ID: 1091041731

View in Genome Browser
Species Human (GRCh38)
Location 11:132287174-132287196
Sequence AAGGCCAGTTTCAGTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091041721_1091041731 19 Left 1091041721 11:132287132-132287154 CCCTTGTCAGATCTGTCTAACCA 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1091041731 11:132287174-132287196 AAGGCCAGTTTCAGTCCTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 181
1091041727_1091041731 -6 Left 1091041727 11:132287157-132287179 CCTTAGGCCCTTTAGGCAAGGCC 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1091041731 11:132287174-132287196 AAGGCCAGTTTCAGTCCTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 181
1091041719_1091041731 29 Left 1091041719 11:132287122-132287144 CCATCATCCTCCCTTGTCAGATC 0: 1
1: 0
2: 0
3: 21
4: 217
Right 1091041731 11:132287174-132287196 AAGGCCAGTTTCAGTCCTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 181
1091041720_1091041731 22 Left 1091041720 11:132287129-132287151 CCTCCCTTGTCAGATCTGTCTAA 0: 1
1: 0
2: 2
3: 11
4: 129
Right 1091041731 11:132287174-132287196 AAGGCCAGTTTCAGTCCTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 181
1091041722_1091041731 18 Left 1091041722 11:132287133-132287155 CCTTGTCAGATCTGTCTAACCAG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1091041731 11:132287174-132287196 AAGGCCAGTTTCAGTCCTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 181
1091041725_1091041731 -1 Left 1091041725 11:132287152-132287174 CCAGTCCTTAGGCCCTTTAGGCA 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1091041731 11:132287174-132287196 AAGGCCAGTTTCAGTCCTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091041731 Original CRISPR AAGGCCAGTTTCAGTCCTGG TGG Intronic
901436411 1:9249746-9249768 CAGGACAGTTGCAGTCCTGCTGG - Intronic
901803884 1:11725626-11725648 AAGACCAGTTGCAGCCCAGGAGG - Exonic
902570934 1:17346667-17346689 AGGCCCAGTCTCAGTCCTTGGGG - Intronic
902686821 1:18082843-18082865 CAGGCCTGGTCCAGTCCTGGGGG - Intergenic
904158033 1:28501153-28501175 CAGCCCAGTTTCAGTCCAGGTGG + Intergenic
905830818 1:41065950-41065972 CATCCCAGTTTCAGTCCTGGTGG + Intronic
905865117 1:41372326-41372348 AAGGCCAGTGTCTGTGCGGGTGG + Intronic
906206555 1:43990533-43990555 GAGCCCAGTCTCAGTCCTGGAGG - Exonic
906936245 1:50216283-50216305 ATGGCAAGTCTCAGTCCTCGTGG + Intergenic
907560566 1:55383696-55383718 AATGCCAGCAACAGTCCTGGAGG - Intergenic
911359760 1:96862343-96862365 AAGGGTAGTATCAGTCCAGGTGG + Intergenic
912090701 1:106071787-106071809 AAAGTGAGTTTCAGTGCTGGTGG - Intergenic
912624286 1:111194821-111194843 AGGGCCAGATTCACTCCTGGGGG - Intronic
