ID: 1091046373

View in Genome Browser
Species Human (GRCh38)
Location 11:132329428-132329450
Sequence CTGTAGAAATGCTGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 285}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091046373_1091046382 11 Left 1091046373 11:132329428-132329450 CCAGCCTCCCAGCATTTCTACAG 0: 1
1: 0
2: 2
3: 24
4: 285
Right 1091046382 11:132329462-132329484 CAAGTGCAACTGTAGCAGCACGG 0: 1
1: 0
2: 1
3: 11
4: 135
1091046373_1091046384 17 Left 1091046373 11:132329428-132329450 CCAGCCTCCCAGCATTTCTACAG 0: 1
1: 0
2: 2
3: 24
4: 285
Right 1091046384 11:132329468-132329490 CAACTGTAGCAGCACGGGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 85
1091046373_1091046383 12 Left 1091046373 11:132329428-132329450 CCAGCCTCCCAGCATTTCTACAG 0: 1
1: 0
2: 2
3: 24
4: 285
Right 1091046383 11:132329463-132329485 AAGTGCAACTGTAGCAGCACGGG 0: 1
1: 0
2: 0
3: 9
4: 123
1091046373_1091046385 18 Left 1091046373 11:132329428-132329450 CCAGCCTCCCAGCATTTCTACAG 0: 1
1: 0
2: 2
3: 24
4: 285
Right 1091046385 11:132329469-132329491 AACTGTAGCAGCACGGGTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091046373 Original CRISPR CTGTAGAAATGCTGGGAGGC TGG (reversed) Intronic
900939309 1:5787522-5787544 CTGTCAAAATCCTGGGAGGAGGG - Intergenic
901080466 1:6581006-6581028 CTGTTCACATTCTGGGAGGCAGG - Exonic
901177302 1:7313814-7313836 CTGTGAAAAGGCTGGAAGGCAGG + Intronic
901215520 1:7552742-7552764 CTGCAGCAAAGCAGGGAGGCTGG + Intronic
902859650 1:19235924-19235946 CTCTAGAAAATCTGGGAGACAGG - Intronic
905510198 1:38513313-38513335 CTGTGCAAAGGCTTGGAGGCAGG - Intergenic
905823071 1:41009184-41009206 CTACAGAAATCCTGGGAGCCAGG + Intronic
907422700 1:54357840-54357862 ATGTGGAAAGACTGGGAGGCAGG - Intronic
909016315 1:70383638-70383660 GAGTAGAAATGCTGGCATGCTGG - Intronic
909370443 1:74877543-74877565 CTGCAGAAAGGCTGGGGGGCGGG + Intergenic
912485354 1:110023015-110023037 ATGCAGAAATGCTGGGAAGCAGG - Exonic
912556570 1:110520501-110520523 CAGTAGGATGGCTGGGAGGCAGG + Intergenic
912582881 1:110736054-110736076 CTATAGGAAAGCAGGGAGGCCGG - Intergenic
912665062 1:111571366-111571388 CTTCAGAAAGGGTGGGAGGCAGG - Intronic
913233453 1:116761066-116761088 CTGCAGAAACCCTGGGGGGCAGG + Intronic
915792366 1:158687706-158687728 CTTTAAAAATTCTGTGAGGCAGG + Intergenic
918045668 1:180939546-180939568 CAGGAGAAGTGGTGGGAGGCAGG - Intronic
918664848 1:187138057-187138079 ATGTTGAAATAATGGGAGGCTGG + Intergenic
918900846 1:190415123-190415145 CTATATAGATGTTGGGAGGCAGG - Intronic
920188662 1:204178539-204178561 CTGCATACATGGTGGGAGGCAGG - Intergenic
920675730 1:208037442-208037464 CTGTAGAGGGGCTGGCAGGCTGG - Intronic
920688709 1:208129475-208129497 CTGCAGAAATTCTGTGAGGATGG + Intronic
921333905 1:214067030-214067052 CAGTAGAAATTTTGGAAGGCAGG - Intergenic
921376619 1:214480910-214480932 CAGCAGATATGCTGGGCGGCTGG + Intronic
