ID: 1091045317

View in Genome Browser
Species Human (GRCh38)
Location 11:132319838-132319860
Sequence GCCTCCCGTTAGGCTACTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 934
Summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 892}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091045317_1091045322 -9 Left 1091045317 11:132319838-132319860 CCCCGAGTAGCCTAACGGGAGGC 0: 1
1: 0
2: 7
3: 34
4: 892
Right 1091045322 11:132319852-132319874 ACGGGAGGCACCCCCCAGTAGGG 0: 1
1: 32
2: 1203
3: 2786
4: 1971
1091045317_1091045329 16 Left 1091045317 11:132319838-132319860 CCCCGAGTAGCCTAACGGGAGGC 0: 1
1: 0
2: 7
3: 34
4: 892
Right 1091045329 11:132319877-132319899 AGACTGACACCTCACACAGCCGG 0: 240
1: 1110
2: 2392
3: 1067
4: 718
1091045317_1091045323 -8 Left 1091045317 11:132319838-132319860 CCCCGAGTAGCCTAACGGGAGGC 0: 1
1: 0
2: 7
3: 34
4: 892
Right 1091045323 11:132319853-132319875 CGGGAGGCACCCCCCAGTAGGGG 0: 6
1: 1182
2: 2720
3: 1853
4: 1526
1091045317_1091045321 -10 Left 1091045317 11:132319838-132319860 CCCCGAGTAGCCTAACGGGAGGC 0: 1
1: 0
2: 7
3: 34
4: 892
Right 1091045321 11:132319851-132319873 AACGGGAGGCACCCCCCAGTAGG 0: 1
1: 32
2: 1178
3: 2793
4: 1981
1091045317_1091045330 17 Left 1091045317 11:132319838-132319860 CCCCGAGTAGCCTAACGGGAGGC 0: 1
1: 0
2: 7
3: 34
4: 892
Right 1091045330 11:132319878-132319900 GACTGACACCTCACACAGCCGGG 0: 284
1: 1317
2: 1765
3: 2330
4: 1168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091045317 Original CRISPR GCCTCCCGTTAGGCTACTCG GGG (reversed) Intronic
900699955 1:4040653-4040675 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
901224477 1:7605105-7605127 CCTCCCAGTTAGGCTACTCGGGG + Intronic
901970760 1:12905827-12905849 CCTCCCAGTTAGGCTACTCGGGG - Intronic
902014405 1:13295943-13295965 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
904878230 1:33672682-33672704 CCTCCCAGTTAGGCTACTCGGGG - Intronic
904898416 1:33836284-33836306 CCTCCCAGTTAGGCTACTCGGGG + Intronic
905962907 1:42059948-42059970 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
906589125 1:47007147-47007169 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
906878752 1:49566719-49566741 CCTCCCAGTTAGGCTACTCGGGG + Intronic
907231730 1:53005340-53005362 TCTCCCAGTTAGGCTACTCGGGG - Intronic
907436009 1:54448689-54448711 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
908215148 1:61943804-61943826 CCTCCCAGTTAGGCTACTCGGGG - Intronic
908294976 1:62704816-62704838 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
908638037 1:66190255-66190277 CCTCCCAGTTAGGCTACTCGGGG + Intronic
909307246 1:74096969-74096991 CCTCCCAGTTAGGCTACTCGGGG + Intronic
909326040 1:74352389-74352411 CCTCCCAGTTAGGCTACTCGGGG + Intronic
909682720 1:78310732-78310754 TCTCCCAGTTAGGCTACTCGGGG - Intronic
909770430 1:79414861-79414883 TCTACCAGTTAGGCTACTCGGGG - Intergenic
910381677 1:86633376-86633398 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
910572220 1:88718247-88718269 TCTCCCAGTTAGGCTACTCGGGG + Intronic
910612011 1:89154919-89154941 CCTCCCAGTTAGGCTACTCGGGG - Intronic
910709810 1:90167548-90167570 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
910949925 1:92635101-92635123 CCTCCCAGTTAGGCTACTCGGGG + Intronic
911074163 1:93856442-93856464 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
911106344 1:94134821-94134843 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
911867830 1:103051022-103051044 CCTCCCAGTTAGGCTACTCGGGG + Intronic
911891519 1:103377915-103377937 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
912751144 1:112288698-112288720 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
912973325 1:114304696-114304718 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
913258367 1:116975444-116975466 CCTCCCAGTTAGGCTACTCGGGG - Intronic
913394309 1:118349469-118349491 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
913418567 1:118638458-118638480 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
913434458 1:118832145-118832167 CCCCCCAGTTAGGCTGCTCGGGG - Intergenic
914997051 1:152553209-152553231 CCTCCCAGTTAGGCTACTCGGGG + Intronic
915011559 1:152691610-152691632 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
915644095 1:157254645-157254667 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
915763283 1:158336790-158336812 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
916251912 1:162746688-162746710 TCTCCCAGTTAGGCTACTCGGGG - Intronic
916351396 1:163853820-163853842 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
916373539 1:164126377-164126399 GTCTCCCATTAGGCTACTTGGGG + Intergenic
916596768 1:166251495-166251517 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
917893692 1:179465543-179465565 TCTCCCAGTTAGGCTACTCGGGG + Intronic
918351333 1:183658781-183658803 CCTCCCAGTTAGGCTACTCGGGG - Intronic
918408495 1:184234676-184234698 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
918554587 1:185783766-185783788 CCTCCCAGTTAGGCTACTCGGGG + Intronic
919065445 1:192688148-192688170 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
920781137 1:208992141-208992163 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
920955423 1:210615858-210615880 CCTCCCAGTTAGGCTACTCGGGG + Intronic
920995585 1:210987704-210987726 CCTCCCAGTTAGGCTACTCGGGG + Intronic
921243762 1:213214596-213214618 CCTCCCAGTTAGGCTACTCGGGG - Intronic
921455408 1:215365372-215365394 TCTTCCAGTTAGGCTACTCGGGG + Intergenic
921469651 1:215532919-215532941 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
921993041 1:221388482-221388504 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
922374338 1:224945910-224945932 CCTCCCAGTTAGGCTACTCGGGG + Intronic
922552289 1:226504703-226504725 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
924130324 1:240900715-240900737 CCTCCCAGTTAGGCTACTCGGGG + Intronic
924411244 1:243807753-243807775 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1062913085 10:1226832-1226854 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1064431123 10:15270596-15270618 TCTCCCAGTTAGGCTACTCGGGG - Intronic
1064905270 10:20339267-20339289 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1064924609 10:20556109-20556131 CCCCCCTGTTAGGCTGCTCGGGG - Intergenic
1065157622 10:22886357-22886379 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1065274039 10:24067564-24067586 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1066168598 10:32816556-32816578 CCTCCCAGTTAGGCTACTCGAGG - Intronic
1066274244 10:33853167-33853189 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1066582670 10:36898349-36898371 CCTACCAGTTAGGCTACTCGGGG + Intergenic
1066584132 10:36913459-36913481 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1066603708 10:37137948-37137970 CCTCCCAGTTAGGCTACTCGAGG - Intronic
1066806426 10:39260000-39260022 CCTTCCAGTTAGGCTACTCAGGG - Intergenic
1067845378 10:49715632-49715654 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1067903158 10:50263101-50263123 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1069110599 10:64441789-64441811 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1069256288 10:66335651-66335673 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1069355861 10:67584489-67584511 TCTCCCAGTTAGGCTACTCGCGG + Intronic
1070061739 10:72990236-72990258 GTCCCCAGTTAGGCTACACGGGG - Intergenic
1070064737 10:73022204-73022226 TCCCCCAGTTAGGCTACACGGGG - Intronic
1070474125 10:76815423-76815445 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1071373019 10:84972656-84972678 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1071663546 10:87530624-87530646 CCCCCCAGTTAGGCTACTTGGGG + Intronic
1071748078 10:88444041-88444063 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1071825030 10:89316795-89316817 CCTTCCAGTTAGGCTACTCAGGG - Intronic
1071884675 10:89936945-89936967 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1071999149 10:91177327-91177349 CCTTCCAGTTAGGCTACTCGGGG + Intronic
1072298719 10:94038277-94038299 GCCACCAGTTAGTCTAGTCGTGG - Intronic
1072311939 10:94165057-94165079 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1072361353 10:94662988-94663010 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1072869261 10:99099712-99099734 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1074030867 10:109686987-109687009 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1074696815 10:116057275-116057297 GCCTCCAGTTAGGCTTCGGGCGG - Intronic
1076666019 10:132093190-132093212 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1076938314 10:133581268-133581290 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1077450409 11:2639633-2639655 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1077591801 11:3498325-3498347 GCCTCCAGTTAGGAAACTCGGGG + Intergenic
1077741827 11:4854782-4854804 TCTCCCAGTTAGGCTACTCGAGG - Intronic
1077771227 11:5221401-5221423 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1078119367 11:8490632-8490654 GTCTCCAGTTAGGCTACACAGGG - Intronic
1078166446 11:8889962-8889984 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1078419843 11:11201273-11201295 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1078557307 11:12339867-12339889 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1078674734 11:13399968-13399990 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1078726714 11:13938786-13938808 CCTTCCAGTTAGGCTACTCGGGG + Intergenic
