ID: 1091041732

View in Genome Browser
Species Human (GRCh38)
Location 11:132287175-132287197
Sequence AGGCCAGTTTCAGTCCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091041722_1091041732 19 Left 1091041722 11:132287133-132287155 CCTTGTCAGATCTGTCTAACCAG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1091041732 11:132287175-132287197 AGGCCAGTTTCAGTCCTGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 142
1091041725_1091041732 0 Left 1091041725 11:132287152-132287174 CCAGTCCTTAGGCCCTTTAGGCA 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1091041732 11:132287175-132287197 AGGCCAGTTTCAGTCCTGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 142
1091041727_1091041732 -5 Left 1091041727 11:132287157-132287179 CCTTAGGCCCTTTAGGCAAGGCC 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1091041732 11:132287175-132287197 AGGCCAGTTTCAGTCCTGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 142
1091041719_1091041732 30 Left 1091041719 11:132287122-132287144 CCATCATCCTCCCTTGTCAGATC 0: 1
1: 0
2: 0
3: 21
4: 217
Right 1091041732 11:132287175-132287197 AGGCCAGTTTCAGTCCTGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 142
1091041721_1091041732 20 Left 1091041721 11:132287132-132287154 CCCTTGTCAGATCTGTCTAACCA 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1091041732 11:132287175-132287197 AGGCCAGTTTCAGTCCTGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 142
1091041720_1091041732 23 Left 1091041720 11:132287129-132287151 CCTCCCTTGTCAGATCTGTCTAA 0: 1
1: 0
2: 2
3: 11
4: 129
Right 1091041732 11:132287175-132287197 AGGCCAGTTTCAGTCCTGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091041732 Original CRISPR AGGCCAGTTTCAGTCCTGGT GGG Intronic
900781107 1:4617645-4617667 AGGTCAGTGTCAGGCCTGGGAGG + Intergenic
902148180 1:14420821-14420843 AGGCCAGCTTGAGTTCTGGGTGG - Intergenic
902676094 1:18009426-18009448 AGGACAATTTCCATCCTGGTTGG + Intergenic
903174158 1:21570662-21570684 AGGCAAGTTTGAGCCCTGGCTGG + Intronic
905304027 1:37005304-37005326 AGGCCAGAGTCAGCCCTAGTGGG - Intronic
910747391 1:90588632-90588654 AGCATCGTTTCAGTCCTGGTGGG - Intergenic
911359761 1:96862344-96862366 AGGGTAGTATCAGTCCAGGTGGG + Intergenic
917079406 1:171241152-171241174 AAGCCAGCTTCATTCCTGGGAGG + Intergenic
923395757 1:233560970-233560992 ATAGCAGTTTGAGTCCTGGTGGG - Intergenic
924920716 1:248626573-248626595 AGGCCAGTTTCAGAACTGCTGGG + Exonic
1063440989 10:6072907-6072929 AGGCTAATTTCATCCCTGGTGGG + Intergenic
1066568672 10:36748355-36748377 AGGCCAGTGTGAGTTCTGGGTGG + Intergenic
1067108046 10:43378467-43378489 GGGCCTGTTTCAGAGCTGGTGGG + Intergenic
1068031440 10:51709879-51709901 AGGTAAGTTTCCTTCCTGGTGGG - Intronic
1068300741 10:55135489-55135511 AAGCCATTTTCAGACCTGTTTGG + Intronic
1068528830 10:58162306-58162328 AGGCCAGTGTCAGTGTTGATAGG - Intergenic
1072966901 10:99981713-99981735 AGGCCTTGTTCAGTTCTGGTGGG - Intronic
1073773740 10:106763519-106763541 AGGTAACTTTCGGTCCTGGTGGG + Intronic
1075423401 10:122323257-122323279 GGGCTGGTTTCAGTCCTGCTGGG + Intronic
1075784338 10:125038754-125038776 AGGACAGTTTCAGGGCTGGTGGG - Intronic