921671694 1:217931957-217931979 CTGAAATAATGCTGGGAGACTGG + Intergenic
923750669 1:236743441-236743463 ATGTAGAAAATCTGGGAGGGAGG + Intronic
1062838437 10:651181-651203 CTGTAGATATGCGTGGAGGACGG - Exonic
1063311105 10:4952800-4952822 CTGGAGAAATGCAGAGATGCAGG + Intronic
1063316693 10:5013595-5013617 CTGGAGAAATGCAGAGATGCAGG - Intronic
1064098300 10:12440793-12440815 CTGTATATATGATGGGATGCAGG + Intronic
1064440035 10:15345508-15345530 CTGTATAAAGGCAGGGTGGCCGG + Intronic
1064604985 10:17029845-17029867 TTGTAGGAAAACTGGGAGGCAGG + Intronic
1065155725 10:22868573-22868595 CTGCAGAAAGGGTGAGAGGCCGG + Intergenic
1065285247 10:24181366-24181388 CTGTAGAAAGGCTCTGAGGTGGG + Intronic
1067803646 10:49377657-49377679 TTACAGAGATGCTGGGAGGCTGG - Intronic
1068076354 10:52260129-52260151 CTGAAAAAGTGCTGGGAGACAGG - Intronic
1069217858 10:65844737-65844759 CAGGAGAATTGCTTGGAGGCAGG - Intergenic
1069535656 10:69250728-69250750 CTGTAAAAATGAAGGCAGGCTGG - Intronic
1072121839 10:92411566-92411588 CAGTAGAAATGCTGCAAGGCTGG + Intergenic
1073328722 10:102657289-102657311 CTGTAGAAATCCTGGTGGCCGGG - Exonic
1075662852 10:124210127-124210149 CTGTGGAAATGCTTGGATTCTGG + Intergenic
1075680129 10:124325589-124325611 CTATACAAAGGCTGGAAGGCAGG - Intergenic
1077738517 11:4818062-4818084 GGGTAGAAATACTGGGAAGCAGG + Intronic
1077981641 11:7307041-7307063 CTGTAATAATGGTGTGAGGCTGG + Intronic
1079199945 11:18368365-18368387 CTGTAGAAATGCTGTTACTCAGG - Intergenic
1079333419 11:19551701-19551723 CTGTAGAAATGAGAGGAAGCAGG - Intronic
1079457184 11:20646528-20646550 TTGTAGCAATGCTGAGAGTCTGG + Intronic
1079985408 11:27195121-27195143 CTGGAGAAATGCTGGCAGACTGG - Intergenic
1080041105 11:27760333-27760355 CTCTAGAAATCCTGGAAGGTAGG + Intergenic
1081975505 11:47232045-47232067 CTTAAGAAATGAAGGGAGGCGGG + Intronic
1083274182 11:61587628-61587650 CTGCAGAATTCCTGGGGGGCGGG + Intergenic
1083457926 11:62791508-62791530 CGGCTCAAATGCTGGGAGGCCGG - Intronic
1084805550 11:71576627-71576649 CTGGAGAAATGCTCTGAGGGAGG + Intergenic
1085407695 11:76273187-76273209 CGGGAGAATTGCTTGGAGGCGGG + Intergenic
1085844584 11:80050775-80050797 CTGTAGATAGGCTGGCAGCCTGG - Intergenic
1086064299 11:82730972-82730994 CTGTAGAACTGCGGGGAGAAAGG - Exonic
1088080519 11:105906459-105906481 CCGAAGAAAGGCTTGGAGGCAGG + Intronic
1088314308 11:108491543-108491565 TTGTAGAGATGGTGGGGGGCGGG + Intronic
1088551284 11:111014733-111014755 CTTTAGGAAGGGTGGGAGGCAGG - Intergenic
1088661561 11:112052613-112052635 CTGTGGAAGTGCTGGAAGGGTGG - Intronic
1088690491 11:112322522-112322544 GTGTAATATTGCTGGGAGGCAGG + Intergenic
1089288014 11:117420071-117420093 CTGTAGAAATGCCTGGGGGAGGG + Intergenic
1090541736 11:127713331-127713353 CTATAGACATCCAGGGAGGCTGG + Intergenic
1090888850 11:130904843-130904865 CTGTAAAGATGGTGGGGGGCAGG - Intronic
1091046373 11:132329428-132329450 CTGTAGAAATGCTGGGAGGCTGG - Intronic
