ID: 1091044235

View in Genome Browser
Species Human (GRCh38)
Location 11:132311729-132311751
Sequence CTATTATTCCAATTCTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091044233_1091044235 25 Left 1091044233 11:132311681-132311703 CCAAATCTTCAATTGTCTAGGTC 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1091044235 11:132311729-132311751 CTATTATTCCAATTCTTTATTGG 0: 1
1: 0
2: 4
3: 12
4: 294
1091044232_1091044235 26 Left 1091044232 11:132311680-132311702 CCCAAATCTTCAATTGTCTAGGT 0: 1
1: 0
2: 5
3: 18
4: 172
Right 1091044235 11:132311729-132311751 CTATTATTCCAATTCTTTATTGG 0: 1
1: 0
2: 4
3: 12
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091044235 Original CRISPR CTATTATTCCAATTCTTTAT TGG Intronic
900295751 1:1948515-1948537 CTATAATCCCAATACTTTAGAGG - Intronic
905839030 1:41157986-41158008 GTAATATTCCTATTCTTTCTTGG + Intronic
906559562 1:46746255-46746277 CTATTATTCCATAGCATTATAGG - Intergenic
906765044 1:48422055-48422077 TCATTATTCCAAATCTGTATTGG - Intronic
906974174 1:50551172-50551194 CTATTATGTCAATTTTTTAAAGG + Intronic
908460858 1:64347403-64347425 CTTTTATTAATATTCTTTATGGG + Intergenic
908635513 1:66159734-66159756 CTAATATTCCCTGTCTTTATAGG + Intronic
908792981 1:67801893-67801915 CTTTTCTTCCACTTTTTTATAGG - Intronic
910389363 1:86722568-86722590 CTGCTGTTCCAATTCTTTTTTGG - Exonic
911005929 1:93224110-93224132 CTATTTTTTCAATTTTTTGTGGG - Intronic
912126493 1:106545505-106545527 CTATCTTTCCAATTCTTTAATGG - Intergenic
912168871 1:107073044-107073066 TTATTCTTCCTATTCTTTAGGGG - Intergenic
912929360 1:113942876-113942898 TTATTATTTCACTTCTTGATTGG - Intronic
913976507 1:143461614-143461636 CTATTGTTCCTAGTTTTTATTGG - Intergenic
914070907 1:144287230-144287252 CTATTGTTCCTAGTTTTTATTGG - Intergenic
914108248 1:144679125-144679147 CTATTGTTCCTAGTTTTTATTGG + Intergenic
914736032 1:150417790-150417812 CAATTATTACAGTTCTTAATGGG - Intronic
915799028 1:158768899-158768921 TTCTTATTCCTATTGTTTATTGG + Intergenic
916532472 1:165670601-165670623 ATTTTATTCCAATTTTTTAATGG - Intronic
916541471 1:165759811-165759833 ATATCAATACAATTCTTTATGGG - Intronic
917388626 1:174506807-174506829 CTATTATTTCAATAGTTTTTGGG - Intronic
918660855 1:187086847-187086869 ATATCACTACAATTCTTTATAGG - Intergenic
918949439 1:191117021-191117043 CTACTAAACTAATTCTTTATTGG - Intergenic
920585500 1:207155594-207155616 TTATTATGCTAATTCTTGATGGG + Intergenic
922394720 1:225184836-225184858 GTCTTATTCCAATTCTTAAGGGG - Intronic
924321567 1:242855766-242855788 TTATTATTTCAATACTTTTTGGG + Intergenic
924397965 1:243643799-243643821 ATATTATTCTAATAATTTATAGG - Intronic
924503714 1:244660928-244660950 CTATTATTCCAAAGCTTTATTGG + Intronic
924918337 1:248598045-248598067 ATATTCTTCCATTTATTTATTGG + Intergenic
1064268477 10:13844499-13844521 GTATTATCAAAATTCTTTATCGG - Intronic