913069390 1:115285520-115285542 AGGCACAGTCTCAGTCCTGGGGG - Intergenic
914934267 1:151964522-151964544 AACACCAGCTGCAGTCCTGGTGG - Intergenic
915666898 1:157453365-157453387 AAGGACAGCTTGAGTCCAGGAGG - Intergenic
915981948 1:160425849-160425871 AGGGCCAGTTGCTGCCCTGGAGG - Exonic
922054174 1:222024288-222024310 AAAACCAGTTTTAGTTCTGGAGG - Intergenic
923114793 1:230925107-230925129 AAGGCACGTTTCAGTCATGATGG + Intronic
924920715 1:248626572-248626594 CAGGCCAGTTTCAGAACTGCTGG + Exonic
1069891180 10:71653300-71653322 AAGGCAAGCTTCAATCCTGGAGG + Intronic
1070012143 10:72486251-72486273 AAGGCCATTTTCAGTATTGTTGG + Intronic
1071212334 10:83358083-83358105 AAAGCAAGTTCCAGTCCTGCAGG - Intergenic
1072391448 10:94991659-94991681 AAGGGCAGTTACAGAACTGGTGG + Intergenic
1073773739 10:106763518-106763540 AAGGTAACTTTCGGTCCTGGTGG + Intronic
1073959147 10:108905967-108905989 ATGGCCAGTTTCACTAATGGGGG + Intergenic
1074545308 10:114397849-114397871 AAAGGCAGATACAGTCCTGGTGG - Intronic
1075772296 10:124949784-124949806 AATTCCAGTTTCAGGCCAGGTGG - Intronic
1075784339 10:125038755-125038777 GAGGACAGTTTCAGGGCTGGTGG - Intronic
1076095469 10:127731952-127731974 AAGGGGAGTGTCTGTCCTGGAGG + Intergenic
1077398977 11:2343633-2343655 CAGGAAAGTTTCAGTCATGGTGG + Intergenic
1078599260 11:12716019-12716041 AATGACAGTCTCAGTCTTGGGGG - Intronic
1083201336 11:61122865-61122887 TAGGTCAGTCCCAGTCCTGGGGG - Intronic
1083259273 11:61514443-61514465 ATGGCCCGCTTCACTCCTGGTGG + Intergenic
1083882135 11:65553967-65553989 CAGGGCAGGTTCAGCCCTGGAGG - Intronic
1083899289 11:65635962-65635984 AAGGCCACTGTCAGCTCTGGGGG - Intronic
1083998253 11:66282778-66282800 AAGGTCAGTGTCAGGGCTGGGGG + Exonic
1085445323 11:76597467-76597489 TTGGGCAGTTTAAGTCCTGGGGG - Intergenic
1090882578 11:130846916-130846938 AAGCAGAGTTTCAGTCCTTGTGG + Intergenic
1091041731 11:132287174-132287196 AAGGCCAGTTTCAGTCCTGGTGG + Intronic
1092128012 12:6088845-6088867 AAGGCCATTATCAGTCCCAGTGG + Intronic
1093122994 12:15295291-15295313 CAGGACAGTTCCAGTGCTGGTGG + Intronic
1094202389 12:27807225-27807247 CAGGCTACTTTCAGCCCTGGTGG + Intergenic
1095791605 12:46174207-46174229 AAGGCCAGTTTGGGTGGTGGTGG + Intergenic
1098959109 12:76719710-76719732 AAGGAAAGATCCAGTCCTGGCGG + Intergenic
1101706988 12:107230007-107230029 GTTGTCAGTTTCAGTCCTGGTGG + Intergenic
1102098689 12:110260687-110260709 AAGCCCAGTTACAGTCATGAGGG + Intergenic
1107419396 13:40232712-40232734 GAGGCCAGTCTCTGTGCTGGGGG - Intergenic
1107541182 13:41390707-41390729 AAGGACTGCTTCAGTCCGGGAGG - Intergenic
1107966446 13:45602487-45602509 CTGGCCTTTTTCAGTCCTGGGGG + Intronic