1091303593 11:134523426-134523448 CTCTGGGAATGCGGGGAGGCTGG + Intergenic
1091696316 12:2630500-2630522 CTGTTGAAATAGTGGGAGGAGGG + Intronic
1092463005 12:8702987-8703009 CATTAGAAATGTTTGGAGGCTGG + Intronic
1093845538 12:23966164-23966186 CTGAAGAAATCTGGGGAGGCGGG - Intergenic
1096194947 12:49643806-49643828 CTGTGGATAGCCTGGGAGGCAGG - Exonic
1097355153 12:58593056-58593078 CTGTAGCAAAGCTGTCAGGCAGG + Intronic
1098113968 12:67155016-67155038 TTCTAGAAATACTGTGAGGCGGG - Intergenic
1099017675 12:77364279-77364301 CTGTAAAAGTGTTGGAAGGCAGG + Intergenic
1100867776 12:98875641-98875663 ATCTATAAATGGTGGGAGGCAGG + Intronic
1102571911 12:113831893-113831915 CTGCAGCAGTGCAGGGAGGCTGG - Intronic
1102813212 12:115841835-115841857 CTGTAAATATGCTGGGTGACAGG + Intergenic
1103160314 12:118723689-118723711 CTGGAGAAACACTGGGAGCCAGG + Intergenic
1103724896 12:122992633-122992655 TTGTAGACTTGCTGGCAGGCCGG + Exonic
1104072911 12:125362018-125362040 CTGCAGTCATGCTAGGAGGCTGG + Intronic
1105946329 13:25192873-25192895 GTGAAGAAATGCTGGGAAACTGG + Intergenic
1106105771 13:26732289-26732311 ATTTAAAAATGGTGGGAGGCTGG - Intergenic
1106599411 13:31175013-31175035 CTGCAGTAATGCTGGGGGCCTGG - Intergenic
1106804109 13:33288500-33288522 CAGGAGAAATGCTGGAAGCCAGG - Intronic
1107260996 13:38491010-38491032 ATGTAAAAATGGTGGGAGGCTGG - Intergenic
1107361871 13:39626908-39626930 CAGGAGAATTGCTTGGAGGCAGG + Intergenic
1109164872 13:59021238-59021260 ATATGGAAATGCTGGGAGGGTGG + Intergenic
1109790482 13:67241034-67241056 CAGGAGAATCGCTGGGAGGCAGG + Intergenic
1110819961 13:79902691-79902713 GTGGAGAAATGTTGGGAGGCAGG - Intergenic
1111724517 13:91988912-91988934 CTGCAGTCATCCTGGGAGGCAGG + Intronic
1112949147 13:104969640-104969662 CTGTAGAAATGTCTTGAGGCCGG + Intergenic
1113156238 13:107326132-107326154 AGGCAGAAATGCTAGGAGGCAGG + Intronic
1114613810 14:24057979-24058001 CTGAAGAACTGCTTGAAGGCCGG - Exonic
1118346010 14:64941442-64941464 CTGAAGAGATGGTGTGAGGCTGG + Intronic
1118443334 14:65831069-65831091 CTGAAGAGATGATGGGAGGAAGG + Intergenic
1119288330 14:73474415-73474437 ATCAAGAAATGATGGGAGGCCGG + Intergenic
1119291979 14:73502513-73502535 CTCAACAAATGCTGGGTGGCTGG + Intronic
1120691159 14:87594665-87594687 CTGTAGAAGGGTTGGGAGGAAGG - Intergenic
1121175655 14:91889050-91889072 CTCCAGAGATGCTAGGAGGCAGG - Intronic
1121745354 14:96285542-96285564 CTATAGAAATGTTTGGTGGCTGG - Exonic
1124552429 15:30693826-30693848 ATGTATAAATGCTGAGTGGCTGG - Intronic
1124678811 15:31711840-31711862 GTGTATAAATGCTGAGTGGCTGG + Intronic
1124695322 15:31859626-31859648 CTTTATAAATGCAGGGAGACAGG - Intronic
1125439735 15:39689245-39689267 ATGTAGAGGTGCTGGGAGGGTGG - Intronic
1127389550 15:58494312-58494334 GGGTACAAATCCTGGGAGGCAGG + Intronic
1127689970 15:61385869-61385891 CTGTAAAAAGGATGGGAGGGAGG - Intergenic
1128909790 15:71503281-71503303 ATGGAAAAATGCTGGGAGGGTGG + Intronic