1064283045 10:13968787-13968809 CTATCATTCCCATTCTGTAATGG + Intronic
1065432082 10:25669431-25669453 ATATTATTACTATTCTTTTTAGG - Intergenic
1068413094 10:56683376-56683398 CTTTTATTCTTATTTTTTATGGG + Intergenic
1068850385 10:61732144-61732166 CTACTTTTTGAATTCTTTATTGG + Intronic
1070270271 10:74947247-74947269 CTATAATTCCAGTACTTTTTTGG - Intronic
1070668085 10:78359448-78359470 CTATCACTCCACTCCTTTATTGG - Intergenic
1072136287 10:92549757-92549779 CTATTAGTCCCATTCTTTACTGG + Intronic
1072880870 10:99227765-99227787 CTAGAATGCAAATTCTTTATAGG - Intronic
1073195842 10:101691028-101691050 AGGTTATTCCCATTCTTTATAGG + Intronic
1074644169 10:115425716-115425738 CTTTTTTTCCAATTATTTACCGG + Intronic
1077902858 11:6503822-6503844 CAATTATTACAATTATTTCTGGG - Intronic
1080269732 11:30438378-30438400 TTCTTATTCCTATTCTTCATAGG - Intronic
1080915422 11:36653064-36653086 CTGTTTTTCCAATTCATAATAGG + Intronic
1081207978 11:40296649-40296671 TACTTATTCCAATTCTTTTTGGG - Intronic
1081465640 11:43313829-43313851 CTGTAATCCCAATTCTTTAAGGG + Intronic
1081575370 11:44315895-44315917 CTATTATTCTCATTCTATAATGG + Intergenic
1081955330 11:47087248-47087270 GTATTATACCATTTCTTTTTAGG - Intronic
1083909644 11:65698760-65698782 TTATTCTTCCAAATCTTTTTGGG - Intergenic
1085954383 11:81373530-81373552 CTATTCCTCTAATTCTTCATTGG - Intergenic
1086650051 11:89277647-89277669 CTAATATTCCACTTCTTCAGGGG + Intronic
1086947551 11:92858079-92858101 TTTTTATTCCAACTATTTATTGG - Intronic
1087145260 11:94804451-94804473 CTATTTTTGTAATTCTTTTTTGG + Intronic
1087413237 11:97819702-97819724 CCATTATTTGAATTCTTTATAGG + Intergenic
1087807860 11:102574977-102574999 CCATTATTCCAATTTTATAAAGG + Intergenic
1088076232 11:105851931-105851953 CTACTGTTCCATTTCTATATCGG + Intronic
1088617857 11:111650092-111650114 CTACTAATCCAATGTTTTATGGG - Intronic
1088845707 11:113664530-113664552 CCATTATTCTAAATCTTTACTGG + Intergenic
1088992029 11:114961939-114961961 CTTTTGTTCCATTTCTTTAAGGG + Intergenic
1090222372 11:125039396-125039418 CTATTACTCAAATACTTTAATGG + Intronic
1091044235 11:132311729-132311751 CTATTATTCCAATTCTTTATTGG + Intronic
1093017520 12:14170156-14170178 TCATTATTCCAATTCATTTTTGG + Intergenic
1093390589 12:18614974-18614996 TTATTATTTCAATGCTTTTTAGG + Intronic
1094344842 12:29456042-29456064 CTAGTATTCCAATTTTATTTTGG + Intronic
1095197985 12:39345397-39345419 CTATAATTTTAATTTTTTATTGG - Intronic
1099196675 12:79625181-79625203 CTAGTTTTCCATTTCTCTATAGG + Intronic
1099391295 12:82082562-82082584 CTGTTATACCAATTCTTTTCAGG + Intergenic
1099908217 12:88797188-88797210 CTATTAATTCAATTTTTAATTGG - Intergenic
1100559644 12:95735207-95735229 CTATTGGTCCAATTGCTTATGGG + Intronic
1100948229 12:99812853-99812875 CTCTTATTCCAATTATCTGTAGG - Intronic
1102776393 12:115523254-115523276 CCATTATTGCAATTTTTTGTGGG - Intergenic
