242 GGCAAAGCCAGTTTGAATACAGG + Intronic
977917447 4:102610091-102610113 AGCATGGCCAGTTTCATTGCTGG - Intronic
978142064 4:105329318-105329340 GGCATGCCCAATTACAGTCCTGG - Intergenic
983800992 4:171929740-171929762 GGCAGGGCCCCTTTCAGGCCAGG - Intronic
993947178 5:94129707-94129729 GGGAAGGACAGTGTCACTCCTGG + Intergenic
999212866 5:149905451-149905473 GACAAGGTCAGTTTCAGACAAGG - Intronic
999822977 5:155247278-155247300 ACCAAGGCAAGTTTCAGTGCAGG - Intergenic
1002099883 5:176852128-176852150 GGCAAGGCCTGTGGCAGCCCCGG - Intronic
1006055795 6:31383823-31383845 GGCAAGGCCGACTCCAGTCCTGG + Intergenic
1007477330 6:42127596-42127618 GGCAAGGGGCCTTTCAGTCCAGG + Intronic
1008289311 6:49694266-49694288 GGCAAGCCCTGGTTCTGTCCTGG - Intronic
1008613630 6:53206257-53206279 GGCAAAGCCAGAATCAGTCAGGG + Intergenic
1012749753 6:103143061-103143083 GGCAAGGACATTTTAAGTCATGG - Intergenic
1022082052 7:27032134-27032156 GGCAATGCCTGTCTCAGTACAGG + Intergenic
1024024864 7:45401381-45401403 GGCAAGCCCAGATTTACTCCTGG + Intergenic
1024887531 7:54161526-54161548 AGCAAGGCAAGTTTCAGAGCAGG + Intergenic
1026971615 7:74472093-74472115 GGAAAGGCCAGTTCCAGGCCAGG - Intronic
1028233698 7:88335228-88335250 GGCAAGGGCAGTCTCAGGCTGGG - Intergenic
1030192072 7:106820207-106820229 GGGGAGGCCAGGTTCTGTCCAGG + Intergenic
1031003746 7:116448208-116448230 CCAAAGGCCATTTTCAGTCCAGG + Intronic
1031905669 7:127457729-127457751 GGCAAGGCCTGGTGCTGTCCTGG + Intergenic
1033067328 7:138168509-138168531 TGCAAAGCCAGTTTCAGTCAGGG + Intergenic
1034295210 7:149966297-149966319 GGCAGGGCCACTGTCAGGCCTGG + Intergenic
1034810852 7:154130650-154130672 GGCAGGGCCACTGTCAGGCCTGG - Intronic
1035692159 8:1567354-1567376 TCCAAGGCCAGCCTCAGTCCTGG + Intronic
1037583859 8:20263151-20263173 GGCCAGGCCAGCTTCTGCCCTGG - Intronic
1037812159 8:22093377-22093399 TGCAAGGCCAGTATCAGCCATGG + Intronic
1039771729 8:40694470-40694492 AGCAAGGCCTGCTGCAGTCCTGG - Intronic
1039951402 8:42175708-42175730 GGCATGGCCACTTTCTGCCCAGG + Exonic
1041329384 8:56707849-56707871 ACCAAGGCAAGTTTCAGACCAGG - Intergenic
1041755025 8:61304364-61304386 GGCAAGGCCAGTTTATGCTCAGG - Intronic
1041833812 8:62187937-62187959 GAAAAGGCAAGTTTCAGACCAGG - Intergenic
1043091220 8:75906826-75906848 GACAAGGCAAGTTTCAGAACAGG - Intergenic
1044352132 8:91178855-91178877 GGCCATGGCAGTTTCATTCCTGG + Intronic
1045359068 8:101415225-101415247 AGCAGGTCCAGTTTCATTCCAGG - Intergenic
1047348749 8:124053588-124053610 AGCAAGGGCAGTTTCAGTAATGG - Intronic
1048330173 8:133465788-133465810 AGGAAGGCAAGGTTCAGTCCTGG - Intronic
1048590533 8:135816971-135816993 GGCAAGTCCAGTTTCAGGGCAGG - Intergenic
1053428871 9:38028621-38028643 GGCAAGGCCAGCTCCAGCGCAGG + Intronic
1053692436 9:40593092-40593114 AGCATGGCCAGTGTCAGACCTGG - Intergenic
1054272380 9:63044441-63044463 AGCATGGCCAGTGTCAGACCTGG + Intergenic
1054303678 9:63394010-63394032 AGCATGGCCAGTGTCAGACCTGG - Intergenic
1054402456 9:64720520-64720542 AGCATGGCCAGTGTCAGACCTGG - Intergenic
1054436066 9:65204851-65204873 AGCATGGCCAGTGTCAGACCTGG - Intergenic
1054494326 9:65816836-65816858 AGCATGGCCAGTGTCAGACCTGG + Intergenic
1055084104 9:72296378-72296400 GGCAAGGAGAGTTCCTGTCCTGG - Intergenic
1057400828 9:94721519-94721541 TGCAAAGACAGTTTCAGTCTGGG + Intergenic
1058707543 9:107649874-107649896 GTCAAGGCCAGGTTAAGTCTTGG - Intergenic
1059455170 9:114395813-114395835 GGCATGGCCAATTTCAGTAAGGG - Intergenic
1059995434 9:119904179-119904201 GGAAACCCCAGTTCCAGTCCTGG - Intergenic
1060251133 9:121987607-121987629 GGAGAGGACAGTTTCAGTGCTGG + Intronic
1060892477 9:127197580-127197602 GGCATGGGCAATATCAGTCCAGG + Intronic
1061111191 9:128572448-128572470 GGCAAGGCCTGTCCCAGTACTGG - Intronic
1203623079 Un_KI270749v1:139158-139180 AGCATGGCCAGTGTCAGACCTGG - Intergenic
1188398603 X:29717391-29717413 GGCAAGGCCAGTGACATTCAAGG + Intronic
1188770607 X:34148668-34148690 AGCAAGGCCGGAATCAGTCCTGG + Intergenic
1189112384 X:38305204-38305226 GGCCAGGCCAGTCTCAAACCTGG - Intronic
1189286995 X:39858705-39858727 GACAAGGCCAGGTTCACACCAGG + Intergenic
1189293704 X:39904009-39904031 TGCAAGGCCACTTTTATTCCTGG - Intergenic
1190038527 X:47049671-47049693 CGCAAGGACTGTTACAGTCCAGG - Intronic
1191025908 X:55913116-55913138 GGCAAGAACAGTTTCAGTGATGG - Intergenic
1191640504 X:63426640-63426662 GGCTGGACCAGTTACAGTCCCGG + Intergenic
1192314762 X:70043047-70043069 GGTAAGGACAGCTCCAGTCCAGG - Exonic
1192497106 X:71623275-71623297 GGCAAGTCCATTTTAAGTGCTGG + Intergenic
1193247315 X:79244241-79244263 GGCAAGTCCTGTTTCTGTACTGG + Intergenic
1195330662 X:103796509-103796531 GGCAAGGCTGCTTACAGTCCGGG - Intergenic
1201924382 Y:19268767-19268789 GTCAAGGCAAGTTTCAGAACAGG + Intergenic