1129163466 15:73761107-73761129 CTGCAGAAATCCAGGAAGGCTGG - Intergenic
1131239289 15:90724748-90724770 ATGTAGAGATGGTGGGAGGCTGG - Intronic
1131340083 15:91590870-91590892 ATAAAGAATTGCTGGGAGGCTGG + Intergenic
1132311597 15:100861732-100861754 ACGCAGAAATGCTGGGAGGCTGG - Intergenic
1133146960 16:3795078-3795100 ACGTAGAAAAGCTGGGTGGCTGG + Intronic
1133974626 16:10591762-10591784 CTGAAAAAATACTGGGAAGCTGG + Intergenic
1138110090 16:54316801-54316823 CTGTGGAAGCGCTGGGAAGCAGG - Intergenic
1138282338 16:55781479-55781501 TTGGAGAAATGCTGTGGGGCAGG - Intergenic
1138286605 16:55815165-55815187 TTGGAGAAATGCTGTGGGGCAGG + Intronic
1140732748 16:77871332-77871354 CTGTAGAAATGCCGAGAGAGAGG + Intronic
1141088493 16:81113777-81113799 CTGTAGAATAGCTAGAAGGCAGG - Intergenic
1143013575 17:3879720-3879742 CTGTAGGAGTGCCGGGGGGCTGG - Intronic
1144139877 17:12337833-12337855 GTGTATATATGTTGGGAGGCTGG + Intergenic
1145029269 17:19492290-19492312 ATGCAGCAATGTTGGGAGGCAGG + Intergenic
1145207259 17:20991188-20991210 CTGTGTCACTGCTGGGAGGCTGG + Intergenic
1145763581 17:27442666-27442688 CTGTGGAGATGCTGAAAGGCAGG + Intergenic
1150663477 17:67107457-67107479 CTGTGGAAATGCTGGGTTGCTGG + Exonic
1150920759 17:69479823-69479845 CAGGAGAATTGCTTGGAGGCAGG - Intronic
1150925497 17:69527823-69527845 TTTTAGAAGTGCTGTGAGGCAGG + Intronic
1151278682 17:73055607-73055629 ATGTAGAAATGAGGGAAGGCGGG + Intronic
1152116350 17:78390007-78390029 TGGCAGAAATGCTGTGAGGCAGG + Intronic
1152266680 17:79298982-79299004 CTGATGCAAGGCTGGGAGGCGGG + Intronic
1152583720 17:81180093-81180115 CTGGAGACAGGGTGGGAGGCAGG - Intergenic
1159215223 18:65383837-65383859 ACCAAGAAATGCTGGGAGGCCGG + Intergenic
1159456799 18:68669471-68669493 ATGTGGTAATGGTGGGAGGCAGG + Intergenic
1160896706 19:1406311-1406333 CCGGAGAAATGCTTGAAGGCAGG - Intergenic
1161469331 19:4448405-4448427 GTGGAGAAGTGCTGGGAGGAGGG + Exonic
1162380260 19:10327722-10327744 CTGTAGCAACCCTGAGAGGCAGG - Intronic
1163563115 19:18032697-18032719 GTGTAGAAAGTCTGGGAGGGGGG - Intergenic
1163760150 19:19132101-19132123 CAGTAGAAATGCCAGGAGGCAGG - Intronic
1164514550 19:28922696-28922718 CTGTAACCATGCTGAGAGGCAGG + Intergenic
1165115077 19:33523704-33523726 CAAAAGAAATGGTGGGAGGCAGG - Intergenic
1165338709 19:35194645-35194667 AAGTGGAAATGCTAGGAGGCAGG - Intergenic
1166745443 19:45139893-45139915 CTGTGCAAAGGCTGTGAGGCAGG - Intronic
1166826641 19:45613975-45613997 TTGGAGAAATGCAGGGAGGCAGG - Intronic
1167209318 19:48123103-48123125 CTGGGGACAGGCTGGGAGGCCGG + Intronic
1167242847 19:48355392-48355414 CTGTGGAAGAGCTTGGAGGCAGG + Intronic
1167391508 19:49198076-49198098 CAGTAGACACGCTGAGAGGCAGG + Intronic
1168687954 19:58359523-58359545 CTCAAGAAAAGCGGGGAGGCGGG - Intronic
925276465 2:2651668-2651690 CTGTGGGAAAGCAGGGAGGCAGG + Intergenic
925810187 2:7692866-7692888 CTGTTGCAATGCTGGCAGGGTGG - Intergenic