1105222730 13:18348207-18348229 CTATTGTTCCTAGTTTTTATTGG + Intergenic
1107634719 13:42380727-42380749 CTGTTCTCCCAATTCTTTGTTGG - Intergenic
1108404719 13:50088844-50088866 CTATGATTCCAATCCTGAATAGG - Intronic
1108582994 13:51843147-51843169 ATATTTTGCCAATTCTTTCTAGG + Intergenic
1110327201 13:74230459-74230481 CAATTATACCTATTATTTATTGG - Intergenic
1111506928 13:89203046-89203068 CAAATATTCAAATTTTTTATTGG - Intergenic
1111789515 13:92836838-92836860 CTGTTATTCCAAATCTCTTTTGG + Intronic
1112321556 13:98412577-98412599 CTATTATTTTAATTATTCATTGG - Intronic
1112937153 13:104815225-104815247 CTATTTTAGAAATTCTTTATTGG - Intergenic
1114040929 14:18677765-18677787 CTATTATTACTATTATTTTTTGG + Intergenic
1114334208 14:21670952-21670974 CTTTTTTTCTAATTCTTTACAGG - Intergenic
1115966890 14:38900213-38900235 CTATTTTTTAAATTCTCTATTGG + Intergenic
1116278800 14:42874093-42874115 CTATTTTTCCATCTCATTATTGG + Intergenic
1116405848 14:44565275-44565297 TTATTACTCCATTTCTTTCTTGG - Intergenic
1117050295 14:51853777-51853799 CTATTTTTCCAAGGCTTTGTGGG + Intronic
1117367442 14:55043351-55043373 CGACTACTACAATTCTTTATTGG - Exonic
1118519454 14:66565555-66565577 CTATAATTCCAGTACTTTAAGGG - Intronic
1118686245 14:68294265-68294287 CAATTATTTCCATTCTTTGTTGG - Intronic
1119535583 14:75400258-75400280 CTCTGATTACAATTCTTTATGGG + Intergenic
1120406197 14:84096379-84096401 CTATTCTTCCCATTTTTTAGAGG + Intergenic
1123163899 14:106307322-106307344 ATATTATTCTAATTATTTAATGG + Intergenic
1126557196 15:50002551-50002573 ATATATTTCCAATTATTTATTGG - Intronic
1127233758 15:57024721-57024743 CTATTCTTCCAATTACTGATTGG - Intronic
1128895877 15:71373365-71373387 CTGTTATTTCCTTTCTTTATTGG + Intronic
1130404875 15:83589818-83589840 CTATTATACCATTTCCCTATTGG + Intronic
1131571949 15:93546795-93546817 CTATTATTCCTCTTCTGTATGGG - Intergenic
1131745057 15:95438583-95438605 TTATTATTCCAATTTTATAGCGG - Intergenic
1135122014 16:19774320-19774342 CTATTATTATATTTCATTATTGG + Intronic
1138142818 16:54583098-54583120 CTAGAATTCCAATTCCTTCTTGG - Intergenic
1138738034 16:59274969-59274991 CTTTTCTCCCAATTCTTTATCGG - Intergenic
1139404071 16:66704522-66704544 CTATAATCCCAATTCTTTGCAGG + Intergenic
1140330255 16:74049527-74049549 TTATTATTTCAATTGTTTTTGGG + Intergenic
1141332542 16:83124988-83125010 TTATAAAACCAATTCTTTATTGG + Intronic
1144116867 17:12103302-12103324 CTGTAATTCCAATGCTTTAGGGG - Intronic
1144322457 17:14142630-14142652 CTATTATATCTTTTCTTTATTGG + Intronic
1146797161 17:35790566-35790588 CTATTTTTTCTATTCATTATTGG + Intronic
1148396835 17:47315009-47315031 CTATTCTTCCAGTTTTTCATGGG - Intronic
1149012649 17:51873362-51873384 ATGTTTTTCCAATTCTTTATAGG - Intronic
1149130030 17:53288080-53288102 CTATAATGCCAATACTATATAGG - Intergenic