1079076079 11:17386330-17386352 GGGCCAGTTTCAGGTCTGGAAGG - Exonic
1079867591 11:25756160-25756182 AGGCCAGTGTGAGTTCTGGGTGG + Intergenic
1080867990 11:36212607-36212629 AGGGCAGTTGCAGAACTGGTTGG - Intronic
1081677431 11:44979166-44979188 TGCCCAGTTTCAGTCCTGCCTGG + Intergenic
1083201335 11:61122864-61122886 AGGTCAGTCCCAGTCCTGGGGGG - Intronic
1083259274 11:61514444-61514466 TGGCCCGCTTCACTCCTGGTGGG + Intergenic
1083676020 11:64325287-64325309 AGGCCAGTTTGAGACCAGCTTGG + Intergenic
1085243023 11:75074313-75074335 GAGCCAGTTACAGTGCTGGTTGG + Intergenic
1087768809 11:102184608-102184630 AGGCCAGTTTCATTCGTATTAGG - Intronic
1087881900 11:103426048-103426070 AAGCCATTTTCTGTCCTGGGTGG - Intronic
1088787193 11:113192932-113192954 AGGCCAGTTTCACCCCTTCTTGG + Intronic
1089244762 11:117110769-117110791 GGGCCAGCTTGAGTTCTGGTGGG - Intergenic
1091041732 11:132287175-132287197 AGGCCAGTTTCAGTCCTGGTGGG + Intronic
1091404219 12:198948-198970 AGGCCAAGGTCACTCCTGGTGGG + Intronic
1091817569 12:3451578-3451600 TGGCCAGTTTGAGTCCTTGTAGG - Intronic
1092570118 12:9712066-9712088 AGGCCAGTTTAAGACCAGCTTGG + Intergenic
1092718192 12:11413699-11413721 GGGGAAGTTGCAGTCCTGGTTGG + Intronic
1096445998 12:51692280-51692302 AGGACAGTATCAGCCCAGGTTGG - Intronic
1096855475 12:54478783-54478805 CGGACAGTTTCAGTGCTGGGAGG - Intergenic
1097171830 12:57119165-57119187 AGGACAGTTTCATGACTGGTGGG - Intronic
1100397269 12:94196053-94196075 AGGGCAATCACAGTCCTGGTGGG - Intronic
1101049413 12:100845482-100845504 AGGCAAGTTTCAGTCATGGATGG - Intronic
1103341741 12:120224582-120224604 AGAGCACTTTCAGTCCTGGGTGG - Intronic
1106635395 13:31523800-31523822 AGATCAGTTTCTGTCCTAGTAGG + Intergenic
1108693428 13:52881075-52881097 AATCCAGTGTCAGTCCTGTTAGG + Intergenic
1109209287 13:59516016-59516038 ATGCCAGCTTCAGCCCTGGGTGG + Intergenic
1113578266 13:111409945-111409967 AGGCACCTTTCAGTGCTGGTTGG + Intergenic
1116684736 14:48024096-48024118 AGAACAATTACAGTCCTGGTTGG + Intergenic
1119398571 14:74347309-74347331 AGGCCACTGCCATTCCTGGTGGG + Intronic
1124069318 15:26376858-26376880 AGGCTGGTTTCAGTCATGGCAGG + Intergenic
1125126088 15:36222232-36222254 AGGCCAGACTCAGACCAGGTGGG + Intergenic
1125841799 15:42808635-42808657 AGGCCAGTTTGAGACCTGCTTGG + Intronic
1129995936 15:80006264-80006286 AGGCCTGTGGCAGTCCAGGTGGG + Intergenic
1130933263 15:88447932-88447954 TGGCCAGTATCAGTTCTGATAGG - Intergenic
1131820382 15:96267021-96267043 ATGCGAATTTCAGTCCTAGTAGG + Intergenic
1132291552 15:100707122-100707144 AGGCCTGTCTCTCTCCTGGTGGG - Intergenic
1132999660 16:2842475-2842497 AGGCCAACTTCAGTCCGGGCTGG - Intergenic
1133894086 16:9908888-9908910 AGGTCAGTTTCAGAGCTGGCTGG + Intronic
1135979046 16:27132321-27132343 GGGCCAGTTTCACTCTTGGATGG - Intergenic
1137724969 16:50650869-50650891 AGGCCAGGTACAGTTCTGCTGGG + Intergenic
1138030471 16:53555798-53555820 CGGGCAATTCCAGTCCTGGTAGG + Intergenic
1141659023 16:85431692-85431714 AGGCCAGCTCCTGTCCAGGTGGG - Intergenic
1141752969 16:85971681-85971703 AAGGCAGTTTCAGTCATTGTAGG - Intergenic
1141948881 16:87328090-87328112 AGGCCATTTTCAGTGCTCGTGGG - Exonic