926151629 2:10428733-10428755 CTGAAGGCCTGCTGGGAGGCAGG - Intergenic
927677202 2:25114787-25114809 CTATAGAAATGTTCTGAGGCAGG - Intronic
929152273 2:38758100-38758122 CTGTAGAGATGGTGGGGGTCAGG + Intronic
929755128 2:44757900-44757922 CTGGAGAAATGCTGGTGGGAGGG + Intronic
931316499 2:61137670-61137692 ATGTAAAAATGCTGGGTGGTGGG - Intronic
931645584 2:64418927-64418949 CTGTGCAGATGCTGGGAGGATGG - Intergenic
933293525 2:80464109-80464131 CTGCAGTGATGCTTGGAGGCTGG - Intronic
934147694 2:89111567-89111589 CTTTAGAAACCTTGGGAGGCTGG + Intergenic
934221581 2:90089034-90089056 CTTTAGAAACCTTGGGAGGCTGG - Intergenic
938375080 2:130799581-130799603 TAGTAGACATCCTGGGAGGCTGG - Intergenic
939122413 2:138133669-138133691 CTTTAGAAATGCAGGGACTCTGG - Intergenic
939475273 2:142678789-142678811 CAGTAGAAGTGCTGGGAGGTTGG + Intergenic
940278668 2:151966573-151966595 TTGAAATAATGCTGGGAGGCTGG - Intronic
942082679 2:172416225-172416247 CTGTAGAGTTTCTGGTAGGCAGG - Intergenic
942366014 2:175228659-175228681 CTGTGGAAATGCTGAGTTGCAGG - Intergenic
942610516 2:177737639-177737661 CTACAGGAATGCTGGGAGGGTGG + Intronic
943752075 2:191519886-191519908 CAGTGGAAATGATGGGAAGCAGG - Intergenic
944652679 2:201847457-201847479 CTGGAGAAAATCTGGGAGGTAGG + Exonic
945225515 2:207529159-207529181 CTGGAGAAAGGCGGGGAGGTAGG + Intergenic
946907567 2:224431093-224431115 CTGTAGAAATGTTCCCAGGCAGG - Intergenic
947406451 2:229782296-229782318 CTGTAGAAGTGTTGGGAGAAGGG - Intronic
1168962084 20:1876831-1876853 TTTGAGAAAGGCTGGGAGGCGGG - Intergenic
1169663057 20:8001495-8001517 CTGAAAAAATGCTGGGAGAGTGG + Exonic
1169723208 20:8701324-8701346 CTGTGCAAAGGCTGTGAGGCGGG - Intronic
1171238462 20:23546621-23546643 CCATAGAAGTGCTGGGAGGGTGG - Intergenic
1172729728 20:37076007-37076029 GTGGAGAAAAACTGGGAGGCAGG - Intronic
1172829831 20:37824188-37824210 CTGAAGAAGTGCTATGAGGCTGG - Intronic
1173340736 20:42150460-42150482 GTGGAGAAATCCTGGCAGGCTGG - Intronic
1173880983 20:46412098-46412120 CTGTAGACTCGCTGGGTGGCTGG + Intronic
1174457571 20:50660588-50660610 CTGTGGCAGTGTTGGGAGGCGGG - Intronic
1174631750 20:51964297-51964319 TTTAAGAAATCCTGGGAGGCAGG + Intergenic
1175222492 20:57425472-57425494 CTGAGGAACTGCAGGGAGGCCGG + Intergenic
1175745811 20:61456203-61456225 CAGTACAAATGCTGGGCAGCAGG - Intronic
1175769549 20:61614908-61614930 CTCTCGCAGTGCTGGGAGGCTGG - Intronic
1178016817 21:28356313-28356335 CAGCAGAAATGCTGGGAATCTGG - Intergenic
1178922960 21:36751420-36751442 CTGAAGCAGTGCGGGGAGGCTGG + Exonic
1179973522 21:44849519-44849541 CGCTTGGAATGCTGGGAGGCAGG - Intergenic
1180701115 22:17781857-17781879 CTGCAGAAGCTCTGGGAGGCTGG + Intergenic
1181922976 22:26334898-26334920 ATGGAGAGATGCTGGCAGGCAGG - Intronic
1182255048 22:29031858-29031880 CTGCTGAAATGCAGGGCGGCAGG - Intronic
1182360106 22:29741268-29741290 ATGTCGAGATACTGGGAGGCTGG + Intronic