1152814924 17:82402077-82402099 GTATTATAGCAATTCTTTAAGGG - Intronic
1153373513 18:4348849-4348871 CTATTAATTCAATTACTTATTGG - Intronic
1153436882 18:5077471-5077493 CTATTTTAACAATTCTTTAGTGG - Intergenic
1155027279 18:21953004-21953026 CTATTTTTCCATTTATTTAAAGG + Intergenic
1157741614 18:50098288-50098310 GTATTGTTCCAATTGTTTAAGGG + Intronic
1158767349 18:60469780-60469802 CTAATATTCCAGTTGTGTATAGG + Intergenic
1159180861 18:64902700-64902722 CTATTATTTCACTTCTTTTATGG - Intergenic
1159679672 18:71332809-71332831 CAATTATTTAACTTCTTTATAGG - Intergenic
1165660302 19:37573141-37573163 TTTTTCTTCCAACTCTTTATTGG + Intronic
925570611 2:5308496-5308518 CTATTATATCAAATCTTAATGGG + Intergenic
926527296 2:13996587-13996609 CCATTATTTCAATTATTTTTTGG - Intergenic
927563054 2:24087335-24087357 CTATAATTCCAGTACTTTACAGG - Intronic
928248189 2:29650230-29650252 CTAATCTTCTAATTCTGTATTGG + Intronic
929359081 2:41061948-41061970 TTATTATTCTCATTCTTTAAAGG - Intergenic
929368177 2:41187392-41187414 TTATTCTTTCAGTTCTTTATAGG - Intergenic
930364857 2:50426610-50426632 CTAATGTACCAATTCTTTAGAGG + Intronic
931189564 2:59987095-59987117 GTATTATTACAATTCTTTCCTGG + Intergenic
931582409 2:63791357-63791379 TTAGTATTCCAATTCTTTATGGG + Intronic
932027145 2:68145916-68145938 ATATAATTCCAATTTATTATTGG + Intronic
932500464 2:72178688-72178710 CTTTTATTGCAATTTTTTCTAGG - Exonic
932671497 2:73741308-73741330 CTATAATTCCAGTACTTTGTGGG - Intergenic
933287987 2:80405434-80405456 CTTTTATTAAAATTCTTTAATGG + Intronic
933612722 2:84453994-84454016 CTGTTATTCCACTTCTAGATGGG - Intronic
934181210 2:89622580-89622602 CTATTGTTCCTAGTTTTTATTGG - Intergenic
934291507 2:91696819-91696841 CTATTGTTCCTAGTTTTTATTGG - Intergenic
934306982 2:91834180-91834202 CTATTATTTCAATTATATTTTGG + Intergenic
934326274 2:92018562-92018584 CTATTATTTCAATTATATTTTGG - Intergenic
934745798 2:96758877-96758899 TTATTTTTCCTTTTCTTTATTGG + Intergenic
935669647 2:105544138-105544160 GTATAATTCCAATTCCTTTTTGG + Intergenic
936748861 2:115615686-115615708 ATATGATTGCAATTATTTATGGG + Intronic
937385159 2:121423763-121423785 CTATGATGCCAACTTTTTATTGG - Intronic
937530542 2:122822137-122822159 CTTTTATTAAAATTCTTCATTGG - Intergenic
937683970 2:124675489-124675511 CCATTTTTCTACTTCTTTATTGG + Intronic
939219809 2:139287263-139287285 CCATTATTTCATTTCTTTTTAGG - Intergenic
939471842 2:142632209-142632231 CCTTTATTCCAATTCTTCCTTGG + Intergenic
939472382 2:142640042-142640064 AAATTATTCTAATACTTTATTGG - Intergenic
940353484 2:152715468-152715490 CTATAATTCTGATTCTTCATAGG - Intronic
941579674 2:167279427-167279449 CTTTTATTTCAATGCTTTTTTGG - Intergenic
941931203 2:170941346-170941368 CTTTTTTTCCAATTCTTCTTAGG - Intronic
943306090 2:186264475-186264497 CTATTATTCCCATTGTATTTAGG - Intergenic
943987906 2:194646353-194646375 CTTTTATTGCAATTGTTTTTGGG + Intergenic