1111649229 13:91068271-91068293 AAGGACAGTTTCAATTTTGGAGG - Intergenic
1113558683 13:111258856-111258878 AAGGAGAGTCTCAGGCCTGGTGG + Intronic
1115450994 14:33547163-33547185 AAGGCCAGTTTGAGTCTTTAAGG + Intronic
1116721685 14:48504454-48504476 AAGGCCCCTTTGAGTTCTGGAGG + Intergenic
1120568400 14:86087597-86087619 AACACCACTTTCAGTTCTGGAGG + Intergenic
1122238646 14:100347319-100347341 AAGGCCTGTTTCAGTGCAGCTGG + Intronic
1124553656 15:30706675-30706697 CAGGCCAATTTCAGACCTGCTGG + Intronic
1124677592 15:31698999-31699021 CAGGCCAATTTCAGACCTGCTGG - Intronic
1125014144 15:34914664-34914686 CAGAACAGTTTAAGTCCTGGAGG - Intronic
1125681721 15:41534971-41534993 AAGCCCAGTTAGAGCCCTGGAGG - Intronic
1128719119 15:69933047-69933069 GAGACCAGCTTCAGTGCTGGAGG - Intergenic
1128735016 15:70048586-70048608 AAGGCCGCTGTGAGTCCTGGTGG - Exonic
1129995935 15:80006263-80006285 AAGGCCTGTGGCAGTCCAGGTGG + Intergenic
1130650743 15:85760748-85760770 GACGCCAGGGTCAGTCCTGGTGG + Exonic
1130942874 15:88525530-88525552 AAGGCCAGTGTCTGCCCTGTGGG - Intronic
1131932055 15:97453655-97453677 CAGTCCAATTTCAGACCTGGAGG - Intergenic
1132710502 16:1264135-1264157 AATGCCTGTTTCAGCCCAGGTGG + Intergenic
1133305099 16:4803594-4803616 AAAGCCTGTTCTAGTCCTGGCGG - Exonic
1133668870 16:7998123-7998145 AAGGACTGTTTGAGCCCTGGAGG + Intergenic
1137724968 16:50650868-50650890 AAGGCCAGGTACAGTTCTGCTGG + Intergenic
1141107531 16:81245748-81245770 AGGGCCACATTCAGTTCTGGAGG + Intronic
1141910640 16:87056435-87056457 AAGGCCAGTATCTGCCGTGGCGG - Intergenic
1141948882 16:87328091-87328113 TAGGCCATTTTCAGTGCTCGTGG - Exonic
1142428155 16:90011618-90011640 ATGGCCCGTTTCAGGCCTGGGGG + Intronic
1142987838 17:3707722-3707744 GCAGCCAGTTGCAGTCCTGGGGG - Intergenic
1144624111 17:16835969-16835991 AAGACCATTTTCAGTTCTGAGGG - Intergenic
1144882315 17:18436750-18436772 AAGACCATTTTCAGTTCTGAGGG + Intergenic
1145003557 17:19322075-19322097 AAGGGCAGCTTCAGTCCTGGGGG + Intronic
1145149919 17:20507636-20507658 AAGACCATTTTCAGTTCTGAGGG - Intergenic
1146161853 17:30564274-30564296 AAGACCATTTTCAGTTCTGAGGG - Intergenic
1147158234 17:38556106-38556128 AAGCCCAGGTTTAGTCCTGGAGG + Intronic
1147578255 17:41614688-41614710 AAGACCATTTTCAGTTCTGAGGG - Intronic
1150849586 17:68691928-68691950 AAGACAAGGGTCAGTCCTGGAGG + Intergenic
1152605161 17:81285929-81285951 AAGGCCAGGGTGAGCCCTGGAGG - Intronic
1152803797 17:82344986-82345008 ATGACCAGTTTCAGTACTGAGGG + Intergenic
1153241179 18:3032729-3032751 AAGGACATTTTTAGTCCTTGAGG - Intergenic
1157454702 18:47815585-47815607 AAGGCCAGTTTTTGTACTAGTGG - Exonic
1158241499 18:55383743-55383765 AAGGGCAGTGTCAGGCCTGGCGG + Intronic