1078812140 11:14778385-14778407 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1078951743 11:16142073-16142095 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1079342499 11:19624189-19624211 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1079682994 11:23321672-23321694 GCTCCCAGTTAGGCTACTTGAGG - Intergenic
1079873803 11:25831994-25832016 CCCCCCAGTTAGGCTACTCGGGG - Intergenic
1079981679 11:27157673-27157695 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1080150957 11:29051435-29051457 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1080209637 11:29771096-29771118 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1080253981 11:30268557-30268579 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1080378419 11:31741466-31741488 TCTCCCAGTTAGGCTACTCGGGG - Intronic
1080816210 11:35759917-35759939 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1081086838 11:38811883-38811905 CCCCCCAGTTAGGCTACTCGGGG - Intergenic
1081087624 11:38821700-38821722 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1081377554 11:42377525-42377547 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1081389755 11:42515352-42515374 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1081433743 11:43004790-43004812 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1082103138 11:48191165-48191187 CCTTCCAGTTAGGCTACTTGGGG + Intergenic
1082125535 11:48427522-48427544 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1082136444 11:48554814-48554836 ACCCCCAGTTAGGCTACTCGGGG + Intergenic
1082141721 11:48617177-48617199 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1082150646 11:48734693-48734715 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1082568881 11:54713983-54714005 CCTCCCAGTTAGGCTACTCGAGG + Intergenic
1082599630 11:55133420-55133442 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1082647649 11:55748138-55748160 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1082970559 11:59015950-59015972 CCTTCCAGTTAGGCTGCTCGGGG - Intronic
1083006237 11:59349587-59349609 CCTCCCAGTTAGGCTACTCGAGG + Intergenic
1083124533 11:60551075-60551097 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1083165307 11:60881461-60881483 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1083509360 11:63193352-63193374 TCTCCCAGTTAGGCTACTCGGGG - Intronic
1084247642 11:67871060-67871082 GCCTCCAGTTAGGCAACTCTGGG + Intergenic
1084825182 11:71724433-71724455 GCCTCCAGTTAGGCAACTCGGGG - Intergenic
1085222659 11:74888142-74888164 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1085248035 11:75119997-75120019 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1085495450 11:76964533-76964555 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1086142797 11:83517942-83517964 ACTCCCAGTTAGGCTACTCGGGG + Intronic
1086529154 11:87763810-87763832 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1086567300 11:88241196-88241218 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1086586922 11:88463266-88463288 CCTCCCAGTTAGGCTACTCGAGG + Intergenic
1087089027 11:94248753-94248775 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1087504021 11:98997148-98997170 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1087580093 11:100040390-100040412 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1087878883 11:103391918-103391940 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1088790829 11:113224653-113224675 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1089101696 11:115967645-115967667 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1089888538 11:121855605-121855627 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1090308851 11:125716925-125716947 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1090946967 11:131439237-131439259 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1091045317 11:132319838-132319860 GCCTCCCGTTAGGCTACTCGGGG - Intronic
1091706912 12:2700208-2700230 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1092417920 12:8306456-8306478 GCCTCCAGTTAGGCAACTCAGGG + Intergenic
1093344532 12:18024519-18024541 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1093609536 12:21137252-21137274 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1094387478 12:29910606-29910628 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1094561200 12:31555475-31555497 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1094803498 12:34065686-34065708 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1094805246 12:34083947-34083969 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1095306266 12:40642627-40642649 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1095424830 12:42063690-42063712 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1095483374 12:42658789-42658811 CCTTCCAGTTAGGCTACTTGGGG + Intergenic
1095490141 12:42725231-42725253 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1095854869 12:46849272-46849294 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1096895513 12:54817995-54818017 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1096902685 12:54901118-54901140 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1096926789 12:55156866-55156888 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1096954312 12:55510123-55510145 CCTCCCAGTTAGGCTACTCGAGG + Intergenic
1096957908 12:55545801-55545823 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1097561271 12:61209012-61209034 GCTCCCAGTTAGGCTACTCGGGG + Intergenic
1097569699 12:61317438-61317460 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1097701055 12:62820459-62820481 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1097734556 12:63167676-63167698 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1098015483 12:66100151-66100173 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1098375594 12:69810319-69810341 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1098642582 12:72856852-72856874 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1098699487 12:73606411-73606433 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1098722872 12:73924851-73924873 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1099114650 12:78609188-78609210 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1099677914 12:85786119-85786141 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1099764935 12:86971097-86971119 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1099965573 12:89441334-89441356 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1100742424 12:97608644-97608666 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1101029017 12:100642240-100642262 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1101242962 12:102856553-102856575 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1101401707 12:104393979-104394001 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1101636887 12:106551339-106551361 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1101768184 12:107722823-107722845 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1102440307 12:112958766-112958788 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1102880717 12:116482598-116482620 GCCTCCCCTTAGTCTCCGCGGGG + Intergenic
1104403473 12:128497253-128497275 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1104472630 12:129042966-129042988 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1104474624 12:129061326-129061348 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1104557014 12:129809737-129809759 GCCTCCAGTTAGCCTAATCTAGG + Intronic
1105072778 12:133245645-133245667 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1105283545 13:18984442-18984464 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1105311813 13:19218987-19219009 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1105351119 13:19617160-19617182 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1105420065 13:20243985-20244007 CCTTCCAGTTAGGCTACTCGGGG - Intergenic
1105648455 13:22346789-22346811 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1105992657 13:25637827-25637849 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1106445726 13:29829110-29829132 GCCTCCCAGTAGGCTACTAGGGG + Intronic
1106640904 13:31583911-31583933 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1106737935 13:32607481-32607503 GTCTCCAGTTAGGCTACTCGGGG + Intronic
1106991638 13:35427554-35427576 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1107090449 13:36473707-36473729 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1107380653 13:39853698-39853720 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1107558520 13:41540166-41540188 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1108308522 13:49163061-49163083 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1108547940 13:51515121-51515143 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1108553288 13:51567732-51567754 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1109566352 13:64120913-64120935 GCTCCCAGTTAGGCTACTCGGGG + Intergenic
1109669474 13:65585856-65585878 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1110510334 13:76342991-76343013 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1111680737 13:91438582-91438604 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1111967075 13:94871485-94871507 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1113276876 13:108740556-108740578 CCTCCCAGTTAGGCTACTCGAGG + Intronic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1114171889 14:20280752-20280774 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1114240321 14:20860818-20860840 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1114394958 14:22349627-22349649 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1114581237 14:23762132-23762154 ACTTCCAGTTAGGCTACTTGGGG + Intergenic