944329819 2:198452497-198452519 CTATTATTACATCTGTTTATTGG + Intronic
946104760 2:217359335-217359357 CTATCATGCTACTTCTTTATTGG - Intronic
946989291 2:225309837-225309859 CTATTATTCCATTTTTTCACAGG - Intergenic
1168898475 20:1340106-1340128 CTATAATTGCAATGCATTATGGG - Intronic
1169308490 20:4515493-4515515 CTCTTCTTCAAATTCTATATAGG - Intergenic
1169605348 20:7311822-7311844 CTATTATTCTGGTTCTTTGTAGG + Intergenic
1170314343 20:15027230-15027252 CTATTATTCCATTTTATTATAGG + Intronic
1170533442 20:17316646-17316668 TTATTATTCTAACTTTTTATAGG - Intronic
1170875443 20:20245643-20245665 CTATTATCCCTATTTTTTTTAGG - Intronic
1171479873 20:25446180-25446202 CTATTCTTCCTACTCTTTTTTGG + Exonic
1172387359 20:34543430-34543452 CAATTATTTCAATTCTCTGTAGG - Intergenic
1174523341 20:51151340-51151362 TTATTATTCCCATAATTTATTGG - Intergenic
1174687951 20:52473586-52473608 TCATCATTCCAATTCTTAATTGG + Intergenic
1174738258 20:52986089-52986111 CCATTATTTCATTTCTTTACTGG - Intronic
1174994245 20:55547566-55547588 CTATTTTTATAAATCTTTATTGG + Intergenic
1176731279 21:10500630-10500652 CTATTGTTCCTAGTTTTTATTGG + Intergenic
1177091041 21:16768927-16768949 CCATTATTCCATCTTTTTATCGG + Intergenic
1177533874 21:22399081-22399103 AAATGTTTCCAATTCTTTATCGG - Intergenic
1177829348 21:26119978-26120000 CTATTATTCCTCTTCATTTTTGG + Intronic
1180585787 22:16888331-16888353 CTATTATTTCAATTATATTTTGG - Intergenic
1181693301 22:24578547-24578569 GCACTGTTCCAATTCTTTATGGG - Intronic
951337386 3:21441120-21441142 TTATTATTTCAAGTCTTTATGGG - Intronic
951394061 3:22142879-22142901 TTACTATTGCTATTCTTTATGGG - Intronic
953038741 3:39236364-39236386 ATATTATTACAATTATTTATTGG - Intergenic
954592577 3:51795968-51795990 CTATTTTTTCATTGCTTTATGGG + Intergenic
955804191 3:62717171-62717193 CTAGTAATCCAACTCTTTGTTGG - Intronic
956473218 3:69591319-69591341 TTATTTCTCCAATTCTTTGTAGG + Intergenic
956620033 3:71212673-71212695 ATATCATTCAAATGCTTTATTGG + Intronic
957707467 3:83807552-83807574 TTATACTTTCAATTCTTTATTGG - Intergenic
959373264 3:105556529-105556551 TTATTATTCCAGTACTTTCTTGG + Intronic
960384952 3:117011701-117011723 CTATTATTCTTATTTTTTCTTGG + Intronic
960757414 3:121031145-121031167 ATAATATTCAAATTCCTTATGGG - Intronic
962021415 3:131505708-131505730 CTAAGATTTCAATTCCTTATTGG + Intergenic
962778518 3:138688032-138688054 CTATTATTACAATCATTAATGGG + Intronic
965212240 3:165806791-165806813 GTATTATTCTAATTGTTTAATGG + Intronic
965263480 3:166511997-166512019 CTAGTATTCCAATTAATCATAGG - Intergenic
965636856 3:170790940-170790962 CTATGATTCACATACTTTATGGG - Intronic
965987307 3:174770881-174770903 TTTTTATTTCAATTGTTTATGGG + Intronic
967739110 3:192985794-192985816 CTATTATCCCCATTTTTGATAGG + Intergenic
968241436 3:197090737-197090759 ATAATATTCCAATTCTTGAAAGG + Intronic