1158956963 18:62549234-62549256 AAGGGTAGATTCAGACCTGGTGG + Intronic
1159110980 18:64056429-64056451 GAGCACAGTTTTAGTCCTGGTGG + Intergenic
1160415186 18:78705122-78705144 AGGGCCTCTTTCAGTCCTGTGGG + Intergenic
1162124738 19:8493423-8493445 AAGGTCAGGTTCGCTCCTGGTGG - Intronic
1167854474 19:52226557-52226579 AAGGCCAGCAGCACTCCTGGGGG - Exonic
1168192601 19:54750645-54750667 AAGCCCAGGTGCAGTCCAGGAGG - Intronic
1202655957 1_KI270708v1_random:21931-21953 CAGGCCAGGTGCAGTGCTGGAGG + Intergenic
927085530 2:19671387-19671409 AAGTCCTGGTTCAGTCTTGGAGG - Intergenic
927875524 2:26652962-26652984 AAGGCCAGTTTTGGGCCTGGAGG + Intergenic
928601411 2:32907489-32907511 AAGGATAGCTTCAGTCCGGGAGG - Intergenic
928943825 2:36754181-36754203 ATGGCAACTTTCACTCCTGGAGG + Intronic
933616172 2:84484485-84484507 AAGGCCACTTTCTCTACTGGAGG + Intergenic
933808061 2:86014455-86014477 CAGCCCAGATTCAGTGCTGGTGG + Intergenic
934946973 2:98549444-98549466 AAGGTCAGTTTTACCCCTGGGGG + Intronic
935148385 2:100412174-100412196 AAGGTCATTTTCATTCATGGAGG + Intronic
935800732 2:106692655-106692677 AAGGCTAGTGGGAGTCCTGGGGG - Intergenic
936015312 2:108954460-108954482 AAGGATAGTTTCAGGACTGGTGG - Intronic
936042046 2:109157492-109157514 AAGGCCAGTTTCAGATCCAGAGG - Intronic
936286858 2:111187689-111187711 AAGGAGGGTTTCAGTCTTGGTGG - Intergenic
940689732 2:156900673-156900695 AAGGTCACTTTCAGGCCTTGTGG + Intergenic
943395178 2:187324546-187324568 AAGGCCACTTTCAGTAAGGGTGG + Intergenic
944785834 2:203069319-203069341 AAAGCCAGTATCACTACTGGTGG - Intronic
944807437 2:203296172-203296194 AAGGATAGTTTAAGTCCAGGAGG + Intronic
945724072 2:213453664-213453686 AAGCCCAGTTTCTGTACTTGAGG + Intronic
947732902 2:232440795-232440817 CAGCCCAGTTGCAGGCCTGGGGG - Intergenic
1169815355 20:9650718-9650740 CATGCCAGTTAGAGTCCTGGCGG - Intronic
1170711451 20:18794792-18794814 AAGGCCAGTGTCTGTCAGGGAGG - Intergenic
1171099701 20:22371481-22371503 AAGGCCAGTTTCCCTCCTCCCGG - Intergenic
1171157412 20:22889168-22889190 AAAGCAATTTTCAGACCTGGTGG + Intergenic
1178305965 21:31490415-31490437 AAGGCTAGGTCCAGTCCTGCTGG - Intronic
1178454190 21:32731913-32731935 ATGGACAGTTTCATTTCTGGAGG + Intergenic
1181333593 22:22113491-22113513 AAGGCCCCATCCAGTCCTGGGGG - Intergenic
1182068484 22:27446670-27446692 AAGTCGAGTCTCAGTCCTGTAGG - Intergenic
1184453819 22:44598035-44598057 AGGGTGAGTTCCAGTCCTGGGGG - Intergenic
1185366648 22:50439924-50439946 GAGGACAGGATCAGTCCTGGGGG - Intronic
950379517 3:12599623-12599645 AAGTCAAGTTTCAGCCCAGGGGG - Intronic
952114762 3:30165283-30165305 ATCTCAAGTTTCAGTCCTGGAGG + Intergenic