1114681943 14:24492133-24492155 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1114796502 14:25720983-25721005 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1114807709 14:25857277-25857299 CCTCCCAGTTAGGCTACTCGCGG + Intergenic
1115077999 14:29414451-29414473 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1115107249 14:29775865-29775887 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1115412241 14:33088745-33088767 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1115743534 14:36412418-36412440 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1115827522 14:37294029-37294051 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1115869684 14:37786047-37786069 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1115954679 14:38764730-38764752 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1116011653 14:39358973-39358995 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1116198281 14:41757178-41757200 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1116546023 14:46166556-46166578 CCCCCCAGTTAGGCTACTCGGGG + Intergenic
1116684398 14:48019139-48019161 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1116704992 14:48285127-48285149 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1116727187 14:48575680-48575702 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1116736456 14:48697862-48697884 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1117104593 14:52384882-52384904 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1117260966 14:54033123-54033145 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1117349942 14:54871068-54871090 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1117797625 14:59410156-59410178 CCTCCCAGTTAGGCTACTCGTGG - Intergenic
1117891495 14:60426899-60426921 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1118146608 14:63144404-63144426 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1118415160 14:65527970-65527992 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1118958175 14:70502019-70502041 GCTCCCAGATAGGCTACTCGGGG - Intergenic
1119097572 14:71848263-71848285 CCTTCCAGTTAGGCTGCTCGGGG + Intergenic
1119156305 14:72414974-72414996 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1119699679 14:76744984-76745006 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1120478865 14:85023775-85023797 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1120606947 14:86591217-86591239 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1120778212 14:88461130-88461152 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1123127748 14:105961541-105961563 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1202916070 14_GL000194v1_random:173859-173881 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1123877566 15:24639353-24639375 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1124257826 15:28160154-28160176 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1125055656 15:35356704-35356726 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1125330960 15:38581420-38581442 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1126542453 15:49838642-49838664 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1126722059 15:51591649-51591671 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1126996419 15:54450192-54450214 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1127016968 15:54699525-54699547 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1127057199 15:55143885-55143907 CCTGCCAGTTAGGCTACTCGGGG - Intergenic
1127189551 15:56515337-56515359 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1127971140 15:63962772-63962794 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1128677483 15:69622441-69622463 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1128854114 15:70992804-70992826 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1128895802 15:71372698-71372720 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1129548761 15:76426034-76426056 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1129564578 15:76608438-76608460 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1129581785 15:76819306-76819328 GCTCCCAGTTAGGCTACTTGGGG - Intronic
1129796471 15:78381372-78381394 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1130450162 15:84043109-84043131 CCTACCAGTTAGGCTACTCGGGG - Intergenic
1130572237 15:85057231-85057253 TCTTCCAGTTAGGCTACTTGGGG + Intronic
1130810962 15:87377934-87377956 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1132189101 15:99833375-99833397 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1132889898 16:2198418-2198440 ACCTCCCCTTAGGTTACTGGAGG + Intergenic
1133432461 16:5750288-5750310 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1134075355 16:11287136-11287158 GTCTCCCTTTAGGCTCCTCTGGG + Intronic
1134879621 16:17733858-17733880 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1134898015 16:17907116-17907138 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1136550310 16:30979369-30979391 GCCTCCCGCAAGGCTCCCCGGGG + Exonic
1136600509 16:31284149-31284171 CCCCCCAGTTAGGCTACTTGGGG + Intronic
1136930744 16:34416114-34416136 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1136973829 16:34995694-34995716 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1136991951 16:35158095-35158117 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1137007181 16:35287896-35287918 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1137360782 16:47813394-47813416 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1137437213 16:48465643-48465665 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1137680923 16:50343982-50344004 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1137907109 16:52334112-52334134 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1138692846 16:58785293-58785315 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1138712221 16:58982800-58982822 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1138713165 16:58992677-58992699 TCTCCCAGTTAGGCTACTCGAGG + Intergenic
1138722383 16:59097124-59097146 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1138734092 16:59230355-59230377 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1138762780 16:59564585-59564607 CCTTCCAGTTAGGCTGCTCGGGG + Intergenic
1138842230 16:60523470-60523492 CCTTCCAGTTAGGCTGCTCGGGG - Intergenic
1140179051 16:72695800-72695822 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1140991855 16:80220406-80220428 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1141235112 16:82209182-82209204 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1142412373 16:89923255-89923277 GCCTCCCGATTGGCCACCCGCGG + Intronic
1142538647 17:639821-639843 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1143422698 17:6807889-6807911 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1144448622 17:15355385-15355407 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1146561966 17:33877828-33877850 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1147902449 17:43797914-43797936 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1153090391 18:1335894-1335916 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1153402419 18:4695369-4695391 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1153419919 18:4893495-4893517 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1153541886 18:6164400-6164422 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1153858067 18:9171125-9171147 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1153865579 18:9265345-9265367 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1154364121 18:13690473-13690495 TCTCCCAGTTAGGCTACTCGGGG - Intronic
1154413984 18:14163359-14163381 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1155020060 18:21888367-21888389 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1156295992 18:35791316-35791338 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1156433482 18:37100740-37100762 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1156434510 18:37112241-37112263 TCTCCCAGTTAGGCTACTCGGGG - Intronic
1157061828 18:44300578-44300600 TCTCCCAGTTAGGCTACTCGAGG - Intergenic
1157123379 18:44933373-44933395 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1157355322 18:46928505-46928527 CCTGCCAGTTAGGCTACTCGGGG + Intronic
1158054275 18:53260624-53260646 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1158100226 18:53821605-53821627 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1159570330 18:70104919-70104941 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1159627838 18:70715012-70715034 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1159810926 18:73017140-73017162 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1160285350 18:77537572-77537594 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1163881106 19:19923359-19923381 CCTTCCAGTTAGGCTACTCAGGG + Intronic
1164111199 19:22160948-22160970 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1164236016 19:23335246-23335268 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1164307604 19:24018756-24018778 GCCTCCCAGTAGGCTACTCGGGG + Intergenic