970265256 4:14275979-14276001 CTATTGTTCCAATTCCACATAGG + Intergenic
970760121 4:19475653-19475675 CTAGTATTGCAATTTTTAATAGG + Intergenic
971511496 4:27431594-27431616 ATATTATTCCACTTATTTCTAGG - Intergenic
974570799 4:63646170-63646192 TTATTTTTCCACTTCTGTATTGG + Intergenic
975445842 4:74464151-74464173 CTATTATTCCAATCCTTTGTGGG + Intergenic
975962591 4:79931024-79931046 CTAATATTACAATTCTATTTAGG - Intronic
976365945 4:84232342-84232364 CTTTAATTCCAAATTTTTATCGG + Intergenic
976415685 4:84771686-84771708 CTATTATTCCAATTATACAAGGG - Intronic
977389890 4:96394126-96394148 TTATTATTCAGATTTTTTATTGG - Intergenic
978101738 4:104849731-104849753 CTATCATCACAATTTTTTATAGG - Intergenic
978634277 4:110785385-110785407 CTATTCTTCTGAATCTTTATGGG + Intergenic
978873097 4:113604429-113604451 CAATTTTTCTAATGCTTTATTGG + Intronic
980337308 4:131493688-131493710 TGATTATTCTAATGCTTTATGGG + Intergenic
980433412 4:132736143-132736165 TTATTATTCTATTTCTTCATTGG - Intergenic
980934561 4:139213948-139213970 GCATTATTCTAATTGTTTATAGG + Intergenic
981955476 4:150467386-150467408 CTTTTATTTCACTTATTTATGGG - Intronic
981982324 4:150809160-150809182 ATATTATTTCCATCCTTTATTGG - Intronic
982493277 4:156056953-156056975 TTAGTTTTCCAATTCTTTTTGGG + Intergenic
982898321 4:160963378-160963400 CTTTTCTTCCAATCCTTTCTAGG + Intergenic
983078186 4:163351529-163351551 GTCTTAATCCAATTCTATATGGG + Exonic
983786251 4:171733235-171733257 TTATTATTCCAGAGCTTTATTGG - Intergenic
984057769 4:174950229-174950251 CTCTCAATCCCATTCTTTATAGG + Intronic
984100961 4:175485115-175485137 CTACTAGTCCACTTCTTTTTTGG - Intergenic
986152796 5:5142708-5142730 CTATTATTGCAAATCATTCTTGG + Intronic
986771972 5:10982494-10982516 CTATTAGCCCACTTCCTTATGGG + Intronic
987527729 5:19075045-19075067 GTCTTATTCCAGTTCTTAATGGG - Intergenic
988436901 5:31186800-31186822 CTATTATTCCAAATCCATAATGG + Intergenic
988651391 5:33155585-33155607 ATCTTATTCCAATTCTTAAGTGG - Intergenic
989393529 5:40927561-40927583 GTATTTTGCCAATTTTTTATTGG - Intronic
989401287 5:41010380-41010402 CTATGATTGATATTCTTTATTGG - Intronic
989452355 5:41601614-41601636 CTATTATATGAATTCTTCATAGG - Intergenic
989774722 5:45190708-45190730 CTTGGATTCCAATTCTTTTTTGG + Intergenic
991473644 5:66996938-66996960 CTGTAATTCTAATTCTTTACTGG + Intronic
992521859 5:77561514-77561536 CTATTATTAGAAATCTTCATTGG + Intronic
992664660 5:78995354-78995376 CTACTATTCTAATTCATTAGTGG + Intergenic
993859957 5:93124228-93124250 CTTTTATTCTAATTCTTTATAGG + Intergenic
994008954 5:94877496-94877518 CTATTGTCCCAATCCTTTTTTGG + Intronic
994213096 5:97108019-97108041 CTATTATTCCCATTTTATAGAGG - Intronic
994872951 5:105377512-105377534 CTATTATGCCATGTCTTTAATGG + Intergenic
995580287 5:113592596-113592618 TTATTAGTCCAATTTTATATAGG + Intronic
996000357 5:118354472-118354494 CTAATATTCCATTTCTTATTAGG + Intergenic