1182567749 22:31212547-31212569 CCTCAGAAAAGCTGGGAGGCGGG + Intronic
949184692 3:1176163-1176185 TAGTAGAAATATTGGGAGGCCGG + Intronic
950160472 3:10756967-10756989 CTTTAGAAAAGCTGGATGGCAGG + Intergenic
950855082 3:16097212-16097234 CTGTGGTACTGCTGGGAGGTGGG + Intergenic
951086863 3:18521852-18521874 CAGGAGAAAGGCTGGGAGGCTGG - Intergenic
952307117 3:32156111-32156133 CTGGAGAGATGCTGGGGGGTCGG - Intronic
952560964 3:34592931-34592953 CTCTAGAAATGCAGGGTCGCAGG + Intergenic
954465148 3:50649901-50649923 GTGCAGAGATGCTGGAAGGCAGG + Intergenic
954674319 3:52307356-52307378 CAGTGGGAATGATGGGAGGCTGG + Intergenic
955148887 3:56347397-56347419 CTGGAGGAAAGCTGGGAGGCTGG + Intronic
955500855 3:59581179-59581201 CTGTAGAAATTCTGGGGAACAGG - Intergenic
956493493 3:69799298-69799320 ATGAAGAAATGCAGGGAGGGAGG + Intronic
956724450 3:72145681-72145703 CTCTAGAAATCCTGGGAGCTTGG - Intergenic
959780080 3:110220816-110220838 CTGTAGAAAAGCTTGGAAGTTGG + Intergenic
962722157 3:138186238-138186260 CTGTTGAATTCCTGGAAGGCAGG - Intergenic
962806365 3:138930233-138930255 TTGTAGAGATGGTGGGGGGCGGG + Intergenic
963052254 3:141152233-141152255 CTGTGGGAATGCAGGGAGCCTGG - Intergenic
963688120 3:148463567-148463589 CAGGAGAAAGGGTGGGAGGCGGG + Intergenic
964384287 3:156130819-156130841 CTATCAAAAGGCTGGGAGGCTGG + Intronic
966266330 3:178048920-178048942 CGGTAGAAATGATGGGAACCTGG - Intergenic
966735949 3:183187279-183187301 CTGTAGTAAGGCTGGCAGACAGG + Intronic
966922190 3:184619723-184619745 CTGGAGCAAGGCTGGGAGGCTGG - Intronic
967208660 3:187147570-187147592 CTGGAGACAGGCTGGGGGGCGGG + Intronic
967883196 3:194315817-194315839 CTGTGGCACCGCTGGGAGGCCGG - Intergenic
969106392 4:4810078-4810100 CTTCAGCAATGCTGTGAGGCAGG + Intergenic
970519322 4:16866072-16866094 CTGTAGATATCCTGTTAGGCAGG - Intronic
972092191 4:35301217-35301239 CAGCAGAAAAGCTGGGAGCCCGG - Intergenic
972336665 4:38113042-38113064 CGGTAGCAAGGCTGGGAGGAAGG + Intronic
972344836 4:38183959-38183981 ATGTAGACAGGCTGGGAGGAAGG + Intergenic
973024601 4:45251509-45251531 ATCTAGAAATGGTGGGAGGCTGG + Intergenic
973226366 4:47789722-47789744 CTATAAAAATGCTAAGAGGCCGG + Intronic
975366378 4:73534028-73534050 CTGTAGAACTGCTGAGTGGCAGG - Intergenic
976561323 4:86504899-86504921 CTGTAGGCAAACTGGGAGGCAGG - Intronic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
976831230 4:89317016-89317038 CTGTATAAAAGCTCTGAGGCAGG + Intergenic
977072562 4:92409777-92409799 CTGCAGAAATTCTGGGAGAGAGG + Intronic
977148693 4:93480890-93480912 CTGTAGAGATTCAGGGAGGTGGG - Intronic
977409428 4:96642545-96642567 CCGTGGAAATGCTGGGAGGCAGG + Intergenic
978503977 4:109436828-109436850 ATGTGGAGATGCTGGGAGGGTGG + Intronic
978858275 4:113418233-113418255 CTGCTGAACTGCTGGGTGGCTGG - Intergenic
980401393 4:132290599-132290621 CTGGAGAAATGGTGGGATGGGGG + Intergenic
981131200 4:141160343-141160365 CTGGGGAAATGCTGGTTGGCAGG + Intronic