1164420587 19:28088354-28088376 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1164542790 19:29133293-29133315 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1165287893 19:34858078-34858100 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1165980586 19:39719365-39719387 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1166171901 19:41033768-41033790 CCTTCCAGTTAGGCTACTCAGGG - Intergenic
1168437928 19:56337004-56337026 CCTCCCAGTTAGGCTACTCGGGG + Intronic
925327076 2:3031252-3031274 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
927235676 2:20872237-20872259 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
927239724 2:20910888-20910910 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
927283942 2:21336643-21336665 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
927463764 2:23321864-23321886 GCCTGCCGTGAGGCTCCTCAAGG + Intergenic
927634762 2:24805746-24805768 CCTCCCAGTTAGGCTACTCGGGG + Intronic
928487712 2:31749230-31749252 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
928837805 2:35568476-35568498 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
930150858 2:48058313-48058335 CCTTCCAGTTAGGCTACTCAGGG + Intergenic
930289914 2:49481056-49481078 CCCCCCAGTGAGGCTACTCGGGG - Intergenic
930893756 2:56421749-56421771 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
930922755 2:56777269-56777291 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
931491641 2:62754413-62754435 CCTCCCAGTTAGGCTACTCGGGG + Intronic
931530721 2:63211176-63211198 CCTCCCAGTTAGGCTACTCGGGG - Intronic
932019125 2:68064461-68064483 TCTCCCAGTTAGGCTACTCGGGG - Intronic
932520268 2:72404428-72404450 CCTTCCAGTTAGGCTACTCGGGG - Intronic
933018562 2:77162540-77162562 CCTCCCAGTTAGGCTACTCGAGG - Intronic
933023132 2:77219926-77219948 CCTCCCAGTTAGGCTACTCGGGG - Intronic
933257551 2:80098428-80098450 CCTCCCAGTTAGGCTACTCGGGG + Intronic
933568263 2:83977100-83977122 CCCCCCAGTTAGGCTACTCGGGG - Intergenic
934550342 2:95257491-95257513 ACTCCCAGTTAGGCTACTCGGGG + Intronic
934997487 2:98978526-98978548 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
935369030 2:102325071-102325093 CCTCCCAGTTAGGCTACTCGGGG - Intronic
935421999 2:102879447-102879469 CCTCCCCGTTAGGCTGCTCGGGG + Intergenic
936762606 2:115804852-115804874 CCTCCCAGTTAGGCTACTCGGGG + Intronic
937110921 2:119366799-119366821 GCGTCCCCTTCGGCTACTCCCGG + Intronic
937186728 2:120051079-120051101 GCTCCCAGTTAGGCTACTCGGGG + Intronic
937507290 2:122551407-122551429 CCTCCCAGTTAGGCTACTCGTGG - Intergenic
937632953 2:124123623-124123645 TCTCCCAGTTAGGCTACTCGGGG - Intronic
937741305 2:125358040-125358062 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
937810744 2:126196314-126196336 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
938167448 2:129043565-129043587 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
938848137 2:135232514-135232536 CCTCCCAGTTAGGCTACTCGGGG - Intronic
938854583 2:135296998-135297020 CCTCCCAGTTAGGCTACTCGGGG + Intronic
939031053 2:137076007-137076029 CCTCCCAGTTAGGCTACTCGGGG + Intronic
939157626 2:138544154-138544176 TCTCCCAGTTAGGCTACTCGGGG + Intronic
939594292 2:144104827-144104849 CCTCCCAGTTAGGCTACTCGGGG - Intronic
939651037 2:144762244-144762266 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
939943454 2:148380691-148380713 CCTCCCAGTTAGGCTACTCGGGG - Intronic
940095212 2:149966438-149966460 CCTTCCAGTTAGGCTACTCAGGG - Intergenic
940257267 2:151744040-151744062 TCCCCCAGTTAGGCTACTCGGGG - Intergenic
940465804 2:154025114-154025136 CCTCCCAGTTAGGCTACTCGGGG + Intronic
940573613 2:155471914-155471936 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
940644394 2:156375683-156375705 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
941054096 2:160767188-160767210 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
941553110 2:166940867-166940889 CCTCCCTGTTAGGCTACTCGGGG + Intronic
941623920 2:167809705-167809727 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
941767443 2:169313632-169313654 TCTCCCAGTTAGGCTACTCGGGG + Intronic
941895782 2:170627971-170627993 CCTCCCAGTTAGGCTACTCGGGG + Intronic
942639915 2:178050069-178050091 CCTCCCAGTTAGGCTACTCGGGG - Intronic
942753621 2:179315196-179315218 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
942790670 2:179757384-179757406 CCTCCCAGTTAGGCTACTCGGGG + Intronic
942859370 2:180591030-180591052 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
943929927 2:193836290-193836312 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
943935044 2:193904582-193904604 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
944196843 2:197063038-197063060 CCTCCCAGTTAGGCTACTCGGGG - Intronic
944612957 2:201430250-201430272 TCTCCCAGTTAGGCTACTCGGGG + Intronic
944629893 2:201613271-201613293 TCTCCCAGTTAGGCTACTCGGGG - Intronic
945390728 2:209262098-209262120 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
945614994 2:212055498-212055520 CCTCCCAGTTAGGCTACTCGGGG - Intronic
945677779 2:212876400-212876422 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
945870493 2:215220961-215220983 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
946205837 2:218107989-218108011 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
946513629 2:220387649-220387671 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1170082531 20:12492307-12492329 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1170186226 20:13593915-13593937 TCTTCCAGTTAGGCTACACGGGG - Intronic
1170494569 20:16912850-16912872 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1171352350 20:24512846-24512868 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1171935197 20:31268480-31268502 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1173770485 20:45652154-45652176 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1174694548 20:52543642-52543664 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1176635422 21:9188505-9188527 CCTCCCTGTTAGGCTACTCGGGG + Intergenic
1176930188 21:14800803-14800825 CCTCCCAGTTAGGCTACTCGAGG - Intergenic
1177273198 21:18875371-18875393 CCTTCCAGTTAGGCTGCTCGGGG + Intergenic
1178044456 21:28677617-28677639 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1178345131 21:31819645-31819667 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1178903616 21:36617241-36617263 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1178965177 21:37109781-37109803 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1179301002 21:40110137-40110159 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1180317585 22:11288988-11289010 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1180414684 22:12697958-12697980 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1180506960 22:16021726-16021748 CCTTCCAGTTAGGCTGCTCGGGG - Intergenic
1180575236 22:16767079-16767101 CCTTCCAGTTAGGCTGCTCGGGG - Intergenic
1182165061 22:28164364-28164386 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1182707939 22:32299948-32299970 CCTTCCAGTTAGGCTGCTCGGGG + Intergenic
1182789869 22:32942166-32942188 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1183095491 22:35549524-35549546 CCATCCCGTTAGGCTAATCCGGG - Intronic
1184598358 22:45527768-45527790 GCCTCCCCTGAGGCCTCTCGTGG + Intronic
1203331696 22_KI270739v1_random:42-64 CCTTCCAGTTAGGCTGCTCGGGG + Intergenic
949209252 3:1478187-1478209 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
949342571 3:3045349-3045371 CCTCCCAGTTAGGCTACTCGGGG - Intronic
949816845 3:8068047-8068069 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
950597171 3:13995138-13995160 CCTCCCAGTTAGGCTACTCGGGG + Intronic
950862698 3:16164271-16164293 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
951042652 3:18005109-18005131 CCTCCCAGTTAGGCTACTCGGGG + Intronic
951672887 3:25204846-25204868 CCTGCCAGTTAGGCTACTCGGGG + Intronic
951684532 3:25329243-25329265 CCTCCCCGTTAGGCTACTCGGGG - Intronic
952118719 3:30215791-30215813 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
952290598 3:32011161-32011183 CCTCCCAGTTAGGCTACTCGGGG - Intronic
952514999 3:34094779-34094801 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
952612374 3:35226520-35226542 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
952680265 3:36083440-36083462 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
952700426 3:36321668-36321690 ACTCCCAGTTAGGCTACTCGGGG - Intergenic
952837676 3:37618383-37618405 CCTCCCAGTTAGGCTACTCGGGG + Intronic
953116227 3:39994758-39994780 CCTCCCAGTTAGGCTACTCGGGG - Intronic
953130669 3:40134603-40134625 CCTCCCAGTTAGGCTACTCGGGG - Intronic
953524780 3:43679660-43679682 CCTCCCAGTTAGGCTACTCGAGG - Intronic
954500739 3:51012045-51012067 CCTCCCAGTTAGGCTACTCGGGG + Intronic
955030285 3:55209836-55209858 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
955268993 3:57477644-57477666 CCTCCCAGTTAGGCTACTCGGGG - Intronic
955504184 3:59614547-59614569 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
955626440 3:60924278-60924300 CCTGCCAGTTAGGCTACTCGGGG - Intronic
955652495 3:61210227-61210249 CCTCCCAGTTAGGCTACTCGGGG + Intronic
955854297 3:63256289-63256311 CCTCCCAGTTAGGCTACTCGGGG - Intronic
955890599 3:63645880-63645902 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
956207349 3:66769080-66769102 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
956215418 3:66843503-66843525 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
956394514 3:68810892-68810914 CCTCCCAGTTAGGCTACTCGGGG - Intronic
956862410 3:73338285-73338307 TCGCCCAGTTAGGCTACTCGGGG + Intergenic
956866434 3:73373881-73373903 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