956721533 3:72122224-72122246 ATGGCCTGTTTCACTCCTGCCGG + Intergenic
956768833 3:72507333-72507355 AAGGCTCGTGTCAGTCCAGGGGG - Intergenic
956918662 3:73902599-73902621 AAGGTCTGTTTCAGTGTTGGAGG - Intergenic
959631433 3:108511425-108511447 AAGGCAAGTATCAGTCTTAGAGG + Intronic
959645489 3:108695131-108695153 TAGGCCAGTCTCAGTACTTGAGG + Intergenic
961687519 3:128644568-128644590 AAGGACGGTTTGAGCCCTGGAGG + Intronic
963227459 3:142876854-142876876 AAGCCCAGATTCAATGCTGGGGG + Intronic
963247608 3:143077061-143077083 CAGGCCCGTTACAGTCCTGAAGG + Intergenic
963283631 3:143412003-143412025 AAGTCCCATTTCAGTCCGGGAGG + Intronic
964014061 3:151925351-151925373 AAGGCCAGTTGCAGGCCCTGTGG + Intergenic
964477120 3:157107165-157107187 AAGGCTATTTCCAGTCCAGGTGG - Intergenic
964838644 3:160969424-160969446 AAGGCCATTTACTGTCATGGGGG + Intronic
965808703 3:172569991-172570013 CAGGAAAGTTTCAGTCATGGTGG - Intergenic
966718908 3:183041574-183041596 TACTCCAGTTTCAATCCTGGTGG + Exonic
967700111 3:192582616-192582638 AAGTAGAATTTCAGTCCTGGTGG + Intronic
967810278 3:193753984-193754006 AAGGACACTTACAGTCGTGGCGG - Intergenic
968317346 3:197736271-197736293 ACGGCAAGTTTCAGTCCGGGTGG + Intronic
968782981 4:2597134-2597156 AGGGCCAGTTTCTATCCTTGGGG + Intronic
971822380 4:31574787-31574809 AAGGCAAGTGTCAATCCTGAAGG + Intergenic
974627928 4:64447459-64447481 AAGGCAAGTTTCAGAGCAGGAGG - Intergenic
975406469 4:73996267-73996289 AAAGCCTGTTCTAGTCCTGGTGG - Exonic
982404790 4:155007658-155007680 AGGGCCAGAGTCAGTTCTGGGGG + Intergenic
983563976 4:169130453-169130475 AAGGCCAGTTTGATTCATGGTGG - Intronic
983718668 4:170817511-170817533 AAGGCCACTCTCAGTTCTAGAGG - Intergenic
985614572 5:911713-911735 AAGGCCACTTTCCTTCCTGTTGG + Intronic
988931020 5:36035677-36035699 AAGGCCAGGTGCAGCCTTGGCGG - Exonic
989278158 5:39612063-39612085 AAGGCCCTTTTTAGTCCTGTTGG + Intergenic
997402819 5:133615540-133615562 AAGGCCATTTTCAGTTCTAAAGG + Intergenic
997440036 5:133902689-133902711 AAGGCCACTGTCAGACCTGGAGG - Intergenic
998231730 5:140365212-140365234 AAGACCAGTTCTAGCCCTGGTGG + Intronic
998454829 5:142263695-142263717 AATGCAAGCTTCGGTCCTGGTGG + Intergenic
999256814 5:150214153-150214175 GAGTCCAGTCTCTGTCCTGGAGG - Intronic
1002532232 5:179854305-179854327 CAGGCCAGATCCAGCCCTGGTGG - Intronic
1002711829 5:181199767-181199789 GAGAACAGTGTCAGTCCTGGGGG - Intronic
1004521965 6:16369746-16369768 AAGTCAGGGTTCAGTCCTGGTGG - Intronic
1007964248 6:45988925-45988947 AAGGCCAGTCTCAGTCTATGAGG + Intronic
1008314728 6:50026015-50026037 AAGGTGAGTCTCAGGCCTGGTGG + Intergenic
1012944513 6:105451267-105451289 AATGCCAGTTACAGCCTTGGGGG + Intergenic