997057785 5:130465511-130465533 GTAATATTCTATTTCTTTATAGG - Intergenic
998607677 5:143651793-143651815 ATATTATTCCATTTTTATATAGG - Intergenic
998970578 5:147586972-147586994 CTATTATTCCATTTCAGAATGGG - Intronic
999006144 5:147981657-147981679 CTATTTATCCATTTATTTATCGG + Intergenic
1000682766 5:164206640-164206662 TTATTATGCAAATTCTTAATAGG + Intergenic
1003935600 6:10972345-10972367 CATTTAATCCAATTCTCTATTGG - Intronic
1004818115 6:19334483-19334505 CTAGTAATCAAATTTTTTATTGG - Intergenic
1005384189 6:25269633-25269655 CTGTTTTTCCTTTTCTTTATGGG + Intergenic
1007550236 6:42723578-42723600 CTATTTTTCCAGTTGATTATTGG - Intergenic
1008103738 6:47420904-47420926 CTGGTATTTCAATTCTTTACTGG - Intergenic
1008175611 6:48264635-48264657 TTATTATTTCAATACTTTTTTGG - Intergenic
1008684083 6:53904831-53904853 TTATAATTCCAATTGCTTATGGG - Intronic
1008779159 6:55081342-55081364 CTATTGGTCTAATTATTTATTGG - Intergenic
1009649723 6:66459641-66459663 ATATTGATCCAATTATTTATTGG - Intergenic
1009779263 6:68248382-68248404 CTATTATTCAAAGTCATTATGGG - Intergenic
1012479154 6:99649132-99649154 CTATGATTCCCATTCTACATGGG - Intergenic
1012535721 6:100294529-100294551 CTGTTATTTTAATTCTTTGTTGG + Intergenic
1013916959 6:115352157-115352179 CTTTTATTCCACATCTTTATGGG - Intergenic
1014181922 6:118394130-118394152 ATATTATTTCAAATCTTTTTTGG - Intergenic
1014397016 6:120936716-120936738 CTAATCTTCCTAATCTTTATGGG + Intergenic
1014620866 6:123665524-123665546 CTATTAATGGAATTATTTATTGG - Intergenic
1016829894 6:148423956-148423978 CTATAATTCCACTACTTGATTGG - Intronic
1022271226 7:28809750-28809772 TTATTATTCCCATTCTGTAGAGG - Intronic
1022819433 7:33944843-33944865 CTACTATGCTCATTCTTTATGGG + Intronic
1023426008 7:40037026-40037048 ATTTTATTCCATTTATTTATTGG + Intronic
1024182905 7:46915539-46915561 ATATTCTTTCAATTCTTTCTGGG + Intergenic
1024535604 7:50428707-50428729 CTAAAATTCCAATTCTTCTTTGG + Intergenic
1025822702 7:64984406-64984428 GTAATATTCTAATTCTTCATCGG - Intronic
1028679024 7:93504097-93504119 CTATTATGACTATTCTTCATTGG - Intronic
1029010554 7:97257462-97257484 TTAATATTCCAATGCTTTTTGGG + Intergenic
1029664315 7:101985070-101985092 TCATAATTTCAATTCTTTATTGG - Intronic
1031258530 7:119486927-119486949 CCATTCTTCTAATTCTTAATAGG - Intergenic
1032648314 7:133850534-133850556 CTAATATTCCATTTCTCTTTGGG + Intronic
1033522044 7:142170357-142170379 CTATTTTTCCCATGCTTTAATGG + Intronic
1033895070 7:146058604-146058626 CTATGATTGCAATGCATTATGGG - Intergenic
1034127704 7:148688642-148688664 GGATTATTCCAAGTTTTTATTGG - Intergenic
1036835961 8:12067238-12067260 GAACTATTCCAATTTTTTATAGG + Intronic
1036857804 8:12313808-12313830 GAACTATTCCAATTTTTTATAGG + Intergenic
1038231401 8:25703993-25704015 CTTTCCTTTCAATTCTTTATTGG - Intergenic
1038388485 8:27172571-27172593 CTGATTTTCCAATTCTTCATAGG + Intergenic