956926205 3:73991414-73991436 CCCCCCAGTTAGGCTACTCGGGG - Intergenic
957061857 3:75488885-75488907 CCTTCCAGTTAGGCTACTCGGGG + Intergenic
957102902 3:75850417-75850439 CCTCCCGGTTAGGCTACTCGGGG + Intergenic
957207406 3:77216001-77216023 CCTCCCAGTTAGGCTACTCGGGG + Intronic
957344627 3:78945239-78945261 CCTCCCAGTTAGGCTACTCGGGG - Intronic
957565464 3:81878831-81878853 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
958167828 3:89900113-89900135 GCCTCCAGTTAGGCTACTTTGGG - Intergenic
958175987 3:89996679-89996701 CCATCCAGTTAGGCTACTTGGGG - Intergenic
958185110 3:90110413-90110435 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
958412316 3:93832976-93832998 GCTCCCCATTAGGCTACTCGGGG - Intergenic
958978192 3:100690789-100690811 CCTCCCAGTTAGGCTACTCGGGG + Intronic
959013718 3:101109032-101109054 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
959218493 3:103483594-103483616 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
959618050 3:108370032-108370054 CCCCCCAGTTAGGCCACTCGGGG - Intronic
959725680 3:109538890-109538912 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
959823864 3:110769535-110769557 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
959949691 3:112165691-112165713 CCTCCCAGTTAGGCTACTCGGGG + Intronic
960448621 3:117778686-117778708 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
960568830 3:119165212-119165234 CCTCCCAGTTAGGCTACTCGGGG - Intronic
960612526 3:119568597-119568619 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
960732005 3:120737948-120737970 CCTCCCAGTTAGGCTACTCGGGG + Intronic
960747008 3:120901628-120901650 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
960859992 3:122142515-122142537 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
961895623 3:130165833-130165855 GCCTCCTGTTAGGCAACTCGGGG + Intergenic
961984791 3:131121408-131121430 CCTCCCAGTTAGGCTACTCGGGG + Intronic
961989456 3:131172161-131172183 GCCTCCCGATGGGCTACTACTGG - Intronic
962073309 3:132054256-132054278 CCTCCCAGTTAGGCTACTCGGGG + Intronic
962232970 3:133681920-133681942 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
962643553 3:137413184-137413206 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
962761431 3:138518402-138518424 CCTCCCAGTTAGGCTACTCGGGG - Intronic
962836713 3:139196068-139196090 TCTCCCAGTTAGGCTACTCGGGG + Intronic
962880272 3:139570763-139570785 CCTCCCAGTTAGGCTACTCGGGG + Intronic
962907574 3:139818659-139818681 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
962995395 3:140622861-140622883 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
963050678 3:141140751-141140773 TCTCCCAGTTAGGCTACTCGGGG + Intronic
963070433 3:141300961-141300983 CCTCCCAGTTAGGCTACTCGTGG + Intergenic
963340134 3:144023403-144023425 CCTCCCAGTTAGGCTACTCGGGG + Intronic
963387894 3:144620045-144620067 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
963567323 3:146946089-146946111 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
963581305 3:147129592-147129614 TCTACCAGTTAGGCTACTCGGGG + Intergenic
964243237 3:154620063-154620085 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
964500264 3:157340744-157340766 CCTTCCAGTTAGGCTACTCAGGG - Intronic
964588075 3:158329658-158329680 CCTCCCAGTTAGGCTACTCGGGG + Intronic
964715310 3:159714963-159714985 CCTCCCAGTTAGGCTACTCGGGG - Intronic
965311131 3:167130058-167130080 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
965651476 3:170938354-170938376 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
965886355 3:173451481-173451503 CCTCCCAGTTAGGCTACTCGGGG + Intronic
968272075 3:197410626-197410648 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
969005745 4:4018979-4019001 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
969187294 4:5486008-5486030 CCTCCCAGTTAGGCTACTCGGGG + Intronic
969747145 4:9081283-9081305 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
970643292 4:18090939-18090961 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
971586129 4:28407502-28407524 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
971621277 4:28856934-28856956 CCCCCCAGTTAGGCTACTCGGGG + Intergenic
971880603 4:32365848-32365870 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
972373416 4:38448213-38448235 CCTCCCAGTTAGGCTACTCGAGG + Intergenic
972677612 4:41275841-41275863 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
972821003 4:42701709-42701731 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
972898622 4:43655053-43655075 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
972917304 4:43896924-43896946 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
972984694 4:44749413-44749435 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
973559637 4:52122402-52122424 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
973569629 4:52224746-52224768 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
973591548 4:52447026-52447048 CCTCCCAGTTAGGCTACTCGTGG - Intergenic
973626019 4:52773585-52773607 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
973640734 4:52900562-52900584 CCTCCCAGTTAGGCTACTCGGGG + Intronic
973648202 4:52970737-52970759 CCTCCCAGTTAGGCTACTCGGGG - Intronic
973667584 4:53178219-53178241 CCTCCCAGTTAGGCTACTCGGGG - Intronic
973679214 4:53298665-53298687 CCTCCCAGTTAGGCTACTCGGGG - Intronic
973693574 4:53467063-53467085 CCTCCCAGTTAGGCTACTCGGGG - Intronic
974238053 4:59207165-59207187 GCTCCCAGTTAGGCTGCTCGTGG - Intergenic
974276223 4:59724176-59724198 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
974503133 4:62732244-62732266 CCTCCCAGTTAGGCTACTCGCGG + Intergenic
974723472 4:65771561-65771583 CCTCCCTGTTAGGCTACTCGGGG + Intergenic
974780410 4:66545783-66545805 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
975806473 4:78118251-78118273 CCTCCCAGTTAGGCTACTCGGGG + Intronic
976170841 4:82302967-82302989 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
976574720 4:86656646-86656668 CCTCCCAGTTAGGCTACTCGGGG + Intronic
976918553 4:90408353-90408375 CCTCCCAGTTAGGCTACTCGGGG - Intronic
976924907 4:90484797-90484819 CCTCCCAGTTAGGCTACTCGGGG + Intronic
977004221 4:91544732-91544754 CCTCCCAGTTAGGCTACTCGGGG + Intronic
977219747 4:94325211-94325233 TCTCCCAGTTAGGCTACTCGGGG + Intronic
977580919 4:98723985-98724007 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
978176203 4:105735101-105735123 CCTCCCAGTTAGGCTACTCGGGG + Intronic
978363636 4:107957393-107957415 TCTCCCAGTTAGGCTACTCGAGG - Intergenic
978412481 4:108440839-108440861 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
979074728 4:116257327-116257349 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
979236339 4:118404398-118404420 CCTCCCAGTTAGGCTACTCGCGG - Intergenic
979599730 4:122574602-122574624 GCCTCCCAGTTGGCTGCTCGGGG + Intergenic
979886160 4:126030450-126030472 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
980033756 4:127860244-127860266 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
980090361 4:128436923-128436945 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
980196062 4:129590454-129590476 TCCCCCAGTTAGGCTACTCGGGG + Intergenic
980607493 4:135111681-135111703 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
981338497 4:143593656-143593678 CCTCCCAGTTAGGCTACTCGGGG + Intronic
981501654 4:145458229-145458251 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
981556704 4:146003167-146003189 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
981687509 4:147471221-147471243 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
981958092 4:150503273-150503295 CCTCCCAGTTAGGCTACTCGGGG - Intronic
982310816 4:153983497-153983519 CCTTCCAGTTAGGCTACTCGGGG + Intergenic
982619986 4:157692202-157692224 CCTCCCAGTTAGGCTACTCGAGG - Intergenic
982820117 4:159934492-159934514 CCTCCCTGTTAGGCTACTCGGGG + Intergenic
983175788 4:164586319-164586341 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
983362449 4:166744173-166744195 TCTCCCAGTTAGGCTACTCGGGG - Intronic
983364597 4:166769609-166769631 CCTCCCAGTTAGGCTACTCGGGG + Intronic
983598746 4:169499821-169499843 CCTCCCAGTTAGGCTACTCGGGG + Intronic
984383863 4:179030657-179030679 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
985234884 4:187862185-187862207 CCTTCCAGTTAGGCTGCTCGGGG + Intergenic
985438959 4:189964451-189964473 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
987305917 5:16638030-16638052 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
987611583 5:20211461-20211483 TCTCCCAGTTAGGCTACTCGGGG - Intronic
988646521 5:33101320-33101342 CCTTCCAGTTAGGCTGCTCGGGG + Intergenic
988668208 5:33353585-33353607 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
988917787 5:35912430-35912452 CCTCCCAGTTAGGCTACTCGGGG - Intronic
989407555 5:41078702-41078724 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
989583323 5:43053822-43053844 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
989614692 5:43328303-43328325 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
989768728 5:45117243-45117265 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
989779079 5:45243256-45243278 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
989804398 5:45585946-45585968 CCTCCCAGTTAGGCTACTCGGGG + Intronic
990060177 5:51637460-51637482 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
990482214 5:56222065-56222087 CCTCCCAGTTAGGCTACTCGGGG - Intronic
990710363 5:58573501-58573523 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