1144642248 17:16943983-16944005 AAGCCATTTTCAGTCCAGCTTGG + Intronic
1145206910 17:20989496-20989518 AAGCCATTTTCAGTCCAGCTTGG - Intergenic
1146358050 17:32151536-32151558 AGACCATTTTCAGTCCTGCGCGG + Intronic
1147158235 17:38556107-38556129 AGCCCAGGTTTAGTCCTGGAGGG + Intronic
1149660052 17:58329542-58329564 AAGCCAGTTTCAGCCAAGGTCGG + Intergenic
1149996258 17:61407510-61407532 AGGCCAGTTTATGAACTGGTTGG + Intronic
1152133599 17:78491626-78491648 AGGCCAGGGTCAGGACTGGTGGG - Intronic
1154261551 18:12838535-12838557 AGCCCAGATCCAGTCCTGGGAGG + Intronic
1155486115 18:26344903-26344925 ACTCCAGATTCAGTCCAGGTGGG - Intronic
1156509793 18:37626775-37626797 AGGCCAGTGTCTGTCCGTGTAGG - Intergenic
1156685412 18:39639461-39639483 AGTCCAGTTTCACTCTGGGTAGG - Intergenic
1159110981 18:64056430-64056452 AGCACAGTTTTAGTCCTGGTGGG + Intergenic
1161208748 19:3055743-3055765 AAGCCGGCTTCAGTCCTGGGCGG + Intronic
1164447380 19:28329690-28329712 TGGCCCGTTTCAGTCATGGCTGG - Intergenic
1165838467 19:38773186-38773208 CTGCCAGTCTCAGCCCTGGTCGG - Intronic
1165841092 19:38789511-38789533 CTGCCAGTCTCAGCCCTGGTCGG + Intronic
929943235 2:46351117-46351139 AGGCCTTTTTCTGTCCTGTTTGG + Intronic
929955892 2:46458402-46458424 AGGCCAGTGTGAAACCTGGTAGG + Intronic
930281921 2:49379430-49379452 GGGCCAGTTTGGTTCCTGGTGGG - Intergenic
932414620 2:71566125-71566147 AAGCCAGTTCCTGGCCTGGTAGG + Intronic
933808062 2:86014456-86014478 AGCCCAGATTCAGTGCTGGTGGG + Intergenic
937620583 2:123980560-123980582 TGGCCACTTTCAGTCATGGCTGG - Intergenic
943189099 2:184653469-184653491 AGGCAAGTTTCAGAGCAGGTTGG + Intronic
943395179 2:187324547-187324569 AGGCCACTTTCAGTAAGGGTGGG + Intergenic
947910344 2:233796378-233796400 AGGCAAGTTTCATTCATGTTCGG + Intronic
948409163 2:237745873-237745895 AGGCTAGTTTAACTCTTGGTGGG - Intronic
948556139 2:238812867-238812889 AGGCCAGGGACAGCCCTGGTTGG + Intergenic
1169072104 20:2738999-2739021 AGGCCAGGTCCAGGCCTGGCAGG + Intronic
1169815354 20:9650717-9650739 ATGCCAGTTAGAGTCCTGGCGGG - Intronic
1170489770 20:16861322-16861344 AAGGAAGTTTCATTCCTGGTAGG + Intergenic
1172208015 20:33178249-33178271 AGCCCAGATCCAGGCCTGGTGGG + Intronic
1174270839 20:49367238-49367260 AGGCAGTTTTCAGTCCTGGGTGG - Exonic
1174711538 20:52711292-52711314 AGGCCAGTGTGAGTCCTGAAAGG - Intergenic
1174916782 20:54661965-54661987 AGGCGAGCATCAGTCCTGGGTGG - Intergenic
1178138110 21:29651137-29651159 AGGCCAGTCTCGGGCCTGGGTGG + Exonic
1178161022 21:29914584-29914606 AGGCCAGTTTCCTTCCTTTTGGG + Intronic
1181580979 22:23827899-23827921 AGACCAGTGTCAGTCCTGCCTGG + Intronic
1184739178 22:46417322-46417344 AGGCCAGTTTGAATTCTGGAAGG - Intronic
953606806 3:44417766-44417788 AGGCCACTCCCAGTCCTGGTAGG + Intergenic
956691781 3:71885252-71885274 AGGCCAGCTAAAGTCCTGGCTGG - Intergenic
959645490 3:108695132-108695154 AGGCCAGTCTCAGTACTTGAGGG + Intergenic
959940394 3:112075240-112075262 AAGCCAGTTTTAGTGCTGGCTGG - Intronic
960935282 3:122896202-122896224 AGGCCAGTTTCAGTCTTTAATGG + Intergenic
963247609 3:143077062-143077084 AGGCCCGTTACAGTCCTGAAGGG + Intergenic
973233021 4:47864527-47864549 AGGCCTGTTTCAGTTCTTTTTGG - Intronic