1013124964 6:107174079-107174101 AAAACTATTTTCAGTCCTGGGGG + Intronic
1015224079 6:130836486-130836508 AAGGCCAGTTCCAGCTCTGGTGG + Exonic
1016856337 6:148674163-148674185 AATGAGAGCTTCAGTCCTGGAGG + Intergenic
1018511844 6:164532778-164532800 AAGGCCAGCTGCAGTCATGGGGG + Intergenic
1018771671 6:166976313-166976335 AAAGCCACTTTCAGACCAGGTGG - Intergenic
1019829463 7:3312249-3312271 CAGGTCAGTTTCAGACCTGAGGG - Intronic
1021182010 7:17517960-17517982 AAGGCCAGTGGCAAGCCTGGTGG - Intergenic
1021633859 7:22672107-22672129 AAGGCAAGTTTCTGTCCTTTAGG + Intergenic
1024436707 7:49365182-49365204 AAGGCCTGTTTTAGTCCTTTTGG - Intergenic
1028170226 7:87587299-87587321 ATGGCCAGTGACAGTTCTGGAGG - Intronic
1028743398 7:94301448-94301470 AATGCCAGATTGAGGCCTGGAGG + Intergenic
1030919620 7:115366053-115366075 AAAGCAAATTTCAGTCCTGCAGG + Intergenic
1031529213 7:122855889-122855911 ATGACCAGTCTCTGTCCTGGAGG - Intronic
1031932007 7:127695020-127695042 AAGGCCAGTGTGGGTTCTGGTGG + Intronic
1033204352 7:139404694-139404716 AAGGCCAGAGTTAATCCTGGTGG + Intronic
1033441945 7:141387940-141387962 AAGGCAGGTTTCAGTGCAGGTGG - Intronic
1033485313 7:141783450-141783472 AAGGCCAGTTTTACTCCATGAGG + Intronic
1036999046 8:13695680-13695702 TAGATCAGTTTGAGTCCTGGGGG + Intergenic
1037412057 8:18608128-18608150 GAGGACTGTTTCAGTCCAGGAGG + Intronic
1038071165 8:24015050-24015072 AAGTCTAGTTTGAGTCTTGGGGG + Intergenic
1046697531 8:117358649-117358671 AACACCAGTTTAAGTCCTGAAGG - Intergenic
1047766779 8:127996523-127996545 AATGCCAGTATGAGTCCTTGAGG - Intergenic
1048590532 8:135816968-135816990 AAGTCCAGTTTCAGGGCAGGAGG - Intergenic
1052487297 9:29118587-29118609 AAGGCCAGTCCAAGGCCTGGCGG + Intergenic
1057242905 9:93428047-93428069 AAGCACAGTTCCAGTCCTGGAGG - Intergenic
1057792097 9:98131083-98131105 AAGGCCTGGGTCACTCCTGGGGG + Intronic
1057887867 9:98844804-98844826 CAGGGGAGATTCAGTCCTGGGGG + Intronic
1058707542 9:107649871-107649893 AAGGCCAGGTTAAGTCTTGGAGG - Intergenic
1060529541 9:124340178-124340200 ATGGCCACTTCCAGACCTGGTGG + Intronic
1060836116 9:126756329-126756351 AAGGGCAAATTCAGTCCAGGAGG - Intergenic
1061278543 9:129583721-129583743 CAGGCCAGGCTCAGCCCTGGAGG + Intergenic
1185946868 X:4386413-4386435 AAGGGCAGTTTCTGACCTTGAGG + Intergenic
1187220804 X:17324001-17324023 AAGGCTTCTTTAAGTCCTGGGGG - Intergenic
1188147679 X:26633604-26633626 CAGGCCAATTTCAGGCCTGCTGG + Intergenic
1190064973 X:47233464-47233486 GAGACCAGTTTCGGTCCTGGAGG + Intronic
1192497109 X:71623278-71623300 AAGTCCATTTTAAGTGCTGGGGG + Intergenic
1192861161 X:75072615-75072637 AGAGCCATTTTCAGTCCTGCAGG - Intronic