990721308 5:58699396-58699418 TCCTCCAGTTAGGCTACATGGGG + Intronic
990750498 5:59010860-59010882 CCTCCCAGTTAGGCTACTCGGGG - Intronic
990944960 5:61239580-61239602 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
991052980 5:62292243-62292265 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
991086950 5:62656325-62656347 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
991103438 5:62817997-62818019 CCTCCCAGTTAGGCTACTCGCGG - Intergenic
991209512 5:64087892-64087914 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
992031765 5:72728311-72728333 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
992183596 5:74222230-74222252 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
992197036 5:74350505-74350527 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
992280982 5:75176453-75176475 CCTGCCAGTTAGGCTACTCGGGG - Intronic
992338655 5:75799607-75799629 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
992659477 5:78944699-78944721 CCTCCCTGTTAGGCTACTCGGGG + Intronic
992675369 5:79101181-79101203 CCTCCCAGTTAGGCTACTCGGGG + Intronic
992815011 5:80428176-80428198 CCTCCCAGTTAGGCTACTCGGGG - Intronic
993008773 5:82456961-82456983 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
993627083 5:90238964-90238986 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
993917608 5:93761776-93761798 CCTCCCAGTTAGGCTACTCGGGG - Intronic
994266525 5:97723199-97723221 GTGCCCAGTTAGGCTACTCGGGG + Intergenic
994281038 5:97902572-97902594 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
994424193 5:99563165-99563187 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
994528473 5:100935509-100935531 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
994565668 5:101442757-101442779 GCTCCCAGTTAGGCTACTCAGGG - Intergenic
994574060 5:101553898-101553920 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
995338540 5:111030437-111030459 CCTTCCAGTTAGGCTACTCGGGG - Intergenic
995570148 5:113471590-113471612 CCTCCCAGTTAGGCTACTCGGGG + Intronic
995749891 5:115442597-115442619 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
995905418 5:117117210-117117232 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
996114194 5:119600031-119600053 CCTCCCAGTTAGGCTACTCGGGG - Intronic
996187138 5:120491074-120491096 CCTCCCAGTTAGGCTACTCGGGG + Intronic
996609681 5:125364295-125364317 CCTCCCCGTTAGGCTGCTCGGGG + Intergenic
996674116 5:126155219-126155241 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
996937124 5:128962136-128962158 CCTCCCAGTTAGGCTACTCGGGG + Intronic
996938293 5:128973201-128973223 TCTCCCAGTTAGGCTACTCGTGG + Intronic
996956203 5:129186508-129186530 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
996964374 5:129290649-129290671 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
997084705 5:130784179-130784201 CCTACCAGTTAGGCTACTCGGGG - Intergenic
997112242 5:131087860-131087882 CCTACCAGTTAGGCTACTCGGGG - Intergenic
997117209 5:131138335-131138357 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
997137801 5:131344719-131344741 TCTCCCAGTTAGGCTACTCGGGG - Intronic
997744821 5:136289862-136289884 CCTCCCAGTTAGGCTACTCGGGG - Intronic
998541907 5:142990884-142990906 TCTCCCAGTTAGGCTACTCGGGG + Intronic
999612220 5:153382095-153382117 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1000746972 5:165045867-165045889 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1001983399 5:176052462-176052484 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1001987046 5:176083591-176083613 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1002234070 5:177791590-177791612 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1003225721 6:4203932-4203954 CCTTCCAGTTAGGCTACTCTGGG + Intergenic
1004809825 6:19247660-19247682 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1005193847 6:23259702-23259724 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1005202641 6:23364392-23364414 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1005373543 6:25158890-25158912 CCTGCCAGTTAGGCTACTCGGGG - Intergenic
1007155329 6:39737111-39737133 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1008163180 6:48103173-48103195 TCTCCCAGTTAGGCTACTCGTGG - Intergenic
1008253986 6:49275227-49275249 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1008281311 6:49599262-49599284 CCTCCCCGTTAGGCTACTTGGGG - Intergenic
1008349941 6:50478230-50478252 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1008671612 6:53774734-53774756 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1009384811 6:63075724-63075746 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1009410555 6:63361077-63361099 CCTCCCAGTTAGGCTACTCGAGG + Intergenic
1009457901 6:63878398-63878420 TCTTCCAGTTAGGCTACTCGGGG + Intronic
1009820226 6:68790508-68790530 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1010307599 6:74343208-74343230 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1010352282 6:74888696-74888718 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1010482742 6:76374847-76374869 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1010688375 6:78878212-78878234 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1010718401 6:79256731-79256753 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1010721290 6:79285378-79285400 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1010851596 6:80783739-80783761 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1010944472 6:81958451-81958473 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1011081687 6:83496367-83496389 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1011188014 6:84700044-84700066 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1011200587 6:84831848-84831870 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1011283427 6:85700184-85700206 CCTTCCAGTTAGGCTACTCAGGG + Intergenic
1011294959 6:85816644-85816666 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1011303043 6:85896392-85896414 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1011308741 6:85958327-85958349 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1011524966 6:88254302-88254324 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1012220068 6:96638460-96638482 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1012317215 6:97795341-97795363 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1012844760 6:104375313-104375335 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1012941054 6:105415697-105415719 TCTCCCTGTTAGGCTACTCGGGG - Intergenic
1013517873 6:110905001-110905023 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1013874325 6:114805330-114805352 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1013906214 6:115222787-115222809 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1013907160 6:115233809-115233831 GCCTCCTGTTAGGGTATTCTTGG + Intergenic
1014128436 6:117804373-117804395 ACTCCCAGTTAGGCTACTCGGGG + Intergenic
1014345809 6:120268160-120268182 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1014357741 6:120433288-120433310 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1014424318 6:121285708-121285730 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1016875811 6:148863925-148863947 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1017226593 6:152028864-152028886 GTGCCCAGTTAGGCTACTCGGGG - Intronic
1018011187 6:159671313-159671335 CCTCCCAGTTAGGCTACTCGGGG - Exonic
1018114019 6:160565242-160565264 TCCCCCAGTTAGGCTACTCGGGG - Intronic
1018175743 6:161178072-161178094 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1018213741 6:161506924-161506946 GCCTCCTGTGAGGCTGCTCCTGG - Intronic
1020326308 7:6977281-6977303 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1020600683 7:10270922-10270944 GCCTCCCAGTAGGCTACTCGGGG - Intergenic
1020640477 7:10747773-10747795 TCTTCCAGTTAGGCTACTTGGGG - Intergenic
1021156416 7:17215919-17215941 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1021186469 7:17570959-17570981 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1021374472 7:19889386-19889408 CCTCCCAGTTAGGCTACTCGAGG + Intergenic
1021744204 7:23722508-23722530 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1022406807 7:30098247-30098269 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1022619144 7:31964676-31964698 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1022880009 7:34576504-34576526 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1022986960 7:35665039-35665061 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1022994861 7:35744613-35744635 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1023419769 7:39967033-39967055 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1023511036 7:40953873-40953895 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1024016050 7:45315988-45316010 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1024380037 7:48685649-48685671 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1024460079 7:49650443-49650465 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1024901515 7:54323546-54323568 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1025034169 7:55582616-55582638 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1025593902 7:62900564-62900586 CCTTCCAGTTAGGCTACTTGGGG - Intergenic