974438395 4:61885890-61885912 AGGACAGTTTCTGGCATGGTAGG + Intronic
975217131 4:71768758-71768780 AAGAAAGTTTCAGTTCTGGTCGG - Intronic
975406468 4:73996266-73996288 AAGCCTGTTCTAGTCCTGGTGGG - Exonic
981989913 4:150906056-150906078 GGGCCAGTTTTTTTCCTGGTAGG - Intronic
984530920 4:180915286-180915308 AGGAAACTTTCACTCCTGGTAGG + Intergenic
988847254 5:35140737-35140759 TGGCCAGTTTCTGTTCTGATTGG + Intronic
991560623 5:67947699-67947721 ATGCCATTTTCAGACCTGCTAGG + Intergenic
994241214 5:97423732-97423754 AAGCCATTTTCAGCCCAGGTTGG - Intergenic
996107019 5:119517147-119517169 AGGCCAGCTTGAGTTCTGGGTGG + Intronic
997191203 5:131937513-131937535 AAGTCATTTTCAGTCCTGCTTGG + Intronic
998454830 5:142263696-142263718 ATGCAAGCTTCGGTCCTGGTGGG + Intergenic
1001031506 5:168266575-168266597 AGGAGAGTTTCAGGCCTGGGTGG - Intergenic
1002711828 5:181199766-181199788 AGAACAGTGTCAGTCCTGGGGGG - Intronic
1005483604 6:26277983-26278005 AGGCCAGTCTTGGTCCTGCTGGG - Intergenic
1006117084 6:31781184-31781206 AGACCAGACACAGTCCTGGTCGG - Intronic
1011052114 6:83163965-83163987 ATACCAGTTTCATTGCTGGTAGG - Intronic
1015224080 6:130836487-130836509 AGGCCAGTTCCAGCTCTGGTGGG + Exonic
1015336691 6:132047137-132047159 TGGCCAGTGTCATTCCTGGCTGG + Intergenic
1018511845 6:164532779-164532801 AGGCCAGCTGCAGTCATGGGGGG + Intergenic
1020271250 7:6597623-6597645 AGGCCAGTTTCTGTTTTTGTTGG - Intronic
1021182009 7:17517959-17517981 AGGCCAGTGGCAAGCCTGGTGGG - Intergenic
1021961806 7:25880762-25880784 AGGGCAGTTACATTCCTGTTGGG - Intergenic
1023354684 7:39355032-39355054 GTGCCAGATTCATTCCTGGTGGG - Intronic
1024436706 7:49365181-49365203 AGGCCTGTTTTAGTCCTTTTGGG - Intergenic
1030056321 7:105586722-105586744 AGGCCAGACTCAGCCCGGGTAGG - Intronic
1033331636 7:140421567-140421589 AGGCCAGGTTCAGACCAGCTTGG - Intronic
1033441944 7:141387939-141387961 AGGCAGGTTTCAGTGCAGGTGGG - Intronic
1034784280 7:153910916-153910938 AGTCCACTTGCAGTCCAGGTAGG - Intronic
1040079932 8:43275565-43275587 AGCCCAGGTGCAGCCCTGGTGGG + Intergenic
1047114865 8:121830108-121830130 AGGCCAGTCTCAGTGATTGTAGG - Intergenic
1047374994 8:124287429-124287451 AGGCCACTTTCAGTACTCTTGGG - Intergenic
1049641521 8:143718129-143718151 AGGCCAGTTTCTCTCCTGTCTGG - Intronic
1049808629 8:144553112-144553134 AGGAAAGCTTCACTCCTGGTGGG + Intronic
1050023021 9:1304660-1304682 AGGCAACTTTCAGTGCTCGTAGG - Intergenic
1053444010 9:38137540-38137562 AGGCCAGTTTGAGTCCTTCTAGG - Intergenic
1058707541 9:107649870-107649892 AGGCCAGGTTAAGTCTTGGAGGG - Intergenic
1060447938 9:123709084-123709106 TGACCACTTTCAGTCCTGCTGGG - Intronic
1187822730 X:23305618-23305640 AGGCCAGCTTCTGTTATGGTTGG - Intergenic
1189283489 X:39835672-39835694 AGGCCAGTTTGAGACCAGCTTGG - Intergenic
1190520787 X:51277668-51277690 AAGCCATTTTCAGACCTGCTTGG - Intergenic
1192157427 X:68757067-68757089 AGGCCAGTTTCACCCTAGGTTGG + Intergenic
1192332858 X:70192032-70192054 AGGCCAGTTTGAGACCAGCTGGG + Intronic
1193119264 X:77806482-77806504 AGGCCAGTTTGAGACCTGCCTGG - Intergenic
1197124758 X:122931152-122931174 AGGCCAGTTTCATTCAGGATTGG - Intergenic
1199861847 X:151808082-151808104 AGGCTACTTTCAGCCCTTGTGGG - Intergenic