1038972450 8:32651268-32651290 CTTTCATTCCAATTCTGCATTGG - Intronic
1041094654 8:54337539-54337561 CTATTTTTACAATTTTTTAGAGG - Intergenic
1043691642 8:83160637-83160659 CTATTATTTCATTTTTTTAATGG + Intergenic
1045187483 8:99853783-99853805 GTATTCTTCCAACTCTTTGTTGG - Exonic
1045521179 8:102904615-102904637 CTTTTATTTCCATTCTTTCTTGG + Intronic
1047945817 8:129878234-129878256 CTTTTATTCCATTTCTATAAAGG - Intronic
1048607860 8:135988542-135988564 TTATTATTCCCATTTTTTAAAGG - Intergenic
1050864878 9:10486211-10486233 CTTTTGTTCCAATTGTTTCTGGG + Intronic
1050966787 9:11814386-11814408 TAATTCTTCCAATTCATTATTGG + Intergenic
1051154750 9:14129014-14129036 TTATTTTTTCAATTCTTTTTTGG + Intronic
1051319335 9:15883843-15883865 TTATTATTCCTTTTCTTAATAGG + Intronic
1051807268 9:21008863-21008885 CTATTTTTGCAATTTCTTATGGG + Intronic
1052128973 9:24817292-24817314 GTTATATTCCAAGTCTTTATTGG + Intergenic
1054832393 9:69640857-69640879 CAATTATTTCAATTCAATATTGG + Intronic
1055993884 9:82136343-82136365 CAATTTTTCCACTTTTTTATTGG - Intergenic
1056039154 9:82643165-82643187 CTATTAGTCCAGTTTTTAATGGG - Intergenic
1056910928 9:90699925-90699947 CAATTATTCCATTTGTTTACTGG - Intergenic
1057793134 9:98137333-98137355 CTATTATGCCCATTTTATATGGG + Intronic
1058576176 9:106404775-106404797 TTATTTTTCCCATTTTTTATTGG - Intergenic
1060652813 9:125344681-125344703 CTATTATCCCAGCTCTTTTTGGG + Intronic
1185735695 X:2494008-2494030 CTATTATTACTATTGTTTTTAGG + Intronic
1186440537 X:9581948-9581970 CTTTTATTCCATTTCTTTGCAGG + Intronic
1188126123 X:26371766-26371788 GTATTATTTAAAATCTTTATAGG + Intergenic
1188184098 X:27092297-27092319 CTATTAATTTAATTCTTAATTGG - Intergenic
1188290797 X:28385948-28385970 TTATTTTTCCAAATCTGTATTGG - Intergenic
1189092194 X:38096031-38096053 CCTTTATTTCAATTCTTTTTAGG - Intronic
1189528407 X:41851725-41851747 ATATTATTCCAATTTAATATTGG + Intronic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1189717032 X:43877660-43877682 CTATTATTCCAATTCTGATCTGG - Intronic
1190893185 X:54589318-54589340 CTATTTTTCCATCTGTTTATAGG - Intergenic
1193737405 X:85175314-85175336 ATATGGTTTCAATTCTTTATAGG - Intergenic
1194939992 X:99998055-99998077 CTATCATTCCTGTTCTTTACAGG + Intergenic
1195151650 X:102077324-102077346 CTGTCAGTCCAATTCTATATTGG + Intergenic
1197923678 X:131623797-131623819 TTATTATTCCAAGACTTTTTGGG - Intergenic
1198003541 X:132466672-132466694 GTAGTATGCCATTTCTTTATGGG + Intronic
1198299448 X:135320785-135320807 CAATTCTTCCAATGCATTATGGG + Intronic
1198990326 X:142506677-142506699 CTACTTCTCCAATTTTTTATCGG + Intergenic
1199374691 X:147093793-147093815 ATATTCTTCCAATTCTATAAAGG - Intergenic
1199652296 X:149958466-149958488 TTATTATTTCAATTGTTTTTTGG + Intergenic
1200881675 Y:8219606-8219628 GTTTTATTCCAATTCATTAAAGG + Intergenic