1025609069 7:63060935-63060957 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1027330701 7:77089960-77089982 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1027871780 7:83716808-83716830 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1028159113 7:87465620-87465642 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1028211333 7:88078063-88078085 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1028395473 7:90364553-90364575 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1028395981 7:90369227-90369249 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1028446388 7:90928644-90928666 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1028630000 7:92924657-92924679 TCTCCCAGTTAGGCTACTCGAGG + Intergenic
1028643795 7:93073233-93073255 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1029124888 7:98288917-98288939 GCCTCCCTCTAGCCTACTCAGGG - Intronic
1029785062 7:102781380-102781402 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1029979514 7:104864812-104864834 GCCCCCAGTTAGGCTACTTGGGG - Intronic
1030220978 7:107098938-107098960 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1030392315 7:108942958-108942980 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1030997087 7:116371955-116371977 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1031435199 7:121724756-121724778 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1032603638 7:133326629-133326651 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1032686548 7:134239769-134239791 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1032764403 7:134976679-134976701 TCTCCCAGTTAGGCTACTCGAGG - Intergenic
1033231058 7:139597649-139597671 GCCTCCCATGAGGCTCCACGAGG - Intronic
1034379579 7:150679062-150679084 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1035533227 8:371992-372014 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1035639444 8:1173301-1173323 GCCTCCAGTTAGGCTGCTCAGGG + Intergenic
1036370317 8:8156654-8156676 GCCTCCAGTTAGGCAACTCGGGG - Intergenic
1036536253 8:9655462-9655484 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1036880575 8:12508977-12508999 GCCTCCAGTTAGGCAACTCGGGG + Intergenic
1037183379 8:16033208-16033230 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1037249855 8:16878988-16879010 TCTCCCAGTTAGGCTACTCGAGG - Intergenic
1037545388 8:19915423-19915445 GGCTCCAGGTAGGCTACTCAGGG + Intronic
1037999457 8:23379357-23379379 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1038116290 8:24559408-24559430 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1038140552 8:24840279-24840301 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1038877418 8:31566813-31566835 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1039154611 8:34540938-34540960 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1039319543 8:36413538-36413560 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1039639582 8:39205048-39205070 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1039707389 8:40021818-40021840 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1040061983 8:43111641-43111663 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1040368516 8:46745302-46745324 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1040427393 8:47302867-47302889 CCTCCCAGTTAGGCTACTCGAGG + Intronic
1040445154 8:47485572-47485594 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1040451669 8:47554172-47554194 TCTCCCAGTTAGGCTACTCGAGG + Intronic
1040686635 8:49880540-49880562 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1040865642 8:52046756-52046778 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1040962384 8:53048566-53048588 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1040992756 8:53369711-53369733 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1041035552 8:53785959-53785981 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1041123100 8:54607465-54607487 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1041202235 8:55461194-55461216 CCTTCCAGTTAGGCTACTCCGGG - Intronic
1041302739 8:56429804-56429826 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1041338228 8:56811998-56812020 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1041388153 8:57326341-57326363 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1041518283 8:58726704-58726726 CCTCCCAGTTAGGCTACTCGAGG - Intergenic
1041771743 8:61480004-61480026 CCTCCCCGTTAGGCTACTCAGGG + Intronic
1041842979 8:62293658-62293680 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1042016790 8:64322143-64322165 ACTCCCAGTTAGGCTACTCGGGG + Intergenic
1042204874 8:66318511-66318533 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1042534421 8:69844004-69844026 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1042630359 8:70809015-70809037 CCTACCAGTTAGGCTACTCGAGG - Intergenic
1042638548 8:70906050-70906072 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1042720404 8:71820966-71820988 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1042731406 8:71939267-71939289 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1042763098 8:72291750-72291772 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1043200492 8:77363917-77363939 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1043480763 8:80649883-80649905 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1043870246 8:85424264-85424286 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1044042350 8:87385837-87385859 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1044178820 8:89163576-89163598 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1044254623 8:90045752-90045774 TCTCCCAGTTAGGCTACTCGGGG - Intronic
1044353799 8:91197135-91197157 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1045125693 8:99086878-99086900 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1045241142 8:100402516-100402538 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1045360321 8:101426466-101426488 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1045647072 8:104309275-104309297 TCCCCCAGTTAGGCTACCCGGGG - Intergenic
1045802442 8:106117393-106117415 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1046007650 8:108505718-108505740 CCTTGCAGTTAGGCTACTCGGGG + Intergenic
1046609862 8:116411028-116411050 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1047639659 8:126804913-126804935 CCCCCCAGTTAGGCTGCTCGGGG + Intergenic
1047845617 8:128801938-128801960 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1050083147 9:1936486-1936508 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1050329575 9:4531776-4531798 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1050370863 9:4920464-4920486 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1050381213 9:5032466-5032488 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1050500864 9:6296060-6296082 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1050787750 9:9426626-9426648 CCTTCCAGTTAGGCGACTCGGGG - Intronic
1051124880 9:13792325-13792347 TCCCCCAGTTAGGCTACACGGGG - Intergenic
1051142737 9:13995479-13995501 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1051296359 9:15600557-15600579 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1051320818 9:15903251-15903273 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1051327543 9:15989148-15989170 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1051452728 9:17215473-17215495 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1051701982 9:19833796-19833818 CCCCCCAGTTAGGCTACTCGGGG - Intergenic
1051739186 9:20235147-20235169 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1051917495 9:22225751-22225773 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1052149918 9:25102705-25102727 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1052197275 9:25732846-25732868 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1052328241 9:27240076-27240098 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1052640457 9:31160369-31160391 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1052645579 9:31229933-31229955 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1052696777 9:31888571-31888593 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1052724856 9:32217252-32217274 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1052814066 9:33086134-33086156 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1053583019 9:39426334-39426356 TCTCCCAGTTAGGCTACTCGTGG - Intergenic
1053742115 9:41150671-41150693 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1053827130 9:42036766-42036788 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1053847200 9:42251195-42251217 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1054104598 9:60985077-60985099 TCTCCCAGTTAGGCTACTCGTGG - Intergenic
1054581743 9:66921772-66921794 TCTCCCAGTTAGGCTACTCGTGG + Intronic
1054603432 9:67150666-67150688 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1054686230 9:68280629-68280651 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1055616225 9:78075673-78075695 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1055853907 9:80663605-80663627 CCTTTCAGTTAGGCTACTCGGGG + Intergenic
1055899464 9:81217864-81217886 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1057120960 9:92573521-92573543 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1057175884 9:92998894-92998916 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1058207940 9:102131523-102131545 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1058243800 9:102600276-102600298 TCCCCCAATTAGGCTACTCGGGG + Intergenic