981522388 4:145676722-145676744 CTGGGGCAATGGTGGGAGGCAGG - Intergenic
981731995 4:147909287-147909309 ATGAGGAAGTGCTGGGAGGCTGG - Intronic
982073752 4:151718539-151718561 CAGTAGACTTGCTGAGAGGCTGG + Intronic
983917957 4:173312551-173312573 ATGTGGCAATGCTGGGAGGCAGG - Intronic
983944999 4:173576065-173576087 TTGCAGAAATGATGGGAGGCTGG - Intergenic
984487364 4:180388233-180388255 ATGTAAACGTGCTGGGAGGCAGG + Intergenic
985857771 5:2443467-2443489 TTGTACAATTGCTGGGAGCCTGG + Intergenic
988698019 5:33643508-33643530 CTATAGAAATGCTTTGTGGCAGG - Intronic
992350906 5:75928348-75928370 CTGCAGAAATGTTGGGAGTTTGG + Intergenic
993029791 5:82692944-82692966 TTGTAGAAATGCTGGGAGACTGG + Intergenic
995513716 5:112933790-112933812 CTGGTGAAATACTGGGAGACTGG - Intergenic
996142074 5:119923852-119923874 CTGCTGTAATGCTGGGGGGCTGG + Intergenic
996544983 5:124668650-124668672 CTGGAGAAGTGCTGAGAGCCAGG - Intronic
997724313 5:136107282-136107304 ATAAAGAAATGCTGGGAGGCTGG - Intergenic
998008484 5:138673901-138673923 CAGAAGTAATGCTGAGAGGCTGG + Intronic
999106035 5:149071990-149072012 CAGTAGAGGTGCTGGGAGGATGG + Intergenic
1000443860 5:161296163-161296185 TAGTAGAAATGCTGGGAGTGGGG + Intronic
1001285259 5:170418447-170418469 CTGGAGAAATGATGGGAAGAGGG - Intronic
1001722224 5:173866402-173866424 CTGTAGAAATGGTTGGAAGGCGG + Intergenic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1002848906 6:973822-973844 TTGGAGAAAGGGTGGGAGGCAGG - Intergenic
1003034376 6:2630395-2630417 CTTTAGCAATGCTGGAAGCCAGG + Intronic
1005954124 6:30651597-30651619 CTGGAGAATTGCTGGAAGCCGGG - Intronic
1006077738 6:31545287-31545309 CCCTAGAAATCCTGGGAGGCAGG - Exonic
1006091930 6:31633421-31633443 CAGCAGAACTGCTGGGAGGTGGG - Exonic
1008342758 6:50387682-50387704 CTGTAGACATGGTGAGAGGAGGG - Intergenic
1011486392 6:87846220-87846242 ATGTAGAATGGCTTGGAGGCAGG - Intergenic
1012737901 6:102974094-102974116 TTGTAGACTTGCTGGGTGGCTGG + Intergenic
1013749576 6:113388036-113388058 CAGTGGAAATGCTGGGTGGAAGG + Intergenic
1014911570 6:127100356-127100378 CTGTAGAAATCTTGGAAGTCTGG - Intergenic
1014983325 6:127972056-127972078 CTGTAGAAAGGGTGGAAGTCTGG + Intronic
1015035513 6:128649472-128649494 GTGTGGCAATGCTGGGAGGTGGG + Intergenic
1016553839 6:145313024-145313046 CAGTAGCAATGCTTGGAGGATGG + Intergenic
1018029985 6:159834177-159834199 CTGTACATGGGCTGGGAGGCAGG + Intergenic
1018243729 6:161802518-161802540 CCGGAGAAAGGCTGGGAGCCAGG - Intronic
1018846437 6:167560087-167560109 CTGCAGAGATGCTGGGAGAAGGG - Intergenic
1019622452 7:1999255-1999277 CTGTAGAAATACTGGGGGGTGGG - Intronic
1020911938 7:14142049-14142071 ATGGAGAAATGCTGGCTGGCAGG + Intergenic
1022430363 7:30313512-30313534 CAGTAGAAAGGCAGGGAGGGAGG - Intronic
1023162275 7:37309002-37309024 CAGGAGAAATGCTTGGAGTCAGG + Intronic
1023949303 7:44829302-44829324 CTTAAGAAATGCTGGTTGGCTGG + Intronic