1058305766 9:103438954-103438976 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1058750156 9:108032007-108032029 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1058795959 9:108498486-108498508 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1058943627 9:109836099-109836121 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1058962502 9:110005447-110005469 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1058988802 9:110235186-110235208 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1059005152 9:110394077-110394099 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1059616984 9:115962247-115962269 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1060130981 9:121099134-121099156 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1203758199 Un_GL000218v1:155811-155833 CCTCCCTGTTAGGCTACTCGGGG + Intergenic
1203365816 Un_KI270442v1:254723-254745 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1186914589 X:14206312-14206334 CCTCCCAGTTAGGCTACTCGAGG + Intergenic
1186956521 X:14688222-14688244 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1186992985 X:15089118-15089140 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1187130518 X:16498065-16498087 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1187374463 X:18739556-18739578 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1187595846 X:20771854-20771876 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1187848455 X:23566079-23566101 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1188017608 X:25122591-25122613 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1188036024 X:25318351-25318373 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1188272001 X:28152145-28152167 TCTCCCAGTTAGGCTACTCGGGG + Intergenic
1188289205 X:28367504-28367526 CCTCCCAGTTAGGCTACTCGAGG + Intergenic
1189199986 X:39185783-39185805 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1189603493 X:42651432-42651454 CCTCCCAGTTAGGCTACTCGTGG - Intergenic
1189832461 X:44988830-44988852 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1189970653 X:46415312-46415334 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1190209613 X:48434153-48434175 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1190593163 X:52025857-52025879 CCTCCCGGTTAGGCTACTCGGGG + Intergenic
1190603048 X:52111831-52111853 CCTGCCAGTTAGGCTACTCGGGG - Intergenic
1190720793 X:53145719-53145741 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1190800531 X:53784057-53784079 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1190840855 X:54142808-54142830 TCTCCCAGTTAGGCTACTCGGGG - Intronic
1190921676 X:54859355-54859377 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1190966085 X:55303065-55303087 CCTTCCAGTTAGGCTACTCCGGG + Intergenic
1191049617 X:56177523-56177545 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1191138307 X:57090420-57090442 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1191176014 X:57502453-57502475 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1191192829 X:57684974-57684996 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1191610215 X:63103604-63103626 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1191625496 X:63266496-63266518 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1191698853 X:64018553-64018575 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1191935512 X:66423422-66423444 CCTTCCAGTTAGGCTACTTGGGG + Intergenic
1192045152 X:67664537-67664559 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1192049264 X:67709061-67709083 TCTCCCAGTTAGGCTACTCGGGG + Intronic
1192071296 X:67943240-67943262 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1192389988 X:70716211-70716233 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1192391089 X:70728883-70728905 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1192522994 X:71817374-71817396 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1192532631 X:71902491-71902513 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1192697578 X:73434031-73434053 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1192719415 X:73677153-73677175 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1192825581 X:74692758-74692780 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1192910755 X:75601917-75601939 GCTCCCAGTTAGGCTACTCGGGG + Intergenic
1193050072 X:77089980-77090002 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1193088752 X:77471337-77471359 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1193154318 X:78157306-78157328 CCTACCAGTTAGGCTACTCGGGG + Intergenic
1193157502 X:78189563-78189585 GCCTCCCAGTAAGCTGCTCGGGG - Intergenic
1193189188 X:78549374-78549396 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1193457032 X:81743861-81743883 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1193757562 X:85427130-85427152 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1194191023 X:90836929-90836951 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1194370097 X:93060888-93060910 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1194648483 X:96487148-96487170 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1194656942 X:96584661-96584683 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1194813547 X:98415702-98415724 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1194924288 X:99805902-99805924 CCTCCCAGTTAGGCTACTCGAGG - Intergenic
1195088929 X:101440399-101440421 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1195167582 X:102235899-102235921 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1195191276 X:102451188-102451210 CCTCCCAGTTAGGCTACTCGGGG - Intronic
1195215057 X:102691302-102691324 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1195456770 X:105078454-105078476 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1195508323 X:105684744-105684766 TCTCCCAGTTAGGCTACTCGTGG - Intronic
1195723529 X:107890539-107890561 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1195764113 X:108277712-108277734 CCTTCCAGTTAGGCTGCTCGGGG - Intronic
1195832240 X:109072046-109072068 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1195932809 X:110096108-110096130 CCACCCAGTTAGGCTACTCGGGG + Intronic
1195987394 X:110645437-110645459 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1196474684 X:116068868-116068890 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1196853616 X:119962173-119962195 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1196863717 X:120051791-120051813 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1196879382 X:120184539-120184561 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1197057703 X:122140712-122140734 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1197123365 X:122916425-122916447 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1197432522 X:126383853-126383875 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1197574897 X:128199642-128199664 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1197667750 X:129241561-129241583 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1197678080 X:129352523-129352545 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1197737080 X:129859066-129859088 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1197909226 X:131462299-131462321 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1197988203 X:132289896-132289918 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1198165284 X:134049582-134049604 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1198172194 X:134117884-134117906 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1198712856 X:139524255-139524277 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1198895368 X:141448579-141448601 TCTCCCGGTTAGGCTACTCGGGG - Intergenic
1199481680 X:148305138-148305160 CCTCCCAGTTAGGCTACTCGCGG + Intergenic
1199884634 X:152007475-152007497 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1199936843 X:152582605-152582627 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1199968472 X:152840737-152840759 GTCTCCAGTTAGGCTACATGAGG + Intronic
1200288483 X:154848207-154848229 CCTCCCAGTTAGGCTACTCGGGG + Intronic
1200426967 Y:3032267-3032289 CCTTCCAGTTAGGCTACTCAGGG + Intergenic
1200678283 Y:6177093-6177115 CCTCCCAGTTAGGCTACTCGTGG - Intergenic
1200879170 Y:8194175-8194197 CCCCCCAGTTAGGCTACACGGGG - Intergenic
1201308302 Y:12570279-12570301 TCTCCCAGTTAGGCTACTCGGGG - Intergenic
1201425953 Y:13851348-13851370 CCTTCCAGTTAGGCTGCTCGGGG + Intergenic
1201620022 Y:15946379-15946401 GCCCCCAGTTAGTCTACTTGGGG + Intergenic
1201645248 Y:16223290-16223312 CCCCCCAGTTAGGCTGCTCGGGG + Intergenic
1201657565 Y:16362032-16362054 CCCCCCAGTTAGGCTGCTCGGGG - Intergenic
1201731917 Y:17213455-17213477 CCTCCCAGTTAGGCTACTCGGGG - Intergenic
1201920860 Y:19232238-19232260 CCTCCCAGTTAGGCTACTCGGGG + Intergenic
1202166544 Y:21995549-21995571 TCGCCCAGTTAGGCTACTCGGGG + Intergenic
1202242046 Y:22781074-22781096 CCTCCCAGTTAGGCTACTCGAGG + Intergenic
1202253913 Y:22901424-22901446 TCTTCCACTTAGGCTACTCGGGG + Intergenic
1202298302 Y:23383857-23383879 CCCCCCAGTTAGGCTGCTCGGGG + Intergenic
1202333344 Y:23778425-23778447 CCGCCCAGTTAGGCTACTCGGGG + Intergenic
1202395030 Y:24414818-24414840 CCTCCCAGTTAGGCTACTCGAGG + Intergenic
1202406903 Y:24535173-24535195 TCTTCCACTTAGGCTACTCGGGG + Intergenic
1202463878 Y:25134908-25134930 TCTTCCACTTAGGCTACTCGGGG - Intergenic
1202475754 Y:25255274-25255296 CCTCCCAGTTAGGCTACTCGAGG - Intergenic
1202537425 Y:25891638-25891660 CCGCCCAGTTAGGCTACTCGGGG - Intergenic
1202572507 Y:26286742-26286764 CCCCCCAGTTAGGCTGCTCGGGG - Intergenic