1024512195 7:50212990-50213012 CTGGAGAAAGAGTGGGAGGCAGG + Intergenic
1026861431 7:73792680-73792702 CTGTGGAACTGCTTGGAGGATGG - Intergenic
1026969729 7:74460702-74460724 ATTTAGAGATGCTGGGAGGAGGG + Intronic
1031087592 7:117318824-117318846 CTGTAGAATTGCTGAGATGAAGG - Intronic
1032617433 7:133489818-133489840 GAGAACAAATGCTGGGAGGCAGG - Intronic
1034330319 7:150277115-150277137 TTGTAGGAAGGCTGGCAGGCTGG - Intronic
1034882797 7:154775443-154775465 CAGTAGAAATGCTGGTTGGGTGG - Intronic
1041635206 8:60134893-60134915 CCCCAGAAATGCTGGGAGACAGG - Intergenic
1042760445 8:72266678-72266700 CTTTAGAAATGCTGTGTGGATGG - Intergenic
1043529689 8:81135570-81135592 CTGGGGACATTCTGGGAGGCGGG - Intergenic
1044702906 8:94980534-94980556 CTGGAGAATTGCTTGGAGCCAGG - Intronic
1044755974 8:95461595-95461617 CTGTAGAAAGGCTGGAAGAGAGG + Intergenic
1045137049 8:99232801-99232823 CTGCAGAAGTCCTGGGAGGTAGG + Intronic
1046181614 8:110656199-110656221 GTGCAGGAATGCTGGGATGCAGG - Intergenic
1047358512 8:124145766-124145788 CTGGAGAGCTGGTGGGAGGCTGG - Intergenic
1048822255 8:138391208-138391230 CTGGTGAAATGCAGGGTGGCAGG + Intronic
1049196037 8:141316174-141316196 CTGTGGAAATGCGGGGAAGGGGG + Intergenic
1049471803 8:142778006-142778028 CTGTAGCAAAGCTGGAAGGCAGG + Exonic
1050110227 9:2207771-2207793 CTGTAGAAATTCTGCTAGGTTGG - Intergenic
1051892401 9:21956505-21956527 CAGAAGAATTGCTGGGAGCCGGG + Intronic
1055335629 9:75230333-75230355 CTTTAGAGATGGTGTGAGGCAGG - Intergenic
1056332878 9:85536123-85536145 GTGTTGTGATGCTGGGAGGCTGG - Intergenic
1056968347 9:91182648-91182670 CTGATGAAATCCTGGGAGCCTGG + Intergenic
1057493064 9:95537760-95537782 GTGGAGAAATGCTTGGAGACGGG - Intergenic
1057717326 9:97504846-97504868 CTTTAGAAATGTTGGCAGCCTGG - Intronic
1061012645 9:127964472-127964494 CTGTAGGAATCCTGTGAGCCTGG - Intronic
1061028782 9:128067380-128067402 CCGGAGAAGCGCTGGGAGGCGGG - Intronic
1061486334 9:130922329-130922351 CTGGAGAGAGACTGGGAGGCCGG - Intronic
1062447782 9:136602830-136602852 GTGTAGGAATGGTGGGATGCTGG - Intergenic
1186631011 X:11348899-11348921 ATATTGAAATGTTGGGAGGCTGG - Intronic
1186682676 X:11892260-11892282 CTATAGATATGCTCCGAGGCAGG - Intergenic
1189291338 X:39887987-39888009 CTGTAGGGATGGTGGGTGGCTGG + Intergenic
1189386912 X:40544720-40544742 CTGTCAAAATCTTGGGAGGCAGG - Intergenic
1189399746 X:40656553-40656575 CTGTAGAATTGCTGGGTCGGAGG - Intronic
1189665955 X:43354988-43355010 CAGTAGATATCCTGCGAGGCTGG + Intergenic
1191969317 X:66795940-66795962 GTCTAGAGATGTTGGGAGGCAGG + Intergenic
1195030160 X:100919867-100919889 CAGTAGAATTGCTGGGTGGAAGG - Intronic
1195596665 X:106699035-106699057 CTTAAGAAATGCTTGGAGGTAGG - Intronic
1197842700 X:130766609-130766631 TTGTATATATGGTGGGAGGCAGG + Intronic
1198376751 X:136048383-136048405 ATGAAGAAATGCTGCTAGGCAGG - Intergenic
1198822389 X:140662470-140662492 GTGTAGAAATGTGGGGATGCTGG - Intergenic